Equus_caballus Locus ZCCHC8
snOPY snoRNA Orthological Gene Database
Equus_caballus ZCCHC8
Equus_caballus
ZCCHC8
8
SNORA9
5488..5622
25208
TGGTGAGGAAGATAGGCCCTGAGCTAACATCTGTGCCAATCTTTCTCTATTTTGTATGT
GGGACACTGCCACAGCATGTCCACAGCATGGTTTGATGAGCAACGTGTAGGTCCACACCC
AGGATCCAAACCTGCTAACCTGGCCACCAAGCAGAGCACACACTTAACCACTATGCCACC
AGGCTGGACCCTGTGTTTTTACTTCAGATATTTTATTTCTTAATATGTTGAATACCCATC
AATATGCCCCTCGACCTGAGAGTGGGAACATTTACGATTTTTCGTTTCTTTCTTTTGCTA
AACTACAGGCTCCCTGAGAGCAGGAACTTCTCTGTTTTGCTCATTCTTGCATCCTCAGAT
CCTAGAACAATGCCTGGCACATTGAACATAGTAAATAAATGTTATTGAATGATTGAACGA
GAGAAGCCACCGAAAGCCACAATGACAAATCTAAAATAGTCTAACGGTCTAGCTAGTTTT
TCATGAAAAAGTGAAACAAGTCCAATAAACTGAAATAGCTTGACCAGGATCACTATGACA
AACTGGATTTCTTTATTTTCTTGTTTGTTTAGCACGCACACCAGAATCTGTGACAAGCCA
TGCGTCGTGCTCTGATTTTTCAGCCTTAGATGCATAACAGAGACAATTCATACTGTTTTC
ATACATTCTGATCTAGCCGGGCTTTCTTCACGTTTACAAAGGACCAATCCCAGGATGCAA
TGCAAACAATGAGTTAACAGTCGCTTAGAAACCACATGTCCCAGCATGCCATGCACCCGA
GCAATCTCGGAAGTGGGTATGAGAGACGCCATTGCATTCTGGGAGTTGTAGTCTTTTGGG
ACTCGGCCGCCGCCTGTGCAGCTCCGGCGGTCTACGTTTGGAGAAAACCTTACTGGGTGG
CTTAGCGAGGCGTAAGCCCTAGAGAGCGGTGCCGCCCTACGACCTTCGCCCCCAGCCGGT
GGCCAGCTCCGCCTCTTCTCGAATCTTTCTCACAGCCCAAAATGGCGGCGGAGGTGGATT
TTGGCGACCTAGAGCTGTTCGAGGCGTTTGACCACCCAGAGGAGTCGATTCCGAAGCCAG
TTCACACCCGCTTCAAGGACGACGACAGCGAGGAGGAGGACGAGAATGGGGTGGGCGAGG
CGGAGCTGCGGGAGCGGCTTCGGCAGTGCGAGGAAACCATCGAGAAGCTCCGCGCCGAGA
ATATCCTTCCCGCTCGCTGGGCCCTGTCACCGGGGCGTGTGGTGGCGGCTGTGCCCGTGA
GGGCGCGGACGGAAATTCCACGAGGGCCAGAATTCCGAGTAATTTCTCTCGCCTCGCAGG
GCTGAGAATGTAGGGTTCGAGCGGGGTAAGCTGCCCCCGGGCAAACCTCTCCCCTACTAG
GATCCGTATCCTGACTAGATTCGCTCCTCCCGCCCGTCCGTCTGGGGCCGGTTTTATGGG
TTATTTTGGACTGTGTCAACGGTTAGATGAATGACTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTAGAGGTGGGG
CTTACGATCGAGCAGCAAAGAGAAATGCTAATGCTCAAACGGGGGTTCATTTTAAAGTCT
ACCACTTTGAAATAGCTCCGTGCTGAAAGGTGCATTGCAAAGTTTTAAGAAAATCGCGCC
AAGTAAGTTTCCGTTTGGCTTTAGTTACATGATTACAGCCTTTCTAGCAAGATTTGTTAG
TGTTAATTTACACTCTTAGAGTTTTGTTTTGTGTTTAGCTATATATACATACAGATGATT
TGGGCTCAGCTAGTTTTCCTTTTAAAATTGGTAAAGACCCCTAAAAGTCGTTGGTGAATC
ATCTTTTAAAAAGTTTTCGAAGTTTGCCTTTTTCCTCGACACTTTATTATGAAAAACTTC
AAAATAGAGAAAAATTGAAAGGATTGCACAGTGAACATCCATAGATTCCATCCCAGATTT
TTCAGTCGTTAGCGGTTTGTTATACTGCATTTGCTTTACCGAAGATCATGATGCTTTGAC
TTGGAGAGTTTTCTTGAGTGAATGGCTGTTTAACTTTTGACGAGACACCGTTGTTTGAAT
AATTCAACCATCAGTCTGTTAATCTCCTTTGAACTACATGGCTCCTTTTGAGAAATATCT
ATGCTGGGAGGGATGAAAACTTCTATCTTAATATTTGGATCCACATGCCTAGCCCTGCAA
CAAAACGGGAGCTCAGTAAGTGTGTCATCCTCAAAATATCTGTGGGTCTTTTAATGTTTA
TAACGTTGTGCTACCGAAAGTGAGAGTTAATAGTCGAATTTTATGATCTTCATGATTCTG
TTTTATGGGGGCTTATATTCCTTAACAAGTAATAACATCAAGAACTTAAAAGAAAATTGA
ACATTCTGACTCGACCAAGGTATGAGATCTTGAAATTACACCATTGTTGTCCTTTATTTT
TTTATCCTTATATGAATATTTAATTACAATTTCTTTGTAAAAAGGATGTTTAGGGTTTTT
GTATTGTTTTTATGTCTTCAGCATACTCTGGAGAAATCAGAGTAATGATCCTTTATTTTT
ACTCTGTGGGGTTAAAATTTAAATTCTCATAGCTGCATTAAACTTTTAAACTGACTTAGT
GGGTGAACATATTTGTGAAACACAATCCAGAAAATTTTGATTTAATGTTCAGACCAGGCA
AGTTGTCAACCCAGCTGTTCCTATTCTGCAAATATTTCTGGGAAGTTAGAATTAAGATTG
CGGTATTGCTCTAGCAAGATTTGTTTACACGATTAAAGTGTATTAGTAAATAGAAATAAT
GCAAGAAAGAGCATTTTAGAAGAAAAGTAGTTGCTTTTGAGAAAAGTACAGTGAGTAGAT
TTGCATTCAGGCATCTGATTTTAACAGAAGATTAAATGCTGATCTCTCTTAATATAAATT
TATTTAACAGGTCACTAAATCTAAAATATGCGCTAAACTGCAGATTTATTATGTGGAATG
GTAATTTCACGTTTTCAGAATTTGGGGGTGCCAGGATGCAGTTTCACATACACTTCTGTG
TCCCTGGTACCAGCCGGAGTAACCAGCTACGTTGGTGACTAAAAGTTTAAAATTTTAGAA
TTTACATGTATTTTGGAATAGCTTCCCCATACCCTACCTTGCTTCCCCTACGTGAGCACG
CTTTGTGGATCTAACTCATTTTTGGTTAGATATCAAATGTGTTGATATAACTAGGATTCC
TCAAATACCATAATTTTTATCTATTTAAAGATACTTTATTCAGATAAGTACACATTTTCA
AAAGAGTTGATCGTTTAAACATTAAATCTTTATTTATAGCATTGTCGCCTTTTCCAATTT
ATAAGAAACAAGCATTAGTATCATGAAAAAGGAATAAATTAATTTTTTTTTAGAATTAGT
ACCCTCCATATTGTCAGACTGATAAAGCATTTTATAGAAAACCAAAGAACAAAAAAGAAA
CAAAGTTTTTTAAATAAAATTTATACCAAGTCTCTTGGTTTAATCCTAATTTTTGGAATT
GTCATGATCAGATGTTTTTCTTCTTTTTTTTCATTAAACGGTATTTTTTTCTTTTTTTTT
CTACTCTATATTATGAAACATTTCAAATAAACAGAAAGTGGGAAAAATAGTAAAAGTAAT
ACCCATATTTTCATCAGATTTAACAATTAATATTTTGTCATATTTTCTTCTTTTAATCTC
ATATGCACATTTTACCCCAAATATTCCATGTTTTTTTTTAAAAAAGACTTTTTCATACGT
AACCACACCATTCTCAGAACTAATAACTGTCATGATTTCCTTAACATTCCCTCTCCAGTC
CGTATTCGGATTTCCCCAGCTGCATGTCTTTATAGCTGATTGCTCAAACTGAACTCCAAT
CAAGGACCATGCAGTTGCTTGTGGTTTTTAAAAAGATGTCTTGTGTTTTTTTGATTTTAT
TTTTCCTTTTTCTCTCCAAAGCGCCCTGGTGCATAGTTGTATATTTTTAGTTGTGGCATG
TGGGACGCCGCCTCAGCATGGCCTGATGAGCGGTGCCATGTCCGCGCCCAGGATCTGTAC
TGGCAAAACCCTGGGCCGCCACAGCAGAGCGCGCAAACTTAACCACTCGACCCCAACATG
ATGTATTTTTTAAGACTGTAGCTTGCACAAGTTGAAACAAGTCTCTGAACCTATTCCTAT
TTTAATTTTGTTTTCTTTATTTGATTCAAACAATTCCAAACACAGACTTACTTATTTCAC
ATGCTGTACAGGTAGAGGAATGTGAGGTAGGTGACAAGAGGAGGAAGCGGAGATTCAGCT
GGTCCCAGGTTACCAAAGGGATATATTGCAGGTTTCCCGGCTACATTGTAGTTCTGTTTT
TGTAATAGTTGAAAGTCAAATCCAGGAACAAATAATATCTACTTTGGAATCTTGGATTTG
AGATATTTAGTGGGATGTGACTTGCCCTTCAAGAGTTTATCCATTTATTTATAAAGTATT
TTATTTTCCTATAGATTTCCAAGCCAAATTCATTCTGCTTTTAGAAATACATTCTTGTGA
CCTACTGGTCTATCCAGACCCTCTCTTCCTCCAGTTTGTATAGAAACTAGCCATTACGTA
AAGAAACTTTTTGGTTGAAAACTGTGAAATTTTTTTTTTAAATATGTAAGCGATACTTTT
GTGTATAATCATTAAAGTAGGGTAACATTGGTGAAAACTTAAAGTTTTCTTGAGAAAACT
GGAGTTCTTGATGATTCTTGATCCTATTTGTAAAATGTTATGTGATCTTTGGTACTTAAG
AATTATATTATAAAAGTTGTGTGTTTATATGTACATATGCAAGTTTTACTTGAACCTCTT
CTAAGAATGTGTTTTAACTTCTGTTTTAGTGGAATATTGATGAACGATACTAAGTTAGAT
GGACCTTTATTACAGATTCTATTTATGAACAATGTTATTTCAAAGTAAGTCATTTTCCCT
TTCCTAAATGTAATGAGTTAAAGTGTTTATGAAACAATGTCTTCTATAAATATACTGTTT
TCATTTGTATTTATACCATCTTTATTCTTTTACTTAAAATTTGTGGAGTCATAATTAAGA
TTAAAAGCAAGGACTTTAGAGTCATATAAACCTGAGTTTGGATCTGGACTCCTACTTTCT
ACATATGTGAACCTGGGCAGGTCACTGACGCTCACTGCAGTCCATTTCCTCACTGGAAAA
CAGGGTACTAACAGTAGCTACCTCTCACATAGCTAAATGAGCACCAGGAAGAGCCCAATA
AATAGCCTCTAATAAAATCACCACCACCACCGCAACAGTCAATAATGTTAGCCATTTCTC
CCCCAAAATTAGGTAACTGAGTTGTTTCTGTTAGCTCTCTTTAAAGCTTACCCACATGAT
TTTTTTCCTTTAATATCAAACTAGACGTTTGCAAGCCTTCCAGCATGCTGGGGTCTAGGG
TGACTCAGTGCATTCCTGCAGTGCTTGCTAAAGTGTTCTGAAACGGTTTGAGGCCTTGCC
CTGACCCTTCCTCAGAGCATGGTCATGGACATTTCAGACAGTTGCTTGCCCCCTCCTGAG
TCACTTAGTCACATTGTTACCTTATGTGCTGGGCAAGGTAAAGAAGAGTAACGTACGGAG
AGTGTTAGCTATGTGACAAGCCCATTACCTACCTTATCTCAGCAGAAGCGGAAACTGAGG
CTCTGAGGGGTGGGGACCCTCAATGGTGAGGGCAGCAGCAGCATGGTGCTGCGCACAGCT
GGGCTCTAGCCCTGTTGTCACCATCGGATTAGGATCGACATCTACTCTAGGTCATGGCAG
TCTAATTTCTGCACCATTCTCTGGTGTTTCGCCTGCAAAAATCCTAGAATGTCAGAGCTA
AAGAGATCTCACAGATCATCAGGTCTGTGAATAGGAAGTTGGCTGCCCAACTGCAGTCTA
ACGTGGGCTCCTCTGGCACCTCCTGAACTGAGCGCTGAAGAACATTTGATGAATGTAGTT
TTTGACTTGGAAAGCTGGAGAAAGTAGACCTCAGTAGTTTTTCTTGCATTACATTTTGGT
TTTATTTTTTCCACTTTAATATTTATATGGGTGTTCCCTTATATGTGCATAGGCTCTCTG
GGAGGAGGATGTGGAAGAACTGAATGCATTGATGGTTTTTTGGTTTTTTTGTTTTTGAGG
AAGATTAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTCTTTTTGCTGGGGAAGACTGG
CCCTGAGCTAACATCCGTGCCCATCTTCCTCTACTTTATATGTGGGACACCCGCGGCAGC
ATGGCCTGCCAAGCGGTGCCGTGTCCGCACCTGGGATCCGAACTGGCAAACTCCGGGCCG
CCGAAGCGGGATGTGCGCACTTAACTGCTGCACCACCGGGCCAGCCCCCGCATTGATTGT
TTTTGTGTTACAGAAGCAGTTGGCTTGGAGCCAGGGTAGGAAGGAAGCTTTTCATTATGT
AACTCCTTCACTTGTTTTGGATTTTGAACCATTTATGTGTGTTAGGTATTCAAAAGTTAA
GTACATAAAATTTGTTAATAAAATCCATTTGTTCTTTGCACAAATATTTGCCAACTATTA
CAAACAGAGCAGTGTGTTAGGTTATCATAATCATTTTTTTGACTTGGCAGCAATGTGTAT
TTTTTCCTAGTGAATAGATTCCTGAGTGGTACAAAGAGTGATTTGATAAACTTCTGAAAA
ATAAAATAAAATTTACACATGACATCTTCTAATAATGCATAAGACTTCGATTGATTCATT
GTTTTACTTTGTCTGGGTTCTGACCATTTTGTCCTCTTATGCAGGCAATATCATCAAGAA
ATAGAGGAATTTGTATCAAATTTAGTAAAAAGATTTGAGGAACAGCAGAAAAATGATGTG
GAAAAGACTTCCTTTAATCTTTTGCCCCAGGTATTTCAAACTTAAAAGACTTGAAGATTA
GTAAAGTATGCTTTTCATTGCCAATTATTAGGCCACAGGGATCCTCTTGAATCAAAACCA
AAATGACTGTTGAGACTATCTATTCGTCCTCCATCCTTCCACCAGGCTTCCTCCTCCGCA
GTCCGTCCAGTGTGGCCATGGGGCTTGCTTTTGGGTTATGGCTCCTTTTCTCAGGAGAGT
CATATTCAGACCTGTCTATACTCAAAATTAAAGGATTTTTTTTCCTTATTCCCTAATTTG
GACACATAGTTTTGGGCAGAAAATTAATTTTAAGCCAGAAAAAAGCCCTGTATATCTCGA
GTTTATAAAAGATGGATCTATCTAAAACCAACAGATTCATATGCCATCCTTTTTTTGCCC
TCTACTTGTTTAACAAAATCAATAGCATGCCCAAAGAAATATGAGAAATTTCACTGTGTG
AATATTAGAGCATGAATTTATATTAAAAAATTCAGAGTTATGATTTCTGGGCTTTTTTTT
TAATTAACAGTTAAGGTAGGTAGAATCTCAAATAATGATCTTTAGCAGTTTATCCTCAGG
TTGAAGAATGGAGTATTCTGATTAATTAATTTTTTTTTTAATTGGCACCTGAGCTAACAT
CTGTTGCCAATCTTCTTTTTTCATTTTTCTTCTTCTCCCCAAAGCCCCCCAATACATAGT
TGTATATTCTAATTGTGGGTCCTTCTGGTTGTGCTATGTGGGACGCTGCCTCAGCACGGC
CTGATGAGCAGTGCCGTGTCCTCGCCCAGGATCCAAACCAGCAAAATCCTGGGCCACTGA
AGCGGAGCACTCAAACCAAGCCACTTGGCCACAGGGCCGGCCCCATGATTCATTAAATTT
TTTGTTTATTACCTTTGCTTTTCACCTATCATATACAATTTTTAAAGATTTAAGAAACAA
TATATTTAACAAAAATACTGGATATTATTTTTGACTCAAGGGAGACTTGAGAATTTTGTA
GTGGCTTGAGATCTGTGAGAGTTATATTATCAGTATTGACCAGTAATGGAAAATTACATA
TTTTTTAATCTTTCTTGTTATCTGATTTCAAGGTAAAGTTTGCCTTGCCAGTTTAAGCAT
TGAAAGTTCCATAGTTAATACTCAACGCAAAAGTCATAGTGTATGCTAATGCTTCAGATG
CCATCTTTTGTACACTTTTTAATTTAATTTTCCCACTTGTGAAATTTCTTTGTAAACATT
CCTAGCCCCTATTTATGACAATGATGAATTCAAAATTTTACATACCTTAATAGTATGTAT
CAGAAAATAGAGGAGTGTATTCAAATTCCTAATATTTGAAATTTAAAGTTGTTAAAAATT
GGTTGCCTTTTGTAATGTGTGTTTTTCTTTGCCTTAGCCATCCAGTGTTATGCTAGAAGA
GGACCATAAAGTAGAAGAATCCTGTGCAGTTAAAGACAACAAGGAAGCTTTTAGTGTAAG
TTTGGACATTGTAGTTTTGAATTCTACAGATACGTTTCCTTTCCTTTGTCAGTTGGGTGG
CATTTAAATGATAAAGTGGTAAGGTTGTATGTCATCAAATGATCACACATTCTTTGGTTA
AATTTGTTATACACAACAGTGTAGGCGTCAGCCTCTGAATATTATACAGTCGTGTGCCGC
ATAGCAATGTTGAGGTCAACAGCGGACCACATACATGACGGTGGTCCCATGAGATTAGTT
CCACAGAGCCTAGGTGTGTAGTAGGCTGTGCCATCTAGGTTTGTGTAGGTGCACTCTATG
ATGTTTGCACAATGATGAAATCGCCTGACGACGCATTTCTCGGAACGTATCTCCGTCATG
AAGCAACACGTGACTCTAGTTTGCTTTTTAATAACTATCGCAATGTGATGCCCTGAGGGC
GCAATAGACGTTCTTTGGGGGACTTTATTTTTGTCCTGACCAACCTCTTCATGTTTATCT
TCAAGAACTTAAGATAGAGATAAAAAAAAAGCATGCTTGTTGAACTTACAGATGGATGAA
GCTGGGAGGGATAAAGAGCTAATATACCAGGTGGCAGATAGGAAATTTAAAATGCTGACA
AACTCAAATGACGGATGACAAAGAGAAGCAGCTGAACAGGGGTGAACTCACGTGTAGGCC
TTTCAGTACGCGTGCAAAATTCAGCAGTGCCACTGAAGTGTAGTGGTGTGATTTTGCAAC
TTAGAATTTTTTCAAGAAACTAATGTAAGCCTGGATTTGATTCAAGGAAGACTAGTTTTC
ATTTTGATGGCATATTGTGCCCCATAAATATACTGCAGTTTTTAAGACATGGGGCTGCTG
GGAAGTCGAAGAGCCCAGATCTTAGTGAAAAGATTTACAAGGGATGTCACATCTCTTCAG
ATGTGATAAAGGCTGTTGTTTGCAAAAGATAGCATTTTAGATCACCCGTATAGTGCCACG
TGGCAGAGTTAGGAACAGTGATTAAGTACAAAGAGACATTTCAACTCAACTTTCAGAAGG
TGGAAATTTGTGTCAGATGTGAAAAGTGAAATGGTACCTCTTAATAAAAAAGTGAATTCC
TTGTTACTAGAAATAGTCAAATAAAGGCCCAGATGCTATCAAGGCACTTTAAAGAAAACT
TTCTCACTTTGAACTTGATAACTTTTCATTTCCCTTCTAACTCTAAGGTTCTGGGATTTA
AAGTGGTGCCTGCCTGGAAACTGGGAATTTTGTGTATTTATTAATTTAGTCCTTCAATAA
ATACTAATAAATATTTACTAAATGCTCTTTTGTGCGAGGGATTGTTCTAGGTTCCAGGGA
CACAGGAATGGAAAAAGGGGGCAAAGTCCCTGCTCTCATTGAATTACGTCCTAGTTGGGG
AAGGCAGCACTCTGAAGAGAAGGAGCAGAGTAAGAAGGTAGAAAGTGAGAAGTAGAGGGT
ATTTGGTTTGTATAGTGAGTAGTGACAGCCTCTCTGAGCCAAGACCTGCGTCCGCTGAGG
GAATGAGCTGTGCTACGGTTTAAGTGAAGAGTACTCCAGGCAGTAGGCAAAGTGAGTGCA
AAGCCCTGAGGCAGGAGCACTTAGGTATTGCTCACGGTGTAGCGGGCGCTTCTCAGCTCA
TTACAGGTATCACGCATGAAGGTACTGTTATTATTCTCATTTTACAGATGAGGAAACAGA
CATGGAAAGCTAAGTAACTTGCCAGTGGTCACCGGATAGTAAGTGGCAAAGTCAGGGTTT
GAATCCAGGCCCAGTGACTCCAGAGCGTGTGGTCTGAATCCTTGTCTTGCCTTATAGGCT
GTAGGGAGGCCTTTGAATTTTACTCTGAGTGAGGTGCAAAGCTTGAGTGAAGTTTTAAGT
AGAAATGTGACATGATGTGACTTGAATTTTTAAAAGAGCTGGCTTCTCTATGGAAAATAG
TTTGTAGCTGGTTTCGTGTGGAAGCTGCTACTGTATTCATCTCAGGAGAGAGAACGTGAC
GGTTTGGACTAAGATGATAGTGGTGGTGATGAGAAGTGGTTAGAGCGTGAATATACTTTG
AAAGGAGAACTGATCAAATGTGTTGATGAGTTGAGTGTGGAATGTGAGAGCAAGAGAGTA
ATCAGAATGACTCAAGTTTTTGGCGTGAGCAGCTGGAAGAACGTTGCCTTTTCTGTGATG
GGAAAGACTGGAGGGAGGAGTGGGTTTGTAGGGGATAAGAATCCAGTGCAGTTTTAAATA
GGTGAGTTAGAGATGCCTCTTAGATGTCCAGGGAGAGCTGTGGAGTTGGCACTTGCATAT
ACAAGATTGGAGTTTAGAAGGGGTCAGAACTGGACACTTGGGGGTTGTCAGCATGTAAAT
TATATTTAATATCATGGGTCTGGATGAATCACCTAGAGTGAAAGTAGAGAAGAGGACTAA
GGACTGAGCTTAACAGAAGGTGGAGAGATGAGAAGAGTCTAGCAAAGAAGACTAAGAAGG
ACTGGTCAGCAAGGTAGGAAGAAAACCAAGAGAATGGTGTCCTGGAAGGCAAAGGAAGAA
GATGTTTCTAGAAGAGAGGAGCAATCAGCTGTGTCACTTGTTGCTAATGGGTTAAGATGA
AGATGGGGAGCTATCCATTGAATTTGGCGGTGGGGTCATTAGGAAGCTCCATTATCAAGT
AGGGTAATGGAGTAATAGGAACAGAAGCCTTACTGGAGATATGCAGCAGAGAATGGCAGA
AAAAAAAGTGCGGAGACCGTTCTAGATTAAAAGAGACTAAAAAGATAACATCTTAATTGC
AATATGTGAACTTTAATCAGATCCCAGCTTGGGGAAAAAAGCTATAAAAAGCATTTTGGG
GGTAGTTGAGAAAAACTGAATATGGGTCAGATATAGATGATATTAAGGAGTTATTAATTT
TCTTAAGTGTGACAATAGTCTTGTGGTTTGTAGGAGTATGTTCTTATTCTTAGCAGACTC
ATATTGATGTATTTATTAGTGAAGTGTCATGAAAATAGTCTAAACCTGATTATGTGTGGA
AGCTGGAAACCAGTTAGGAAGTTATGTATTGATCTCAGGCGAGAAAAAAATAGCAACTTA
GAGTAAAGTGTTAGCGGTAGTGACTTACTTTCTTCAAATGTAAAAAATAAGAGTGTGTGT
GGGTTTATGTTTATGTAGAGAGAGATGTACACACAAAAATATCAACAATTGGGGCAGGCC
CGGTGGTGCAGCGGTTAAGTGCACACATTCCACTTTGGCAGCCTGGGGTTCGCCAGGTTG
GATCCCGGGTGTGGACATGGCATAGCTTGGCAAGCCATGCTGTGGTGGGCGTCCCACATA
TAAAGTAGAGGAAGATGGGCACGGATGTTAACTCAGGGCCAGTCTTCCCCAGCAAAAAGA
GAAGGATTGGCAGCAGATGTTAACTCAGGGCTAATCTTCCTCAAAAAAGAAACCAAAACA
ACAATTGTTGAATCTAGGTAGAGGGTATATGGGTGTTCGTTGTACTGTTTTTTAACTGTT
CCATATGAAATTTTTCCAAAAAATTGGAGAGAAAAGAAAAGAGTGAATGGGAGGAAAGGA
AATGGAAATAGTAAATATAGACAACTTTTCTGAGGGTCTTGCTGCAAAGGGAAGCAAAGA
AATGGGGAATTGGAGGGAAATGTGAGAGTCAAAGCTTTTATTTTTTAAGTCTGGAGAGAG
TGCAGCTGATACTAATGATCCGATAGAGGAGAAACTCAGTGATCTAGGAAACATAAGGGA
ATTTAAAGATGGAGCTTTGACACATCAAAATCTGGCTCCTTTAACTAGGGAATTGATTAT
TACTTCTAATAATTTCATCCAAAAATAAATCGTTAAAACAGTTAATCATAGTCTTACATT
ATTTAATGTCTTTTTTTTCCTGCTTAAATAGCAATATTTTTTGACTTGTTTTCTGCAGGT
TGTAGGAAGTGTCCTGTATTTTACTAATTTTTGCCTTGATAAATTGGGGCAACCGCTACT
AAATGAAAACCCTCAGCTTACCGAAGGATGGGAAATCCCCAAGTATCCTACATAGTGAAT
GAAGATCTTTTATGCATCTTGCCATTAAGTTCACCTTTAAAACAATTTACCAAATTTTGC
AGACTATGATAACTATTCCTTAATAAAATTCACTAAAGGTACCAGCAAGTCTTCAGCCAC
ATTGTTTCTCTAGAAGGGCAAGAAATACAAGTAAAGGCAAAAAGGTTTGTGTGGGGAGCT
GTTTTTTATTCTTCTTTTTTTAACCAAAACCATAAACTCTTAGCTTGAAAAGTTAATATT
CTTTATTGCTGGCTTACTATAAATAAATTACAGATTAAGCTAGAATTTTAGTATGTAGAC
ATATGTTAAATGTTTAAATTGATCATCTGTTTGTTGGAATTCATTGGTTCACGCCTAATA
TGCCTGGGTGGGTGGAAAGGTGTAATTGTTGCTGTCAGTTTGATTGCTGTCTTATAACCA
TCTGCCCCTTCCCACGTTACCAAAAGGAAGTGTGATAATCTGTTTGCCTCAGTTCTTTGT
TATTAACCACAATGACAAAACTCAGAGGTAACAGATCAGTCGGGAACATAAGGGTTCTTG
GTTAAAAGACCAGGTTGCAAGTACTTTTAGTTAAATCACTAATTACAGGAGGTGAAAGTG
TACTCAGTATTGCAGATACTAGTAATTTGTGATCTAAGTGCTTTCTTGTCTCTCTGATAC
ACTTTGCTGTCATATAGAATTTTATTGATTTGCTTTTATATTTAATTTACATTATGAAAA
TCTTTGTTTTTGACCAAATAGGCCAAAGCCTCACTGTTTCAATTGTGGTTCTGAAGAACA
TCAAATGAAAGATTGCCCAATGGTAAATTTTTGTCATATTAAAAAAATGTGTTTGAACCA
GAGCTTTCTAATGTTTTTGACACATTTATGGCATTGTGTGCTATGAAGAAACTTCTTGTG
TTATTTTCCTGTTGTCCTTGAATTTGAAATCCTTTGAAATCTGTACTTAAATTTTAAGAC
ATCACATTTAAAAAAGTAATAATTTATTACAGTTCTCCATATATGAGATGAATGAAACAT
TATGAGAGTTAATTTTTAGAGAATTTATTCTAAAAACTTGATTTTATGTTATGATAATAT
CAAGATAATAAGAAATTAGAGTAACTGCTTCTCTTCCTTATTTTTCTAAAATATTCACCC
TGTTTTATACTTGTTCCTTATACATTAAAACTGGAATAATCTGTTTGCTTGACCTAAACA
GAGTGCTTATGGTTATCTAATTTCTGAAATATTTCTAAACTGCTTGATACTATTCTTTTT
GAATGCATGACAATTTAGCCTCGAAATGCTGCCCGAATAAGTGAAAAGAGAAAAGAATAT
ATGGATGCCTGTGGTGAGACAAACAATCAGAATTTTCAGCAGCGATACCATGCAGAAGAA
GTAGAAGAAAGATTTGGAAGATTCAAGCCAGGAGTTATTAGGTATCTCTTTTTCAACCGT
AGAATGTCATTTCTATTTCCCCAATATTTGGAACCGTGTATCTTGAGAGTAATTATCAGT
GTATAAGTGTTCTCTAGCACAGCTCTAGATAATATACATCAGTTCATTCAGAAACATTAA
CTGGGGGTCAGCCCCTTGGCTCAGTGGTTAAGTTCACGTGCTCTGATTTGCTGGCCTGGG
GTTTGCTGGTTTGGATCCTGAGTGAGGACCTACACACTGCTCATCAAGCCATGCTGTGGC
AGCGACCCACTTACAAAATGGAGGAAGATTGGCACAGATGTTGGCTCAGGGACAATCTTC
CTCAAGCAAAAAGAGGAAGATTGGCAATAGATGTTAGCTCAGGGTCAATGTTAAACAAAA
CAAAACAAAACAAAAACATGAAGCCATATTAAATACTCCACTTTTAAAACAAACAAAAAA
CATTAGTTGAAATCTTACCTATGTATTTGTTAGGCACCATGGCACATTCTGTATAACATA
AGGCATAGAATTGTTTTAAAACATCAGAATAGTATATGTTTTCATCCAAACAGGAATACA
GTTTTTCTTCCTCTTTCATTTTTACTTAGTGAGGAACTTCAGGATGCACTGGGTGTGACG
GACAAGAGCCTTCCGCCTTTCATCTATCGGATGCGCCAGCTCGGGTACCCACCAGGCTGG
CTCAAAGAGGCCGAATTGGAGAATTCAGGGCTTGCACTCTATGATGGAAAAGGTACAGTA
TGTGGGGTTAGAAAGTCAGCTCGAGTGTGAATCTTTTTTTTTAATAGAGAATCGCAATAA
AATGTCATAGGAATGGCTGGCTTGTTTAGTATGTGTTGAGTTAACTAAAAAATATGATAG
TATTTCCTTTGTTTTACAAGGAAGGAACTAAAACTTCATTGAGTATTATCAGGTAGTTAT
CTGGACCTGTTCAATGACTAACTCAGCCAAAGTTTCAGTTCTCCAGCTACTCCTCATAAG
GTCTTGCCTTTCTCGGTAATAACAGAAATACATCCGTCAATGCCAAGAGGACTATAAAAT
TTAGAATACATAAACCCTCTTATAATGTAGAATTCTTCTCTTAGGTATCTACTCCAGAAA
AATATTCACACGTGCACAAGGAAATGTATGTATATAAAGGTATTTTTGTAGCATTGAATA
TGATAGTGAAAAATTAAAACCAACATTAAGGCCCTGAAGGGAGAATGGCTAAATAAAGCC
TGGGAAGTCTGGGCTCTGGAGTCCCTGCAGAATTTTAAAAAGGGAGTAAATCCATGTGAG
CTGACATAGCAAAATCTGTGCAATGCTGAGCAAAAGCAAGTTTCTGGATGACTTGTAATA
TTATGATGCCATTGATCTTAAATTTAAAAAAAAAAGAAAGAGGGGCCGGCCCGGTGGCGC
AGTGGTTAAAAAAAATACTTTTTACTGGGGCCGACCTGGTGGCACAGCGGGTAAGTGCAC
ACGTTCCATTTCAGCAGCCCTGGGGTCGCCAGTTCGAATCCTGGGTGCGGACATGGCACC
ACTTGGCAAGCCATGCTGTGGTAGACGTCCCACATAATAAAGTAGAGGGAAATGGGCATG
GATGTTAGCCCAGGGCCAGTCTTCCTCAGCAAAAAGAGGATTGGCAGCAGTTAGCTCAGG
GCTAATCTTCCTCAAAAAAAAAAAAAAAACTTTTTATATAAATAAGTCCTCAGAAAAAAC
ATTGAGCATTGTTTCATCCATATGGGTTTCTTTCTTTCTTTTTCTTTTCTTTTTTTTTTT
TGAGGAAGATTAACCCTGAGCTAACATCCACCACCAATCCTCCTCTTTTTGCTGAGGAAG
ACTGGCCCTGAGCCAACATCCATGCCCATCTTCCCCTACTTTATATGTGGGACACCTGCC
ACAGCATGGCTTGCCAAGTGGTGCCATGTCCGGACCCGGGATCCGAACCAGCAAATCCCA
GGCCACGGCCAAAGCAGAATGTGCACAGTTAACCGCTGCACCACCTCTTAGGGCTGTAAT
GAAGATTAACTGAGTTTATACTTGTAAACCATCTAAAACACTGTCTGGTACATAGTAAGC
ATTATATAAATGCTTATTAAATAAAATAAGAACATTGGAATAGAGCATTAGGCAAATTAT
AAGATCAGTGCAAAGTAGACTTTTAAGCAACCCATGAAAGAACCAAAGTTTCTAAGATTT
TAAATATTTATTTTCATTAAAGTATTACGTCCATCCACATTGTTTTAAAATTCTAATGGT
TCAGGAAAATGATAATTAAAACCATTCTTGGAAGATGGAGCACTCCCTAACACATTCTAT
GAAGCCAACATCACCCTGATCCCCAAACCTGACAAGGGCAACACAAAGAAGGAAAACTAT
AGGCCGATATCAGTGATGAACATAGATGCAAAAATCCTCAACAAAATTCTGGCAAACCGA
ATACAGCAATACATCAAAAAGATTATACACCATGATCAGGTTGGATTTATACCAGGGACA
CAGGGATGGTTCAACATCCGCAAGTCAGTCAGCGTGATTCACTACGTTAACAAAATGAAA
AACAAAAACCACATGATCATCTCAATAGGTGCAGAGAAAGCATCCGACAGGATCCAACAC
CCATTTATGATAAACCCTTCTTGGAATAACTCTGTTGCCGTGACTGTAAGCACTCCCAGG
TCTGCTCTTGGTCCAGAGAGGGGTTTATATTGGCACTGAGCAATATTTGCCCTTTCGATG
GTCTGTTATAGATGGTGCTGACGGGGAGACAGAAGCTGGAGAAGTACAACAGAATAAAAG
TGTCACCTACGATCTCTCGAAATTGGTAACCTATCCAGGTTTTAATATATCTACTCCCAG
AGGAATTCCAGATGTAAGTATATTGTTTTTTTGTTCTTCTGGGATATGACATTATTATAT
GTTATATGTTAAAGGTTGTTCAAAATGTTAGCTTATTCACCAGTTACTGTTGCATGAAGA
ACAGTAAATATGTGACTTGTGTGTTTAACTTTTTAACCTCCTTTATGTTGAGTGAAGTCT
TATATTCATCAAAAAAAAACCCACACATTTTTTTCTGACTTTATGCCCTAAGAAAGGAGC
TAAAATAAAATGGTTAGATTCTGTAAATCTAAGACTATTCTAAAATTAAAAGTTGGTTTT
TTTTTTTCTTAAGATTGGCACCTGAGCTAACAACTGTTGCCAATCTTTTTTTTTTCTTTT
TTTTTTTCTGCTTTATCTCCCCAAATCCCTCGGCACATAGTTGCATATCTTAGTTGTGGG
TCCTTCTAGTTGTGGCATGTGGGACGCCGCCTCAACATGGCCTGACGAGCAGTGCCATGT
TGGCGCCCAGGATCTGAACTGGTGAAACCCTGGGCCGCTGAAACGGAGCACGCGAACTTA
ACTGCTTGGCCATAGGGCTGGCCCCTTAAAAGATTATTTTTTAAAAATATGGGATAAAAA
AAATTAAAAATATAGGATGGTTCTGAGATAGTATTATAATTTTACAGAATTACTTGAGAA
GTAAATTTCTACCTTTAGTAAATCTAACTCTTTTCTATTCTTTCTTCCCTTTTATCTCCC
CTTCACAGTAAAAGTTCTTGTTTTACATGAGAATGGTTTTCTACAATTACTCTTTTCCAT
TTTTCATCTTATGTTTCAAGTTTCAACAATTAGCTATTGTGGTGGTGATGGTATTGGTGG
TATTTTAATAAAAACGTGCATTCTAGGTGTTCTTAGGAACTGGGTGGTAGAGAAGAAGCC
AAAGATCTGAACTGAGTCTAGCAAACAGCTATAAAGACAAGTGTGCAATTAATTAAGGGC
TAAATTACATGGTACAAACCATCAGTGCCTCTGGAGGTGGTCCAAGTACCAGCCTACTTC
AGAATCCCCTTGGAGCGCTCGTTAGACATGCACATTCTTGAGACCTGCTCTTAGACGTAA
CTGACGCAGGCCCTGGGATCTGTAGGGTTAACAGAAGCCCAAAGTGATTCTTCTTGAGAA
ACACTGTTGACTGTGCTATTGGTGATCAAAGAGAGATGAGAGATGTCAAGCATTAAAGAT
GAGTGCTCAGTTTGGAAAGGAAAGGAACAGGAGATAGACGACTCAGCATGAGTGTATGTG
CGGGGAGAAGTGAGCAGTGCGAAGTCGAGTTAGCAGTGCTAGTGCACCGTGGCAGAGACG
AGCCAGGTAGGCTGGACAGGAGTCCGTGGCGTCTCTGCCTGTAGCTTCTGGTGGTAGGTG
AAACCTTTTTGAGCCAAGTGATTTTTTCAAGTGGTCTTTTACTATTCAGTCCTGATCGTT
CTGCAGGCAGAGTTGTTTTTTTCCTTCACTGCACCGTTATTTTCACTAATTCCCAAAAAA
AGGAAAAGTCCCATATGGAGCAGAAATGTAGTTTGAGACCTCCACTTTACCTCCTTTGAG
AAAAATCCCAAGGCATGACATTTTCCAAATACGTACTTATTTTTGCCTTCTCTTTTCATC
TTTAGGAGTGGCGGATGTTTGGTTCCATACCGATGCAGGCATGTCAACAGAAGGACGTGT
TTGCCAATTACCTTACTTCTAACTTCCAAGTGGTAAATAGATTTTCAGGGTATGGTTTAT
AAAAATGTATCACATGTATCTGTGGGATTTTGTGGCTCATTCGCATCTTAATGCCATTTC
TTGCTTTGTATATAGAACACTCTGTGTTTTCTGATGAATCCAAAGGCAAAAGTGTAGCTG
AATTTACGTTACCTAGACTTAGCTCCAGAGGGTTTTCTACGTCATATTTAAGCGAGCGGA
TGGAGCTTGATTCTTTGTCTACCCCATCTGACTTACGTTTGTTTGGTTCCTCTGTTAGTC
GAGTGTGAGGCCTGGCAGCAAGAGGTCGTCTCAGTCCAGCACTAGCAGTCCCAAGAAGCA
GAAGAAGGAGAGCAGCTCCGCCGCCTCGCCCGCCGACATGGAGCTCGACTCAGGTAAGTT
TCGTCCCGCGGTTTCAATTTCGCTGAGAACGTAAGACGAATTACTGTGCTCCTGAGTCTG
GTAAGAACGGGAAACTCTTTATGAGCACTACTAAATAGTAAATCTTTGATTTTATCCTTG
GCGATCAGGCATCACCACTTTTACTGATTGAAGCCGAGCTGGAGGACATGGCTTGATGTG
AGGGCCAAATTGGCCAGCTAACTGGATTCCTGAGTTAGGCAGACCTACCCACCCAGTCCC
AGCTCCCAGATCTGGACTGGCCCCTTGGACAGGGGCAGCACTCTGAGACAGGCAGCGGAA
AGTGCTCCCCTCTGGCAGCTCGGTCCCAAGAGGAAGAAGGGCGGGGCCCTAGCCAAACTT
GCCCAGTTACTCTCCCCAATTGTATCAGTTTGATAAATCGCTCCTCCTCCCCGGGAAAGA
GAGACCATGAGGAAAATCTGCCCTCCTGGAAACCCCAGGTGGAACAGAGGCTGTGCCCTC
TGACGTTCTCCAAGCTCTTTGTTCTCTGAACCCTCTGGGCTTAACCCTGGAAGCTGTGGT
CAGCCAGGATCGTGATGGTCCTTTTCAGCAGATCAGTAATCCATCAGCACAGTCATGCTC
CCACCTTTTTGAGCTCCCATCCCCGCAGTACCAACCATTGCTCCTTTGGGTCTCCTCTTA
GGATTACTGATGAGGAATCTAGATTTTTACCCCCAGAAGGCTCTGGAATGGATCAGAACT
TTGTTTTATTAGATAAACTCCAAGGCCACTCTGAATCCACGACTGAAAATTCACTACTTA
CTCGATTTCCCATCCCAAATTATGCCTAGCTACTTTGGTCCTATAGCCTGTCAGATGTTC
TGAAGTGAGATTAATGGCAACAGTAAGATAAAATGCACTCAGACACTCTAATAGAAAGAT
GCCAGCAATATAAATTGCCCCACATTCGAATGTGAACCCCCCTTCCCATTTTCAGATTCC
CAAGGAGAATTCAAAGGTCACAGATTAAATCCCCTTAAAGTCCAAGGGAATTAAAGTCCA
AAATTGAATTATTTTGCATGAGTGACTTCAGAGTCCAAAATCAAAGCCCCCAGACCATTT
TCCCCAATGCTTTACTCTGCTGGGTCTCAGCCGCAGGCGTCCGTGATCCCTGAGTGGAGT
TCACAGCCTAGGCTCTTAGACCTATGCAGCCTGACTTCAGCATCCGGTCTCACTGTTAGC
GAGGCCAATGAGTTAAGAGGAAGCAGAATCTTTACAGCCTTTGTCACGTATCTTTGAAAC
TTTGAAAACAAGCAGTTACCAAAACCCCAAAAGCAGTTGTCCCAGACAAAATTATGTCCC
CAGAGCCCAGTATCTCTCAGCCTTACCGAAGGCCATACTTGAGATTTCTGAGTGAGGGCA
GAAGTCCTGGTTCCTGTCTCTCAGGGATGTTGGGCGGTGCCAGTGGTCTGACTCTCGTGC
CTGTATGCTTTGGTTGGAAGAACTCTCTCCGTAAGAAGTTAAGTTTGGTCTTAGGCACTC
ACAGTATCTGTGCGGAGAAGTCACCCATGCTTGGTGTTTTGAATCATTTGAGACATAGTT
ACAGTCTCATGAAGTTTGGGAATGTGTGGTTGTGGCACCCGTGTCACACACTTAGGTGCA
GGTGTTTTCAGCCCTGTGCTGGGAGCTTTTTCGTCTGTTTCTTTTGAGGGAATCGCTGAG
GGCTGAGAAACCTGCCTCCTAGGAGAAGTTTATCTATCCCTCTCTCTCTCATATAATTAG
CCAATCCAGAGCCAACCTGAGCCTGTGTGGTAAGCTGAGACTCTTGATCCCAAGGCCAGA
GTCTTAAGGATTCAAGTTTAGTGCCTCCGCATTCCTTCCTTGGCTCTCAGCCAGTCCAGA
GTGGAATTTGGGGCCGAAGTTACAGCACTTGCCTGATGAACAGTTGAGTTAGAACCTCAT
TAGTTCTCTATAATGCAAACAGAACCTTTTTGCATGAGTTCCCTGTAAGAAGATGGAATC
TTTGCAGAACAAAGATTATTCACCCATAGGTGCCTAAAAGGCCTGAGATGACCTATTTTC
ATACCATACTGTTAGGGCTGTCTCAACCGCACTTCCTGAGGGGTGGCTGCACTCCACGGT
AAGCCACAGCAGCTCTCTGAGGGCCTCACCTTCGCATCTCTGCCTTAGCTCACTCCATCA
CCCTTGCCCTACCGTCTGTAATCGAATCCTTCCATCCGTTGGACCTGCTTACCAGGCCTC
TGCTGGCTTAATTAAAATTAATATATTAAAAGTAAAATGGGATTCTGTGTCACAAAATTG
TGAGTATAGTGATTTGGTTTGGAGTTGTGAACTCTAACTACCTAAATGTCTTTTTCCTAT
TTACTTTAACAATGTTAACATAACATCCTTATGCTAATATTGTGATATTTTGTGCAAATA
AAACTTGGGTTAAACTGTTTGGATATGATTTATTCTTAAAAGCATCATGGACACAAATTG
TTAAAGAACTAAGTTACCAGCTTGGTGTTAGCTTCTCACTGCCCCCTGCTCCTCCCCGTC
CTCCTCCTCGTGTGTGCTCTTTGTTGCAGTTAGTGGTATCAGTGTTCTTGTAATTCCTTA
GGCTGAGAAACCCCGTTCATCTGCAGCTCCATCCACCCTTATCTTGGCCCTCCGTTTCTA
GCCTGTTGCCAAAATCCTAACAATATCTCAGTAAATTGCCTCTTACTTCAGGCTCTTCTC
TCTTACCTAATGCCTTTTGGTGCCCTTGTAACTGATTTTTTTTTGCATCTTTCGTTTCAG
CTATTTTATCCATTCTTTGCTCTTCAGAGTGAGTTAATTTCTTTTTTTTTAGATTTTTTT
TTCCCCCTTTTTATCCCCAAAGCCCCCCGGTACATAGTGGTATATTCTTCGTTGTGGGTC
CTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGCGTGGTTTGATGAGCAGTGCCATGTCC
GCGCCCAGGATTCGAACCAACGAAACACTGGGCCGCCTGCAGCAGAGCGCAGGAACTTAA
CCACTCGGCCACGGGGCCAGCCCCTGAGTTAATTTCTTAAAATATAAATGACAGTATGTT
TATCTCCTTACAAATCTTATTGCCTTATTGTCTTATTTATTGAACAATAAATTTCAGACT
GGTTTTGCGTAGCTTTCAAGATTCCATGTTACTCAGTTGAATTTTCCAAATTTGTAAAAC
ATGTATAGTGTGTTACAGACTTCTCTACTAGACCCTGAGGACAGGGAGATTAATAAGACA
CAACTGCTGCCCTTAGTTACCACTCTGTCACCTAGGGATTGCAGATGTGTAAACATCATT
TTGATGTACGTGGCCCATATTGATATGTATAGAGCCATCGCCTATTGCTGCCACAGAGCT
GGTTACCGACTCTGATGGTGGCACAAAGGAGAAACTGAGCAGCTGTGCTAGGATGGAGTC
ATAGACCCCTACCAAGAAGGGCTTTTAGCTGTATCTTGAGAGATGAATTCAGGGATTTAC
CAGGGAGATGAGTAGGGTTAGGGCATTTGAGACAGTGGGAAATGCAAATGCAGAAGCATG
AAGTATCACGGCACACCGTGCCAACATCAGAGTGACAGCTGGAGTTTAAACCAGGCAGTA
AGAAATGATGTGGTGGAAGTAGGCAAATTCTTGGTCGTAGAGAGCCCTACAAGGCGTAGA
GGAGATCACACTTCATCCTGTAGTTGATCAGAGGGCACTGAGGGGTTTCCAGTGAGGTGG
GAAGATTAATAGGATCAGATTTGTGTTTTAGAAAAATTAATAGTTTGGAGGATGGATATT
AGGAAAATGAGTGCAGAGGCAGGGATGACTTTAATATGGGCCAGAAATAACATAGTGGCT
GTGACACTCTCTAGGAAAGAGTGGACCCCAGAGAGCCAAGGACCTGGGGTAGGGCAGAAG
GAAAGGGAGGACTCTCAGATGACGAGCAGGTTTCATTTTGGGAAACTTCAACCAAATACC
ACTGGTGGTACCGTTACTGAGAATAGTCTCAATTTTAGGAAAAGATCCTTTGTTTTGGAC
AGATCAGATGTGTTGTCTGAGGGACATATATGTGATGATGACGAGTGATCAATTAGCTAC
TTGAACCCATAGCTCAGGCAAGCAGTCTAGACTAGAGGTACAGAGTTGGGAAATAAGCCA
GGGTGTATTCCTGCCCTGTCTCCTCGGCTTCATCTCCTTCAGTCTTCCCCAACTCTGCAG
TCCAGCCAGCCTGCATTTCCAGCCCAGGGTCCTACTGTGTCCTGCCACGAGCCCCAATCT
TCAGTTACAGCAGACTGTCTAGAGATTACTCTGTATCTCCATGCCACTGTTAATATTTCC
CCACCCTAAAATGATGTAAACAGCGTGGAGATGGATTCCCCAGGGGTGTGGGTAAAGTTT
CTGGTGCCAGAAGTGCCTGCAGCTCTCCCCGCAGGGCTTCTTTTCAGGTAGATTGAGGAC
ATTAGGTGATGGACATGATAGCTGAGGAGCCACAGTTTTCCCCTCTTGAGCCAGTTATTT
TGGGCCATTGACTCTCTGGATACCCCTGAGTTCAAATAACTAATGTTAATAAAACCAAAT
GCTGTGACAACTTGAAGTATCGTATCTTTCTTATTTCAGATGCAGAGGTCCCACGTGGTT
CTCCGAGCAGCGAAGCTTTTCAGTTTCAGCCACCACTGCCCCCTGGCACTCCTCCCCCTC
TGCCACGGGGAACTCCTCCACCCATCTTCACCCCTCCGCTCCCCAAAGGCACCCCGCCGC
TGACTCCCAGTGACTCGCCACAAACCAGAACAGCATCTGCAGCTGTGGATGCGGACGCAC
TGACTCTGGAAGAACTCGAAGAGCAGCAGAGGCGGATCTGGGCGGCCCTCGAGCAGGCTG
AGAGCGTAAACAGCGATTCTGATATTCCCGCTGACACGCCCTTGACTGGGAATTCAGTTG
CCTCTTCACCTTGTCCAAACGAACTAGACCTCCCTTTCCCAGTGGGAAAAACACCTGAAA
AACAGACTCCAGAGGAGCCTGAGGTCCCAGGTACTTGTGCAAAGGAATCGGAAGTTGACC
GTCCCTCGAGTCCGGATTCTGAGGCTGCATCGCTTTGTCAGAAGGAAAAGAAAGAATCTA
CTCAGGTAGACTCTCAAGGTGCTCTTCTTGATAATGGCAGCGTTGTGTCAAACTGTGACA
TTAGGAATGGAGGCAGCCATGTGGACACCAGTCCTTCAACAGCCACTAAAGTTCATAGTC
CCATACCTGACATGAGCAAGTTTGCAACTGGAATAACACCATTTGAATTTGAGAATATGG
CAGAATCTACTGGAATGTACCTCAGGATAAGAAACTTGTTAAAGAACTCGCCCCGAAACC
AGCAAAAAAACAAAAAGGCTTCTGATTAACTGCTTGACATAGCACGAAGAGCTATTTAAT
TCTCTGTAACTTTGTGTTCTGTTAATTAGTACTAACCAAATGGACAGATAAAATTGTTTT
CCTATTTGTCCCTCCCATGTTTAAAAATCTATCCAGGGCTTAATTGTGGCCTGAAGTCAG
GCCTATTTTAAAGAATGGAAAGCCTGGGTTTGCTGGTTTACTCTATTTTATTCTCTGATC
AAAACTTGGGGGGTGGGGGGTTGGTCTAAGTATGAGCTGGTTTAGAGATAGTTTGTTAAG
GTTTATACTATTTTTGGATTGTGAGTGTCTGTCAAGAGTGATGCTTTTTATCTGTCTTTT
GTACGTTGTTTTCCCTTTGTACGTTTTGCTAATTATCCTGTATATAAGTTTAATATATCA
CTTTTTAAAAGAAACAAATCTAACCATTTTAAATTCATATGTCAACTTTGACAACCAAAT
GAGAACAATCAGGGTGGAGCAGCTTTATCCCATTTGGGGTATTTTTGTAAGTGATTTACA
TGCATCAGTTTTAATAACACTTTTACTTTTTTGTAACTTGGTTCTTCATATAAGCTTGCT
ATACAGGTAGCTCAGCTTTGTGTACAGAGGTTTAATAAATTAGTTTTCATATGCATAATC
TAAGACTTTGAATGCAAAAAAGTGATTCACAGTCAAATTAGTATAGACAACCTTTTAAGT
TTCGAAGTTAACTCTATGGTTGCAAAAATTGGTGGTAGCAAAGGAACTATAAGAAATTGC
AAGTTTGGATGTTTTCAGTGGATTTCAGCCTTAAATATAAAAAACAGAATCTTTTAAAGT
AAATTATTTTGAAAAAAATGGAGGGCAGCTAGCATTTGTACAAAAATAATTTTCTAGATT
TGAACCCTAAGATAATTAATAGTTTAAAAAAGTAGACATAAAAAAATTGCTTTTAACTGT
CAGATGTATAAGATAGAGCTGAAACTATGGGTTTTGTCTTTTTCTGGAATGCCGTTACAT
CCTTCTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1224, 2452..2478, 4949..5023, 6884..6989, 8377..8454, 12358..12461, 12578..12643, 13221..13281, 13758..13900, 14489..14631, 16631..16752, 18365..18451, 18718..18832, 23439..24208
1001..1224, 2452..2478, 4949..5023, 6884..6989, 8377..8454, 12358..12461, 12578..12643, 13221..13281, 13758..13900, 14489..14631, 16631..16752, 18365..18451, 18718..18832, 23439..24205
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved