Equus_caballus Locus DKC1
snOPY snoRNA Orthological Gene Database
Equus_caballus DKC1
Equus_caballus
DKC1
X
SNORA36, SNORA56
6002..6135, 10246..10377
13147
AAACTGAAAAATTTCTAACCTTTGGATTGCAGAAGTAAACTCATTGGAAGAGATTCCAT
TTAAAATCACAATAGAGAATTAAATAACTAGCGATCAATCAAGTCCACAGAGGCTAGGTT
AAGAGCCCAGCTTGAGAGAGAGGAGCGAGAAGAACCCGAAAGACAGAAGGGAAGAGGGCT
TGAACCAAGAGCTGCTACTTCCCGCCTGTCCAATACTGCCGTCGCTAGCTACCTGTGTCT
ATTGAGCTCTTGACCTGGAGCCCCCTCGTGGAGTTAAAAGCGACATGTGCTGTAAGTGTA
TAACACACACCAGAAAGACTTGGCACGAAAAAAGAATGTAAAATATCCCATTGATAATGT
ATATTGGTTATGTGTTGAAACGTTAATATTTCCGATCGCTGGGTTAAATAAAATTCGTTA
TTAAAATCTTTTTCAGCTTTTTCTAACTTTTTTTCCACGTGGCTGCTGGAAAATGTAAAA
GTCCACAAGTGGCTCCGCACTCTATTCCCATTGGTCGGCACCGCTCCAGCTGGATGGGCA
TTGCAAGCAGCAAAGGGGCTTTCAACCTCTCTGTGCTTCAACGTGCTCATTTTTCAATCG
GAACTGATCCGACACCAGCCTTCAAGGGTGGGGAAGAGGAAGCAAGGAGCTACCGTTAAC
AGAGCGCTCGGCCAAGTGTCTGAGTATCCAAGCCTGCCTTAAACTCAGCTAAGGTGTGTG
AACAGCAGCCAGGGTCACGCCCACAGGCTACAACCCGCGGAGGCCAGCTGCGCATGCCTT
CCCAGCCCCAGTCGCCGGGGGGCGGGGCGAGGCCCAAAGCGCACGCGCGGGCGCACTAAC
ACAGGGGCCGAGCCAGCCAATGAGATTGTGCGCGCGCGCGCGCGCTTCCAGCTCTGCCCG
CCCCCACCCCCAGGCTGGCTCTGCTTCACTCCGCCCCGCGGCGCGGCACGCACAGGGCGG
CGCACAGGTGGGCGGGTCCTAGCGGCGCGGCCTGACGGCGGCGGGAGTCTGTGGTCGCTC
CCTCGGCTCTGGCCCACGCGGCTTGCACGCTCTTCGGGGTAATATGGCGGACGCGGAAGG
TAAAGGTCGTTCCCTCGCGGTTGGCGGGGCCAGGTGCCCCGAGCTGGGGCCGGCTCGGTG
AGCCGGGAGTGGTGCGGGATGGCGTCGGGGCCCGAGCTCTCCGCTAGCTCCAGTCGCCGG
GCCTCCTGCCGCCCTTGCCTCTGGGCCCTGATTCCAGGACTGAGGGCAAGAGAGCGAGAG
GCCCTCGCGGTGATGTGGTGCCTCGAGGGCCGGACCTCCCGTGGACAGCACAGCCCCCTT
AGGGCCCTGTCGCCGTCGAAAGGCGTCGGCCGTGCCGGCGACCCGCGGTGGCGGGAGACC
TAGTAGTATTTGAGCCGCTGCCAGCCCGGACGCCGCGGTCGGCGCCACGCGCTGAGGGAG
TAGAGGGTGGTGGGAACAAGCGGGGAAGAAGAGGGGCCTCCGGCGGAGCTCCGAGTCGCA
AGAAAGTTCTGGAGGCCACAAGCCCTCGGGGATAGTCGAGCGGTCACTTATGGAACTTTC
AGGCCAGCGGGTCGAGCGCTTCTGCAGCATGTTTAAGCCCCGCCAGGGCCACGTGCTGAG
TCGGAACGGAAGCCGACACGTGCGGCTGTTGGCGGTGGGAGCCGGAGCCGCGCAGCCCAC
GCATTTGGCCGTACACATTTTGTTTTCTTCAGTAATTCTAGACCAAGCATCCATTTCCTA
CCTGCCCTGATTTCGTTTTGTGTTTTAAACGTTGTTGCCTTTATTTTCGGGGAGAACTTC
CAAATCTTGTGTTTGTTTTTTTAGTATTTATTTTGCCGAAGAAGCATAAGAAGAAAAAGG
AGCGGAAGTCATTACCAGAAGAAGATGTAGCAGTGAGTAGGAATACATTTTCCTTTGCTT
TGACTAAAAAACGTTACTTAGATAACAAATTACAAAAAAGAACTGTTTCTAAAGATTTCT
AAGGAATGGGCTGGAATTGGGTGGTCGTTATGTAAAACCACACAAGCCCAGCCAACCTAG
AGTCTCTCCTATCAGGTGTAGTTTGCTAAATGGTATTGGCCGCACCAGCTGCTCTCCCTG
AAATTCTCTTTATCATCTCACCTGCAGACCCACCAACCCTCTTTCTCTTTAAACAGCTGT
GCCCATCTTGGTGGTACTTCCCTTACTGTTTGGAGCTCCTGGTTCATTTTTCTTTTTCCT
GTGGACGTCCCAGGGAAGCAGCACAGACCACTTTTTCTGTTTTAAAGGCATAGACTTCTG
TGGTAGTAATGGAATTGTTCAAAATCAGGTGAGAAGTCTAACAGTGTGTTTCTGTCCTGT
GCAAGGAAATACAACATGCTGAAGAATTTCTTATCAAACCTGAATCCAAAGTGGCTCAGT
TGGACACATCTCAGTGGCCCCTGTTGCTAAAGGTACGTGGTTAAGATCATGCACCAGCTC
AGTGTCTGGCTGTTACATTATCTCTAAGTGTTAAACAGTTGATTAAGAGTGCTTAATGCC
AGCGTCCTTGACTTAGGAAATGGTAGATGATAGTCTAAAGCACTGGTCCTGAAAGTGTCT
GAGGTGAAGGACCACATTATCATTTTTTTCATTTCCAATGCATCTGACAGTGTTGTAGAA
TACAGTTAAGATCCCACAACAACGTCAAACTGCTGTTAAAGTTCATAAACTATTATTTCT
TGGTTTCTGTACCTAACTCCACCTCACAGACCTATACCAGTTTGTGGGCCACACTTGGAG
TAGGACTGCTTTAGTGCTTGAGAGCATGGGCTTTGAAGCCAGACCAGGCTGGGTCAGGCA
GTGTGTGACCTTGCGCCAGTTGTTTAACCTCTCTGAGGCTGTTTGGTCATAATGTCTTCT
CTTAGGAAGGCAAGCTGAGGGCTGCAGGAGGTAATCCATGAAAGGTCTTTAGCCACAGTG
CCTGGCCTTAACATGTCTTGTAGAAGTTATTAACTATTGTATTGTGTTTTAAATAGGGTA
GTTTGGTAACTAGATGAATTGCAAGTTTCACAAATGACTTAATGGGCACCTACTATGAAA
TTAGGAGGAAAAGTTAGAGTAGAAAAAGTTAGTGAGAAACCCCTTGACGAAGTGTTTTAA
TAAACCAGCGTGTGTGAATGAGGTAAAAGAATGAAATCAGCTTACATAACTCAACACAGT
TGAGTTTCTGCTTTGCCAGACATGTCGGCCATTTAGATAGCATCTGCTTTTCTATTGTAA
GCCGAGGGGATATGCTAGTGAACCAGGTAGATGATGTCCCTACTCTCATGAAACTTAAAA
TCTAGGAGTGGGAGACAGTTAAAAAATAATTGCTATTTGTAAGTACCATGACAAAACTAA
ACTGGGTGCTAGAAAAGATGGGCTTCATTTGAGGGGAGCTGTTTCAGACCAGTGGTGTTG
AGCCTCAAGCCTCAGAAAGCAGAGTGAAAAAGGAACAGAGATTGGAGCATCTGGAGCAGG
AACAAGCTGGTCTGTTTGAGAAACATTGTTGCCAGTCTCAATTTGATTATCTTTTGTCCC
TGAGAAAATCAAAGTTAGTCCTTATTCATAAGCCCTCAGAGTGAAGCCCAGTCTGTGCTG
TAGTACCCCAAGAAGTCTCTTTCTAGAGGAGTGCTAAGTTTGTGTTATTCTTACCCATAT
GGGTGATTTTTCCAGTATGTAAGGAGGCTTAACAATCTGTCACAGCAGATAATGGAAATA
AATGAGCAAAATCCAAATTTATGAAGTTGAAGGGTAACCATATTATGGTTGATGGTGGTG
CAGATTCTTGTTTTATGTATGTTAATGGTTTATTAAGTTTGTTTTGTGTTGTATCATTGC
TTTCTAGAATTTTGATAAGCTAAATGTAAGGACGACACATTATACACCCCTTCCTTGTGG
TTCAAATCCTCTGAAGAGGGAGATTGGGGACTATATCAGGTAGGTGTGTTGGGAGCAAGC
ACTGTTCAAACCTATGTTCTTTTCAAAATGACCCTTTCACATCAGTTATTCAAGGAGCTA
GTGGCATTTTAGAATGACATTGCCCTAAATATCTCATAACCTGTACCCATGGTGAACTCT
TCTTTTTTGCTCTTCAGATTTAGTTTTTATTAGAGGACCAGAGCTGATGGCATACTAATT
TTTTTTTTTCCATTCTAGGACAGGTTTCATTAATCTTGACAAGCCCTCCAACCCCTCCTC
CCATGAGGTGGTAGCCTGGATCCGACGAATACTTCGGGTGGAGAAGACGGGACACAGTGG
TACCCTGGATCCCAAGGTGACGGGCTGTTTAATTGTGTGCATAGAACGAGCCACTCGTTT
GGTGAAATCACAACAGAGTGCAGGTATGTGGAAGAGGTGGCTACTTGGAGATTGGAAGGC
TTTCTGCATTTCCTTTCCTTTCTCCATTTTGGCTCTTGGAAGTGATTTCTTCATTAGTAA
AAAAAAAAAAAAAAAATTCTAAGCAGGGGTACTCTTGGTTTATACCTCCTGTCCTCTGCC
AGATCCTGGTGGGTGTGCCTTTCTTGGAGTTCCGGGTACTAGGATTGTGCACATCGGGCT
GACTAGATCTATTCCTGGCACTGAGGCCAAGCTGTGTCTGATTCCAGCTCTAGGCTTATC
ACTCCAGGCTCCTCTAACTCCGCACTGCTGCTTCTGCCTGAAGTGCCCTTCCCTCATTCT
CATCTGGGAGAACTTTCCTGCTTGATCTTAGAAAGGATTTTTTTCCAGGCAGGCTCTACA
CTGGGTAGTCCAACTGTCCCTGTCAGCACGTCAAAAGTTGAACACCTGATGAGAGACAGT
GTCTTCATTCCTTTCCCACATCCACACACCATGAAATCTGTCTTATTGCAAATTTTACAG
AAACAGGAGGTCAAATTGCTTGCTTTTTCCCTGCTGCACAAAATGAGAGTGATGTGAGCA
TATAAAAAATACAGAAAACTCAGTGGCCACACCTGACTACTCTTTTGTCATTTTTCAGGC
AAAGAGTATGTGGGAATTGTCCGGCTGCACAATGCTATTGAAGGGGGTACTCAGCTTTCT
AGGGTAAGTCTGTAATTGTAAGGAGGTCACCTTTTGGCGACTTGGGTCTCTGAGCCCCTG
GACAGCTGGAGACAGGTTGGTTTTCCTGGCTGGCCTTTCTCGTGCTCTTTTCACTGGGCT
GTCCTGGCCATCTTGGATGGGTGACTGCAGATGGTAGGGGCACTTCCAGCCATGTCTTCT
GAGGTGAAGGTCCTATGGCCCTGAGCCATCTCAGCGTAGTTGAAGAAAGTAAAACTTGAA
AGGGCATTTTAGATCTTAAATGATTGAAAGAAACCTTTTGTGTTTCATTTGTGTCCTTAA
ACTCGCCAGATATTCCCTTTGATCTTATTGAAAAGTCCATCTAATGAGAGTCTTTATTTT
CATTTGTGCTTATTCTCAGGCCCTGGAAACTCTGACTGGTGCCTTATTCCAGCGTCCCCC
ACTTATTGCTGCAGTAAAGAGGCAGCTCCGAGTGCGGACCATCTATGAGAGCAAGATGAT
TGAGTATGACCCTGAAAGAAGATTAGGTGGGTCAAGATTAGGCCTGTGAGCAACTGAATT
GATGCAGACCACACATGGAATCCATTGTCGAGAGTTGTATTCTGTTGTTAAAAGTGGATG
CCCTTAGTGTATGGTAGAGTCATGGCCTATGTGTGTTGTCTCTAGTTTCACTGGCTCAGA
GAATAACTTTGGGTTTCTCAACTGGTGATGTGTTTACTTTGGAAAATATGTGCTGCTTTT
GTGTGTGTGTATCAGGAATCTTTTGGGTGAGTTGTGAGGCCGGCACCTACATTCGGACGC
TGTGTGTGCACCTTGGTTTGTTATTGGGAGTTGGCGGTCAGATGCAGGAACTTCGGAGAG
TTCGTTCTGGAGTCATGAGCGAAAAGGTACACCATTGTGGAGCTAGAAGCATTAGAGCTT
GTACTTAATATCTTCCATCCCTTGGTGGAACGCCACCTGCTTCACATCCTAGAAAAGGCA
ATTTCCAAAGCGTTGAGTTCAGTTCAGGGTAGCTTCCCTGTTCTGTTAATTAAACTTTGG
AACATTGAAACATGGGCTAGGGGGCATGATTGGATAGAAAGCATTGCTCTATTCATTTAC
TTCCCAGCCTACAAAAGTGTCTGCTTAGATTTAAATATATCTACAGTTAAAGAGGTCCAG
AAGAGAGGTGATTCTGAAGGGACTGAAGACAGATGAGCTTGGACTAGCAGACAAGACTAA
ATTCATTCAGTTTTTGGAAGTTTGGGGTCTGTTGGGCTGAGATACAGTGACACTGAATAA
TTTCCATACATGGCTGCCTTTCAGGACCACATGGTGACGATGCATGACGTGCTTGATGCC
CAGTGGCTGTACGACAACCACAAGGATGAGAGTTACCTGCGCCGAGTTGTTTACCCTTTG
GAAAAGCTGTTGACATCTCATAAGCGGCTGGTTATGAAAGACAGTGCAGTAAGTTCTGGG
TTTCAAGACTACGTTTGGACAAAATGATGAGAGACATGGTCCATGTTCTGAAAACTTCAT
TCTGTTTAAAGATGTGAAACATGATGTCATGAACTTATATTTTCCTTTGGGTTTATTTTC
TTTTTTTCAACTTTTGTAGATTGGGCACTGGATCCTTTTGTGGTTAATAATGGAAGCATT
GGGGCTGGCTCTGTGGCCTAGTGGTTAAGTTCAGCGCACTCCACTTCAGCGGCCTGTTGA
GTTCCCAGGCATAGACCTACACCACTTGGTGGCGACTCACATACAAAATATAGGAAGGTT
GGCACAGATGTTAGCTCAGGGACACTCTCCCTCAGGAAAAACAAAACCCAAACATACTGA
GTTCAAGTGAAAATTTAATGCTAGGTCTAATTCCATTTCAAACTAAGGCAAATTAATTAA
ACATTTACTTTAAGAGTTCTCCCATAGTAAGTAACTTGGTTCAAGAAATAGACTGTCAGT
GGTACATAAAATTTGCCCTCCTATAACCTGATAGTTCTGCTTGTGCCTGAGAAACCTTGA
TTTATCTGAATGATTGGTAGAAAAGGTTGTTTTGATAGGGATAAAAGGTTGAGACTAGAG
AGTTTCAGAGAGGTTATTTCTGTTTTAGGGATTTCAATGAAAAGTTTCATCCTGTTTAAA
TTCTAGTTTGAGGCTATGAAACCTAAACATCACTGAGCTTATCGAGTCTTTTTTCTTAGC
ATATTTACTAAATAACCTTATTATCGAGAGTAGTTGTCTTAATGACGCAAGTAAATATGT
AAAATGGTGTCAGTTTGGGTTTCCTCTCTAGTAGTGATTTATGGATGAGTTTTGCTTTCC
AAGTAGTCCAGAATTTTGTAAAAAGCCTTGTTATTACTAATGACATTGTGATCAATGTGG
CTTTTATAAATTAACATTGTAATTGTGGCCAAGAGCATAATCAATTTTTGTTAAATAATA
TGTAACAATAAAAATTAGTTCTGAAGGGTATAAATTTCTGTATACATTTAATAATTTGAG
GTTGATCATTCATATTCAAATCTTAAATTACACAGATGTTTGCATGTTTTGTATGTTAAA
GTTAAAAGACAAAAGAGGTATACTAAAATGATTGAAAAAACTTAATCACATAGAACAACA
TAAATGTGATATACCCTCCTTATGCTGGGGTTAAACTGGTGGCTTCTGGGTGAATTTAAG
GGGAGGGTGGAAATATAGTCGGCAAAAGAGATCTTTCTGAGTGAAGACAAGATGGGACAA
GGCAGATGGATGCATTGAGTGCCATTGAACTCAGGAAGAGGTGGCCTTAACTTATACCTC
TTTGCCTATAACTTAATGTCAAAATTTGTGTATAATTGGTTCAACAGGCCTCGGTAATCT
TGCTTGCAAGTTACTTTGGGAGCCTAATAAATCTAATAGGTCTCCTAGTTCTCTTAGACT
TTTTCCCTTAACGATAAGGAATAGAGAAGAGCAATTAAGGAAAACTAAAGCTGGATCTTG
GTTTAAGAAGAAAACACCTTTAAGTCCATGGACATACAGAGAGCAGCTATTTTTGAAGTC
CTCTTTAACCTTTCTGAGACCACATGTACCAAGCCCCTAGCACACAGTGGGTGGTCGCTA
TTATTCTGAGTCCCTTCATAAGCGGGATTTCACAGGTGGGAGAGCATTCACAGGCTCCCT
CCCCCTTGTCCTCCTTTGTTCTGGTGTGGGCGTGGGATGGAGGGCAGTGGCTTGGCCTCT
CATGGGTGATGCCATCCTTGCAGGTGAATGCAATCTGCTATGGGGCAAAGATCATGCTTC
CAGGTGTTCTCCGATACGAGGATGGCATTGAAGTCAATCAGGAGATCGTGGTCATCACTA
CCAAAGGGGAAGCAATCTGCATGGGTAAGAGCAGAAGTCACCCTCATCCCTTCTGCACCA
TCACAGCCAGGCTCACCAAGAGCAAGTCCTCAAAGTCCTGGCCCCTCAGGTGGACTAAGC
ATTGTGTTACCTGGGGTCTTTTGGGAGTGGTCACAGCAAAGGGCCGTGTCAGACAGGCAC
AGGCAAGGAGGTAAGTGGGGTTTCCCTTTGTCCCACTGGCTGCTTTTAGAGGCCATGTCT
CAGCAGCTTGGCCCTCCAGTGGGAAGAGAGGAACTCATTAATGAAGGGGAATAAATGTCC
ATGGCAAGTGAGATGGACAGCCATTAGTCTCTTCCTTGTCTGCTTATAGCAGTGAACCTG
TAAAACTTTAGCTGCTATTGGATTGTCCCTTAAAGCTTCACATGTTCCATGGCCCCAAAG
CAGGTGTGCATGCTGTTCCCTGTGTGTGGCTTGAGCCCCAAGCCTGATGGGTATCTCTTT
AGGGTACCTTGTTGAGGTGTTCCCTTCCGGTCTGGCTGTTGTCTGTGGAGATGGAGCCCT
CCATGGCTCTCTTGCCTGCTCACAGCTGAGAAAAGGGATGCTGATGACATGCTTTATTTC
TGGTGCAAATTTGGCACATTAAGTGGGTAGCTCTGATTCACTTATTAAGAGGTTTCCCAA
GATCTAAGAAGCATTGATTTTTATTAGTGTGATTAATACCAGTATTTTTTTTATCTTGAT
AAGTTTAACATGATTTCAAAGAAGAAAACCTCAAGGCAGTAGAGCTTAGAGTTTTAAATG
GGTTTTAAAAAGTTGTATAGAACAGTGGAATTCAGGCTCATGGGTTATTGAGTCTTTCCC
CTTCAGATCATTCTTTTATCTCTTCCCAATGCCTGCAGCTATTGCATTAATGACCACAGC
AGTGATCTCTACCTGCGATCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAG
AGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGTAAGTGGGACTGAGTGTGTGTC
CCTGCTGCCACAGCCTTGCCGTCTCCTGGGCTCTAGAGAATTGACAGTGAGTAGAAACGG
GCTCGTCTGAGACCAGATTTCAGTTGGACGAGGGGAAGCAGATGGGTATCATTCACATTA
CACAATGGGATGGTGAATTTCAGCCAACTTGAGGGCTTATCACAGAGTGCAGAGAGGTGT
CTGTCACTCAAGAGTCCACAGTGAGGGGCTTGACCTAGGTAGGGGATCTGGGTAAGGGAT
CTTAGCTTGAGCCATGCCAGTACGAAGGACGTAACATGAGTTGTTGATGAGGTGAAGAGG
GGAGGGAAGAGTCCAGGGCAGCTGAAACAGGATGTGCAAAGGCCCTGTGGGGAAGGTGTG
CCACAAAGTGACACTGCAGAGGCTCTCACTAATACAATAATAAGCTTTGTGACCTTTGAG
AAGTCCCATATTTGCTCCTGTTGTATGTGTGCAGTCATAATACCTGCTTCATGTGTTGAC
ACTGTTCTGATGTTGAAACCCTCATGCTCCACCAGGCAAGTCAAAAGAGGCTGATGATCA
AGCAGGGCCTTCTGGACAAGCACGGCAAGCCCACGGAGAGCACACCTGTTGCCTGGACAC
AGGAGTATGTCGACTACAGGTGAGGATGTCCACTGTAGTGAGGGTGGGAGGATTTAGAGC
CCAGAGGGGAAGACACAGCATGCTGGCCACCTGGATGAGTACGTCAGTTACAAGTGAGGA
GGGTCCTGGAGCTTGGGTATGGGGAAGGGACAGATTTAGTTTGGGAGAAACTTGCTAAAT
GTGGGACCATAGGAGCCTCTGGTGGCTCATGAGGCCTTGGGGGTTCTAAGGTAGCAGCAG
GTGCTTCACCTTGACTGCCTGGGCCAGTTAGGGGCTGGGGCCTGCACAGCAGACAGTTAT
CCCTTTCTAGTCTGGGTCATGGGACTCTAGAGGGAGTCAGTCTGCAACAGCAAGTGGTGA
GTTCTTCTTCTGTCCAGCGTCAGTATTTTGATGGTGGCTTTAGACTTGCCGGATAGCACT
GATAAACTGAGGAGGCAGCAGTACCTCCATGGAAAGCTGTTCAATGAATCTAACCTATTG
CTACCTCCCCTCTTTCAGTGATTCTGCAAAGACAGAGGTGGTGGCCAAAGCAGCACAAGC
TCCGCAGGTAGTTGCTGAGGTGGTAAAAACTCCAAAGGTAGTTGCCGAAGCAGTGAAAGC
CCCAAAGGTGAGTGGTGTGCTGTGATCAGTTTGGAATGAGCTTTGGGAGATGTTTCTGCT
TTGCTCATCTCCATGACCATGTGCAGTCCAGCGGCATGTGCTGGCTCAGTTCAGCAGGGC
TTCCCGCCCCCACGGTGCACAGTGTGCACTGAGGTGATATCATCTCGTACCCCAGGTGTA
TTTGTTTAGCCTCTGCGGTCTCCAAATCACTTTCCCTGTTGTATCTGCTGGGAGGAGTGT
GGGCTCAGCCCCCACCTCAGTGAGGCAGCAACACCCGAACAGGGTAGGGGTGCACTGCAT
ATTATTCTGGCCCTCACTCTGGGTCAACTGGTGGCACAGGTGTGTTGAAATCAGAGGCTG
TGACACTTGGAGCTGAACAAAACTCACCAGGGAGCAAAATGACCTGAGGCCGACACATCT
CTAGAGAGCACTGGCTTAGTGTTTCAAAAGTCTGAGGAAAGCGTGTGGTGGCAGCTCCAC
TTCCTAAGGTTGGGAACCGCTGGCATTAGAGCATAGAATGGCATGTCCAAAACCTTGGGT
GGCAGTGAATGACCTGAAACGAGGGATCTGAGAAGAGCTTCTCCTGGCCTGCTTTGGGCC
TGTGAGATGTGAAGTCCTGGCTTGCCTGCCTGCCTTGAAGACTTGTGGGGAGCATCCCTA
GAGGGCAGGTAGTCTAGATTGTTACATGAGGGAGGTTAGGCCCGGAGCAAAATGGCTTGC
TTGGGGCCTTTCAGCCCCCGGGCACTGCACTGCTACTTTGGTGCTCCTGCCATGCCGATG
GCTTCCTGGTCTTTGGGAATGAGACCACTTCAAATCCTCTGTAAACCAAGGCTCTGTCAG
GGTTCATAATTAGAAAATTTCTTGTTGGATCCAGTCAGGATCTTTTCTGGTGGCTCCCAC
CTTTTGATTTACTGAAGCTTTCTCATCCGTTTTTGCCCAAGAGCTAACATTTGGTCAATT
GTCTCTGCCTTAGCGGAAGCGAGAGAGTGAAAGTGATGAGACATCTCCAGTGTCTCCACA
GTTGATCAAGAAGGAAAAGAAGAAGAAGAAAGACAAGAAGACCAAGGCTGCTCTAGAGAG
TGCTGGCGAGCCGGGAGACAGGGTGTGTATAAGCACTTTCAGGATACTTGGGCTCGCTCA
GTCCTTGGAGAGGAAGGAGTTGCTCAGGTGGCACTGCCCTGTGTTCCTGGAGTGCCTTTG
TCCTCCCCCGCCTCCGTGGGATGGACAGAGCCAGGCCCTGGCATTTTATAGTAACTGCTC
ATAGTTAGAATTCTGTTGATGGTGGGTGGGGAAGATGTCTACCTTGGGAAACTGAATGCT
CCCATTTGTGAAAGTAGACCTGCTGCAGCAGCACTGAAAAGCTCAGGACTTGTGTTAATG
TGCAAAATTTCCTTAACCCAGAGTATCCTTACAGATCCTGAAAAGGCTCAGTTGATTGGG
TAGAACTTCCCTGATTTCCTTTTGGGACTGTAGCAATGGTTCTGTTAGCAGATGCTGTGA
GCTTGCTTTCTCTTTCTCTTAGGACAGTGACATCACCAAAAAGAAGAAGAAGAAGAAGAA
AATAAAAGTGGAAATGCTTTCTGAGTAGTGGAAACCACTTTAAGCATTCTGTCCAGCTGG
GAGGAGAAATTAAAGCCTTGTTGAGAAAACATAGTTCTTTTTGTTCTTGAGAGAATGGAA
CATAGGTCCCAGAAAAAGGAGAGATCCAGCACATCTTAGCTGCTGCCTGAGACCTCAGTG
ATGTTACCTGGTGTGGTCATCCCATCTTGTCCTGTTTTAAGGATATGGGTGAAGGAGGCA
GGTTTGATGCCACCCACTTTTCTGCTTGGGAGAGTTGGGAAGCCTTGCCTTTAGAGCCAG
CACTGCCCAGTAACCATCAGCAGCTGTTTCCTGGTGGCCATTTTGACATAGTCCTCTCCT
AGGTTGCTTCCCACTCCATTTAAAAAGTTTGTAAAAGTTAAGTCTGCTCGGTGGACTGGT
GTAGAGCAAGTAAAAATATAACAATCATGTTCAGTGTCCTCTGAGGTGTCAGAGCCACCT
CTGTCACCCCATATTTCCCTTCTGGATATAGGCCTGGCAAGGACTCGCAGTGTTCCATTT
TGTCAGCTATTTGCAGTCCTCCTCTGGTCTGTCCATCCCTTATGCACTTCTTCAGGCACC
CAAATCCATCCGGCTACTTGCATTTGTGACAGAAGCCAAAAAACTATTCCTCTGTTCTCT
TATTCTAACCCTCATTTACTTTCAAGGGATGCAGTATGCATTACTGGGAGAAGAAGGTTG
TAATTTTTACTTAACTAAAGTTTACTTAAGTTTTTAAAGCATTTCTGTTGGATTTTCTAA
TTGTTGGTGATCTCAAACTAATAGAACAAAAAGTATAAAATATTTTGATTAAAAATCTAG
GGACCTTTATGTCCTATTTGAAATATGATGTTTTTCCTTTATGTTTGGTTAGTTTTCTTT
CTCTAGTTCTGTGTCTTGCAACATTCACCTTGGGGTCTATCATCTGGTATGGGACCAAAT
ACTCTGGAATCTTCATTCAAGATACTGATTAGATAACAAAAAGGGAATCATCACAAATTA
AGTGATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1824..1891, 2345..2431, 3847..3938, 4158..4342, 4978..5042, 5419..5545, 5775..5905, 6324..6467, 8243..8363, 9218..9336, 9875..9978, 10458..10536, 11533..11661, 12082..12147
1063..1078, 1824..1891, 2345..2431, 3847..3938, 4158..4342, 4978..5042, 5419..5545, 5775..5905, 6324..6467, 8243..8363, 9218..9336, 9875..9978, 10458..10536, 11533..11661, 12082..12144
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved