Equus_caballus Locus ENSECAG00000011547
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000011547
Equus_caballus
ENSECAG00000011547
8
SNORD58, SNORD58, SNORD58
1252..1315, 1938..2002, 3093..3156
5059
TCTAAGGAGGCAACTCGTTTTCAGATCTTCTAAAACATATTCCACACTCCCTTTCTCCT
TTGCTTTCCTCCTCCCCTCTTCAAATCTCGCTCCCCCCACCCCCCCCGGCGGGGAATCTC
GCGAGAGGTCGAGTGACCACGAATTCTCCCAGAAGCTACCGCTCTTCCTCTTCACGTCTG
CGGCCTGAGGTGAGTGTTTCGTAGCGGTACGTCTCCGAGTGCTCAATCCTCTGATCATCG
CCGCCATCCTGGCCTCGGGGGTGCCCATCTCGAGACCCCTGGGAAGAGGACTCTGGCAAC
TACTGATTCCTCGCTGAAGGCGGTGTTCCTCTGCGCGGGGGACGTGTCGGAGCGCCCGAC
TTGGCGCGCCGTGGGCGTACGGTCTCTGCTTCCCGCAGAGGGGCGCGATGGACGGGAATG
GGGGTGGTGGGGTTTCAGGCGGCCCGCGGTCGGGACGGCCTCCGACTCCAGAGGTCCAGT
GTTTCGCGGTGAGTGGTGGCCGCAAGGAGAGAAAGTTGCGGAGCGATAGAGTCGAGTCGG
ATCGAGGCTTCGCTCCTTTGCGCAGGAGCGTTTCAGACTCGCTGGCGTGGTGGCAGTCTG
AAAGTGTGCGGAGGGACAGCGTTGCTGGGGAGGCCGTGTGAGCCCAGGTGGGGTCTGTAG
AGGGCTGTAGTCGAGTTCTTCCGGGTCGGTTTACGCCTGAAGGATCCCGAGTTGGATGGA
AACAGGCTCTGTCTTCTTCGAGGGTCAGAGGGTGATGAGGTCCTTGTCACCAGTCGGGTG
TCAGCGCTGCTGTAGTCACTGGTAGACGTAAAGGGGATGCAGGCTGTGGATGGAGAGCAG
GGCAGCTGCGATGATGGCATTTCTTAGGACACCTTTGGATTAATCATGAAAACAACTACT
CTCTGAGCAGCTGTTGGTAGCATTTGATACGTGTTTAAACTGTAAGTTACTGTAGATGTG
TATTGACAGAATTAACTCTGCTCCCTTGCAGGTGATCTCCGAAAATGGTTCGCTACTCAC
TTGACCCGGAAAACCCTACAAAGTGTAAGTGAACAGGAAAGGGGTGCATGTTTCTTATTT
TGGGGTAAGAGAAACCATAAGATGCCGAAAATTAACGAAAGCTTTGCTCATCTTTTAGCA
TGCAAATCAAGAGGTTCGAATCTTCGTGTCCACTTTAAGGTAGGTGCATCATGGTCATGC
TCTAAGCGTCTTCCATGTGTCCCAGTGTGTTTTGACTATTCTGAAAAGGTAGCTGCCGTG
ATGCTTTCTTAGGACACCTTTGGATTTACAGTGAATATTAATCAGTTCTGAGCAGCCACC
TTTTTGTCTTTAACCATCAGTTTATAATGAGCGCTTTGATGTAGGATTTGTGGAATTGGG
TAAAACTACTAGAGAACTACTTGCGAACCGAGTGTACAGATGAACGTATGCAACAGTAAT
TGTAAGGATAAGATATGGAGTTTAAGAGACTACAGTGAATAAACAGGTTTAGGATTTGTT
TTTTCATAGCTTCAAACCAAGCCCCCCTGGTTCTCAATCACAGATCCGTTTTTCTCACTG
TATTACCTCACCTCCCAAGAATGGAAAGGTTTTAGCACTTGATAATATGTGGACATTTTA
AACATCTGAGAATTTAATGTTAAAGTTACTTTAGAAATGGTGATCCTTTGACATAGTTAA
CGCTCAGTTTATATTATTATATTTAGAACACTCGTGAAACTGCCCAGGCCATCAAGGGTA
TGCACATCCGAAAAGCTACCAAGTATCTGAAGGATGTCACTTTAAAGAAGCAGTGCGTGC
CGTTCCGTCGATACAATGGCGGCGTTGGTAGGTGTGCCCAGGTGAGAATTCGTGGCTGCC
ATTTGAAAAGGCAGAGTATAAGGGAAAGTGATTGAATGGGGTGAGAATGGCTAAGGCCTG
CCTGTAATCAGACTCTGGTTGCTGTGATGACAATCTTAGGACACCTTTGGATTAACCATG
AAAAAAACAATGTTCTGAGCAACCTTGATGTTGGATAAAATAAATGCAACTTGGTTGTAA
CGTTGATTTAAATCAGGAAATGACTAATAGTCTCTCCATTTTCTTTCAGGCCAAACAGTG
GGGCTGGACACAGGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTACTGCACATGCTTAA
GAATGCAGAGAGTAATGCTGAACTTAAGGTACCCGAACCTGTAACATCTTTATATGCATC
CAACTTGGATGATTGTTCCATTAATGTTGCTGTTGTGCAGATTTGTTATACAGATGATAA
AATACCTAGTATTACAAAGGAATAAGTTACCAAATTGATTGTCTTTGTAATGGTACATGT
GGTTTGTTGCCTACATTTGTAATGGAGAGACATGTTAAATTTCAGTTAAGTTAAAATCAA
GTGATATTAATCAACCAAAGACAGGTTTATCCATTTTGGCCATCATCCATTACCATTTTG
CATTTGGAATTCTGGTCCAAAAGTGGAATTAATGTTGGTCTTTCTGGCTGTTGTAACCCT
TCTAGCTGCTAATTCATGCTGCCAAAATCTTACTTATATCAAGGCTTAGAAATTGACACT
ACCAGATCCTGTAACTCCCCTCCCCTTATGACTTTTAAGGACGCCACTTATAAACAAAGT
GCATTTAGCACTGAGTTTTGGTCCGTCCTTAGATTTAAGGAAGGGCACTTAGAATAAAGG
TGAAAACAAGTGTTTGAACAAATAAGCTGTTTAAAGTCTTACGGATTGCCTTTCAAAAAT
GGTCTCATTAAGGCAGGGACTTGATTTTCCAGTAATGTTAAATGATAAAGATGGTGTCTG
ATTTTGTTCCCCCTTTCCTCTTCCCAGGGTTTGGATGTCGATTCTCTGGTCATTGAGCAT
ATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGGACATACAGAGCCCATGGTCGGATC
AACCCCTACATGAGCTCTCCCTGCCACATCGAGATGATCCTTACTGAAAAAGAGCAAATC
GTTCCTAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAGGTAAATTACTCGGCCGTTGCT
CAGCTTCATTTGTGTGTGATACTAGATTTGTGGTTGCTGTGATGACTAACTTAGGACACC
TTTGGAACAACCGTGAAAGAATACTATTCTGAGCAACCGGCAGTTTTTTACTCATTTTGT
TTTGGCTTTCGTGGGTCTCGTTTGTTTCTTGATTAATAGTAAGTAGAACTTTTTATTCAG
TACATCAGAACTATGTGATTATCTGCTGATGGCCCCAGCTAGATGTCCACGGCCACTTCA
CATGCAATATCTCTGGGGCCAGCCTTGTGGCTGACTGGTTAAGATTGCATGCTTTGCGTT
GGTGGCCCTGGTTTTCCGCTGGTTCGGATCCTGGGCCCCGACATGGCACTGCTAATCAAG
CCATGCTGAGGTGGCGTCCCCCATGGCAGAGCCAGAAGGACCTACAACTAGAATATACAA
CTCTGTACCGGAGGGGCGGGGGGCTGCTTTGGGAAGAAGGAGGGAAAAAAGAGAGAAGAT
TGGCAACAGACGTCAACTCAGGTGCCAATCTTTAAAAAAACAATTACATGTCCAAAAATG
GGCCACTCCCTTCACTCCACCACCCTTCTCCCCCCCAAATCTGATAATCTTGTTTTTAGT
AAATGAAGCAAGCAAAGAAACTGGGAATGATTCTAGACTCCTCCCTTCATATTTAATGAA
TTTAGTTTCTGTTGATTTTATCACTTAAATGTTATCCTCCATCCTTGCTGCCACTTGGTC
TTTAACAGCTGGGCTCCCTGCCTCTGAAGAGTCGGCTCTCCTCCACTTTAGATTTCCTCC
TGTCTGCCCCTCCCCCCATACCCCTTTTCTCCGCTAAAGGACTTTTTCCCTTATGTTGAA
GTTTCCAATTAGTTCACTCAACTTTGACCTACTCCTTTAAGATGTAGCTTGGGTTTCTTC
AGGAAACTTAACAGTCCTTTTATTTTTCCCCCCAGATATCCCAGAAGAAACTGAAGAAAC
AAAAACTTATGGCCCGGGAATAAATTCAGCATAAAATAAATGCAAATATAAATAAAAGCA
GAACGCTGGTTGTCTTTATTAGTAAATATATTTCAAATGTCCTCACAAGATGGGTCAAAC
AAGCTCTCTTCTTTCTTTTGATTAGAATTAGAAACACATTGTTCGCCCTGTGCCATTGGT
TTTGGTTCATAAACATGCTGTTTTGAACCTCTCGGTGTTTCTTTGCATAAGACAGAATTT
GAACATGGGGAAATGTCTGAAAGTTTTTTCCAACCACTTTGAGATTGGACACACTGTTAC
AATTCACAAATTCATAGTTCACTGGCTTTTAGTATAGTCACTTATGTAACCATAGTCAAT
TTTAGAACATTTCATTATCCCAAAGAGGGACCTTGGCAGTGGTTAGCTGTCACTCCAGCC
CTAGGGTACCACTTAGTATTTCTGTCTATATAGATTTGCCTATTCTGGATATTTGATACA
AGTGACATCACAATACCCTCATCTGTTGGTATCTGCAGGGGGATATAGAGCGCCTGCCTT
ATATGGCCCTTTGTCACTGGCTTTGACTTAGCCCAATGTTTTCAGGGTTCATGTTGCAGG
ATGTTTCTACTTTGTTATTGACGAACAGTTCGTTCCCTGAGTAGGCTATTTAATGAGTTG
AACATTTCGGTTTTGTGGGGTTTTTTACCTGTTACAAATAGTGCTGCTGTGAGCCTTCGT
GTAGTACAAGTTTTTGGGTAGGCATGTTCTCATTTCTCTTGGGTATGTGCCAAGAGTGGA
ATTGCTGGATCACATGGTAACTTTAGTAAACGTTTGAGAAACCCATTCGTTTTCAATGTA
GTTGTGCCATTTTCAGTCCTACCGGCAGTGTAAGGGTCCCATTTTCTCCATATTCTCCGA
ACACGGTCTCTGATCACATCTAGCTGTCAAGCTGACTTTAATATTAATTTTTCCTGCCCT
TGAATTGAACGACACTCTTAACTAGCCGAGTGAATAACTTAGCCAGAACTGCGTTCGAAA
AGATCCCAGCGATCCCGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 1138..1178, 1706..1840, 2089..2187, 2847..3038, 3995..4059
1001..1043, 1138..1178, 1706..1840, 2089..2187, 2847..3038, 3995..4039
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved