Equus_caballus Locus ENSECAG00000017154
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000017154
Equus_caballus
ENSECAG00000017154
X
SNORA70
3045..3179
4679
GGGGGGGGGGGGGGGGCGGGGACAGGCGGGTGCCACATTTTGGGTCCCTGTAGGGTGGA
AGCTCCCAGGAGCGCGGAGCAAAAGCAGCTTTCAGAGGCCAGGACTGGAGCATGGTCGCA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCAGCAAAAGGCCTACTGCAGACTCTTCGGTTAGGACAGGGCGA
ACGGGGGGCGGGTCCTCTCCGCTCTGGCTTCCCCTGTCAACAAAAGGAACGCGGGACGAG
GGTTCAGCATAGCGCGTCCCTGCCGGGCCCTGGAGCCCAGAGGGAGGCACAGAGGGCGTG
TCCCGGGCCCCGCGACTCTCGGGAACACGAGCGCGACCATGAGCCCCACTCGGGAGTACT
TTGCTTCTTTCAACTCTAGGAACATACGCCTTTCATAGTTACGGCAAAGCCTCGGGCACG
AGTTCTACGCCCAAGATGGCCAGCCGGAAGCGGGCTTCTCGTGCGGATGTGGCAAGACCC
CATTTGTCAGCTTGCCGCCCGCGACGGGGTGCACAGCCGCCTCCCCGCTCTGCGCAAGGG
CCCGGCCACGCCCGCACGCAGGCGCAGGGCGCCTCTGCGTCTATGGTCAGGAAGTGACAG
AGCGTCCACCCGCCTTCGCCCGGACTCTATGGTTCCTACGCGCGAAGATAGACCGCCTAT
ATAAGGCATGCGCAGGGGAGAGAGCGCCTTTTTCCCACCGGCGCGGTGAGTAGTTGTTGG
TCTGAGCTTATGTGGTGCGGTTGCCGGTTCTCTCCTTTGGTTTGAGGCCTGTCCCCCTTT
TCTCTTCCGACTTTCTTTGTTTCGTTTCAGCCACTGAAGATCCTGGTGTCGCCATGGGCC
GCCGCCCCGCCCGATGGTGAGTGCCGTATCCATGCAGTTTTGCTGCCGGGAAAAGGGGAG
GGAGAACTCCCTTTGCCCTCTAAAAGCAATCGTGAGATGGGGCGGCTTTCCGGTCGTGGG
AACAGCCTCTACGTTTTCCCCAATGTCTTCCAAGTCGCTTTAGGTCTTCGTTTATATAAT
CTGTTTCTTTGAAAGCTCATGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTTTGGGCGGACAT
GCCGGTGTGGTGGTTCCGGGACTCCAGGCGGCAGTCCGGGAAAATCGGGCTCAGGCTTAT
GTGCCCTGCAGGGGGCGCCTGGAGCCCATCACGTGGCTCGGAGGCGGGTTTAATACCACG
TGCTCAGGTCTTTAGGTGGATGGCATGAACTGTGCCATTAGGCAGCAAATTTGTAGTATG
CGGTGCCTTGAAGGGAGATTTTTTTTTTAACTGGACAAGTCTATTTCAAAGTGTTGGCAT
TAGAGCGGGTTAAAAACCCGATAGGGAGTAAGGAAGATGTTTTTGCTTTCGTGTTTCTAG
CATGGATGTTCTCCACCTTTTCATCACCTCGTTCAGACCGTCTCTTGCTTTAGAGCCAAT
TTCTAGGAATGGGCCTCCTTAGAGATTGACATATTTCACCCCCCCTTTCCCAGCCCTACT
TTGGTCTTAACTTGAGGGAACACTCAAAGTACCTATTGTCGAGTTCACTTGTGGACCCCT
GCAAACTTGGGTTTTTCCTCCCCTGCAGTTACCGGTATTGTAAGAACAAGCCATACCCAA
AGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAAGAGCTCCCAAACTGATTTGG
CTGCACTGACCTGGTTGCCTATGCGGCCCCCCCCCCACACACACACACTTACTTGAGGTT
TTTTCAGACGCCAAGATTCGCATTTTCGATCTGGGGCGGAAGAAGGCAAAAGTTGATGAG
TTCCCACTTTGTGGCCACATGGTGTCTGATGAATATGAGCAGCTCTCCTCAGAAGGTGAG
GCAGGATTCTTTGCTAATCACGTGTAGTCTCTTCTATATACTCTCCCAGTCGGACTCAGA
GCACTCTACTGTAATTACCAGTTCATTAATCATGAGCACCCAATTGTAAACCTCTTTGCA
AAATTCAGCTGGCCAATACAGATGTCCCCAGAGCCAGGGAGGGCCATGGTAAGTACTTGT
GTGCCGTTGTGTCTCATTCTGCCTGCCTTTCCCTCTACTTAGCCCTGGAGGCTGCTCGTA
TTTGTGCCAACAAGTACATGGTGAAAAGCTGTGGCAAAGATGGCTTTCACATCCGAGTGC
GGCTCCATCCCTTCCATGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACA
GGTGAGCTGGGTCCTGGTTCTTAGCTTTTTTAGTTATTTTCTCATAACTTGAGGCCTCTG
GCTTGATTTTTTTTCCCATCAGTTAGGGGAAAGAGGTGGCCCCACATAAAGACTCAGCCA
CCCATAGCAAAGCCAGGCCAAGGGCTGACAGGTGTATTTCACTGGACGCTTTCCCCTCAC
CACTACATAGATGAACAGAACTGACTCCCAGAAACAAACACAGAAGGCATCATGGCTAAG
CAGCCTCTGGGCAGCGGGTGGAGGGAGGTGGCTCTGAGGGAGTAGCTCCTCTTGCTGTGA
AACTGATGACAGTCTGCCAGCAAGCAGGTAGGTTGGGTGCTCACAGTTTGGAGAGCTTTC
ATTAGTCTGTTTTTTGGTCTTTTCTGTTTGGGGGTTCTCTGTTCTCTGCAGCCAATTAAG
CCGACCGGGTCCTTTTCCCCATGGGGGCCCGGTGTGCACTGGCTGCAAACAGCAGCCTCC
TTGGTAGTGTATGCAGCCTGTTGCTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCC
CTTTCCAGTGGACATTTCATGTCGGATGCTATCCTCAATCTAGGCTCCAAACCGGTATGC
GGGGTGCCTTTGGAAAGCCCCAAGGCACAGTGGCTAGGGTCCACATTGGCCAAGTCATCA
TGTCTATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAAGCCCTACGCAGGGCCA
AGTTCAAGTTCCCTGGCCGCCAGAAGGTAAGTAGTGCTGCAGCTTTGGTCGCATCTTTTC
TTGCTCTAGTCCTCGGGCCTCCTGACTCACCTCTGTGTCTCTCTCCCTAGATTCACATCT
CGAAGAAGTGGGGCTTTACTAAGTTTAATGCAGATGAATTTGAAGACATGGTGGCTGAAA
AGCGGCTCATCCCAGATGGCTGTGGAGTTAAATACATCCCTAATCGTGGCCCCCTGGACA
AATGGCGAGCCCTGCACTCATGAGAGCCTCAGCACTGCTCTCTTCTTACTCATGCCCATC
AATAAATCCTACTTACTGTTCATCTGTCTTTGCATCTGGATTCATGCCAGCAGAGCCTCT
GGGAACCCTAGGGTCACTGTCCCTTCTTCAGAAAAAGGCTGACAACTAAGCTGGCCAGCT
GTCACTTTATTACCAGTGAGGGAACAAACCCAGAGCATGGGCTAGGACTAGCAGCCTCTC
TTAAGTTGCCTCTTGGGAACATTGACTCAGACCCGCCTCCATCAGATGCTGTAGGTTCAC
AGTCCCCTTTTGAGTTGTTAAGCAATCTCCTTGACTCACTGCTCTACCCACCCCCACCCC
CCAACTTCTAGGGCCTTACTCGCAGGGCCCTCTCCACCACTGGCCAGTGTCCACCCTCAC
ACCAAGCTCCCACAGCTGAATTGGCCCATAGCACTTGGCAGCAAGAGGCCTTTGGGCAAA
CAGTGCGTAGCCCTCCTTGGCCTAAGGATCCCCATGTGCTGTCTGGTGCCCCAACTGTGC
CAGGGCTACTCTGCTGCAAGAGCAATGGTAGGACTCCAGTGTTCTAGGGGAGCAGCAAAG
AGGCCTGCAGAGCTCTGCTAGCCAGGGTGGCCTGAGGCTGTACACCTGGGAGAAGACAGC
GAAGGGATCTGATTCCAGGACTACACATGGTGGGGAGAGCTGCTCCAGTCTGCTGGCTGC
TCCCCAGGCAGGCCTCCATGCGGAGCTTAGTCCCCATGGCCCCTCAGGCCTCTGGCTTTT
TGTGATTTTTATCTACAGCCATTTTTTTTCTTTTAAAAGGCTTCTTATTAAGTTTTGTTT
TCGTTTTTATAACGGTTGGCCCTGAGCTAACATCTGCTACCAATCTTTTCTTTTTTCTTC
TCCCCACAGCCTCCTGGTACATAGTTGTATATTCTAGTTGTAGGTTCTTCTAGTTGTGCT
ATGTGGGACGCCGTGTCAGCATGGCCTGATGAGCAGTGCTAGGTCTGCGCCCGGGATCCA
AACCTGCGAACCCCAAGTGTCTGAAGCGGAGCGCATAAACTTAACCACTTGCCACGGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 2008..2066, 2167..2274, 2502..2640, 3223..3385, 3470..3679
1013..1035, 2008..2066, 2167..2274, 2502..2640, 3223..3385, 3470..3619
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved