Equus_caballus Locus ENSECAG00000021380
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000021380
Equus_caballus
ENSECAG00000021380
X
SNORD61
2441..2512
7389
CTATGGCTCCTTTCTTTTCTCCTTTCAGATCTGATCTCCAAAGTCATCTCTTTACATAG
ACCTTCTGTGACGTCTTAATCAGATTTGGGCTCCCAAATATTGTCCATCAAAGCACTTGG
CTTCCTTCCTCCCTGGCACTAATCACAGCATGCAGTTGTTTAATTTGTTAATTGTATTTA
ATTTTTTCTTTAGTTTTTAAAAAATTAGAATTTTTTAAACTTTTGTATTCCCTCCCATTT
AGGATTGGCAGATAAAATACAGAATGCCCGGTTAGATTTGAATTTCAGATAAACGAGTAA
GTTTTTTTGCATATGATATTGGGACAGAAAGAATTATTTGTTTTCTGAAATTCAAACTTA
ACTGGGCGTGCTGTATTTTTATTTGCTAAATCTGGCAGCTTTACCCACGAGGCGCCTTGC
CCTTGTCTCGCTTGTTCTGGGTTGTATCCTCACGGCCAAGCCCAGAGCCTGCCATTTAAG
AGGTGTTGAGTAATTGTTGTATATGAAGACCCGTCTACCGTTTTGGACGTTTTTTTCCCA
CCTGACATTTAACAGAATTTTCCTCACTCAATAAAAATTGTTGTTAGAGATAATTTGAAA
AAATATATTTTATTATCTAAACTTCTTTGTTTTCCGTTTCTGCAAAATTGGCAAAATAGG
AGCATGTACCCTCATCACATCTTTATGAGAATTAAGTGAGTTATCGGGTGTAAAGTTTAG
CACCGTGCCCAGCCCACTGGAACACGCGATAAATTTCATTTCTTTATTAAATGCACCCCG
TGAACCATCTTAGCGGAAAGCAAAAACGCGGGTTTGTGGGACACGGGTGGGGGCTGGGAA
AACGGTTAGAAACGGGCGCCGGCCAGAACGCAGAGAGCCCGGGAAAAGGGGAGGAGCGAG
GAGTGAACGACAGAGGAGGCAGCCAACGGGGAGGCTGGGAACCGCTCCCCCTCCCTTTGC
GTTTCAAATTCTGAGCTCCGTTTCCATCCGGGTCCTTCAGCCTCGTTCCCGGGCAGTATA
AAGTTTGCTGTCTCCTTTGTTCGCCCTCGTTGCGCAGTAGTGCTCGCGGCTTCCCCTTTC
GGTCTTCGGAGCCGGCAGCCCTCTCTCGTGCTGAGCTGCTAGGAAGCCCCTGTCGGCGAG
CTCGTAGGAGCCAGGAAGCGTCGCCCTCCCCCCCGGTACGTGCATCCTTGTCCTGACGCC
GCTTTCCGTGCGCTCCGGCCGCCTTCGAACTTGGGATTATCTCCCTGGAGATGGGGGCGG
CGGGCGCCATTTTAAGAGCCGAAAGGTGCCGACCTATTTAGATAAAGCGGAGAGTGGGGA
CGGAAGACGTGTAGGCGGCGCGTTTTGTCGTGTGCCTCTCGAGCAAGTTTGGCTGTCGCC
TGCGGGGGTGGTGGCGGAGGTCGGGGCTGGAGCGGGACGAGGCGAGACCGCGGTGGCTGC
ATCGGGATGGCGCTGGGCCGCCGCCGGCACGTGCGTCCTCCGCGGGGCCCGGTCGCTGGC
GGCCGTGCAGAGGGAGCCCTGTGAACGTTCCCAGCCGCTGCTGGGCACAGTTACTCCCTT
GACTGGTGTCTCTTGTCCTGGGCGGAATCCAAGTGTCGCCATTTTGTGTTTCCACGCGGT
TTTTAATGACAGGCTTTAATTGGGTTCTCCTGCAATCTTGGAGCGCTGTTACACTGTGCC
CTTCCACATTCCGTTATTTCATATCAAATGATTTGACACTTTTTTCCCAATCAGTAATCT
TTTCGGCGGGATAGGTTTGGCGACCGAGGGGAGGCGTAACTTGGCTCAAACTTTACATTT
CTGCTTATATTTACTAGGGGGTCCTAATGAGGAAAGACCAAGTTCTTGGAAGAGGGCTGG
GCGTTAACGACCTGCGTCTGGCCTGTGACCTTGAATGAATCGATAATTATTTTAAACCAT
TTGGTTAGGATGTGTTAATTAAATCTTGAAAAGGCAGGAAATCAAGGATTATAATTAAGA
TTCACTTTTTCAAATGTTGAATAGCCGTTACTTGATTAAAACTGCTAGGATGGATCAAGG
ATAAAGGCATTAAGTTGGCCCTTTTAACCAGTTAATGTAAACTGACCTATTACTAAACTA
TTTAAATTGGTTTCCTGCCGAGGCTTAGCAAAGACTGCTTTTGCTGTCTTTGGTTATTAA
GGAATAATGGTTTTAGTAAAAGAAAAATGTGCCCCAATAAATACATGTGTCCGATAAACT
TCAGGAACTTTTTCCAGGGAGGTAATACTGTTCTTTTTACCAGATTCTCACCAGGGAAGA
AAAATGGTTGAAGCAGATCGCCCAGGAAAGCTGTTTATTGGTGGCCTCAACACAGAAACA
AATGAGAAAGCCCTTGAAGCAGTATTTGGCAAATATGGACGGATAGTGGAAGGTGAGTTA
TTTGAAAGTTACGTTCAAAACTGTTAAAATTAAAACGATAAGCTATGATGAATTTGATTG
CATTGATTATCCAAAATGATAATATATTTTGTCCTCTAAGAAGTTCTGAGCTTTCTTTTT
ACATATTCATTTGTGTTATTTCATTCGAACTAGAGTAACACTTTTTCCCCCCGGAAAACT
ACTTTTGTTTTTTTTAGTACTGTTGATGAAAGATCGTGAAACCAACAAATCAAGAGGATT
TGCTTTTGTCACCTTCGAAAGCCCAGCAGATGCTAAGGATGCGGCCAGAGACATGAATGG
AAAGGTGAGAGTGTCCGCAAGTTGATACTATGGATCCTGGTGCATAAAATAGCACCGTAT
GTTACCCAAGGGTGGTCTAGGGCAGCCCTGGAATTTTGTTTTTGAGTGCACGCCTTTCCA
GGACCCTCTGATCATAGCCCTTTGTAATTTCAGAATCAGATTTCATAGCCAAAGTTACCG
ATTATACTCTTAAAGTCTTTCAGTTCAGAATATTATATGATAATGTTTTATCTGGAATCC
ATAAACTGATCAGATAACTTAGCTTTGCATTTTGGTTATTAGTTTTTATAAGAAGTTGTT
AACTGTCTGGCCTTGTTTTAAATTTTACTCACGAGCAGTGCAGTGGATCCAAGTTATGGT
TTGGTTTAAATCATCAGTGTCATTCTTAAAGACTGAGTAAACATTTTGAGTCAGTGGACA
AGTATCACTGGCTGTATCTGTAGCATATTTTCTTAGATTAATTGTTGAGCAAAATTTATC
TGCATTTTGAAGGACGTAACCGGTGTCACAGTGCATAGTGGATCTGCAAGTTCTTTTTTT
CCCTGTGACTTAACCATTTATTTTCATACTGATGGTGCTGGAAATTGGCTGTGGTTTGGC
TGACCCAAGTTGGACTCAACAGGGATTGGGAGGGTTCCAGTCTAATGGGTCTGCTCAGTT
CTGGTCCAGCGTCTTTATTCTGGGTCCCAAGCCGAAGGGGCAGTGGGATAGCTGAAGTTT
GCTTTTCTCATGTCACATCAGAGGAGCACAAGAGAACAAGTCAAATCACAGGCGCACATG
TAAATCATCTGCTTGCGTCATATCTGCTGACATGCTATTGGCCCAGCTTCTTTTTAAAAG
TCTATGTAATTAACCATTTTGCTATTATTTAGTCCTTAGATGGAAAAGCCATCAAGGTAG
AGCAAGCCACTAAACCATCATTTGAAAGTGGGAGACGTGGACCACCTCCACCTCCAAGAA
GCAGAGGCCCTCCGAGAGGCCTTAGAGGCGGAAGAGGAGGAAGTGGAGGAACCAGGGGAC
CTCCCTCACGTGGAGGGCACATGGGTAATGACTTGGGTCTACTTCAGGCTTGGTGTATAA
GTTAGGAACTGCAGACCCACACCAATGGGTGCTTTTGGTTAAGTCCTTGTTTAAAGGCTC
TAGCTTTTGAAATTGAGAACGCTTGCTCATCTACCAAAGTGGTTATGACTTAAAACAGAA
GGCTTCCTTAGTTAAATTGCATTTTTAAACGATGGACAATAGACTAGTCCTCATCCACGT
AGTTCATTCTGTAGGAGCAAAGCAAATGCAGGAAAGTTTTGATAGGCATCGGTGTTGGGC
ATATGAAAATAAAACAATTTGCACTTTTTCTTTGAAGTAACTTTTAAGACTACCCCCAGT
TTTTATTTTCGTAGTCTGTATAGACGTCTCATGATCTGTCTTGTACAAGTGAAAACTAAA
ACAAAATTTCCCAGCTAAATGAATGATGGTCATATTCGTGGTCAAGCAAAGAACACATTT
ACAGCTTTTTCTTGATTCTCGTGAGTATTCACGTGTTTTTCTTTTTTCTCCTAATGTAGA
TGATGGTGGCTATTCCATGAATTTTAACATGAGTTCTTCCAGGGGACCACTTCCAGTAAA
AAGAGGACCGCCACCACGAAGTGGAGGTCCTCCCCCTAAAAGATCTGCCCCTTCAGGACC
AGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGGTGAGCTTAATTACAATATGTTCTACCA
CCATAACACAGGAAAGGATTGAGAGGTAAATCTAAAAATGATGCTTAAAACTGACTCATG
AGGGCCAGCCTGGTGTCGCCTTGGTCAAGTTCACATGTTCTGCTTTGGCGCCCCCGGGGT
TCGCTGGTTCAGATCCCGGGTGCAGACCTGGCACCGCTTGGCAAGCCATGCTGTGGCAGG
TGTCCCACATATAAAGTAGAGGAAGATGGGCATGGATGTTTGCTCAGGGCCAGTCTTCCT
CAGCAAAAAGAGGAAGATGGGCATCAGATGTTAGCTCAGGGCTAATCTTCCTCAAAAAGA
AAAGAAAACTGACTCGTGGACTCCAGGTGATCTAGGTACATGCAGTTAATTAGCACTGAG
AAGAATTGAGGTGTAAATAGGAAATTTTACAGAAGATGTCTTGATTTAGCTCCATATTGT
CATATTAGGTTACATCACTACTTTTCATTGCCTGAATGTAAGTTCACATTTTTTCTCTTG
GGGTATATTTAAAAGTGATTATTTTTCTTTAAGCTCCTGTGTCGCGTGGAAGAGATAGTT
ATGGAGGCCCACCCCGAAGGGAACCCCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAA
GAGATGATGGATATTCTACTAAAGACAGGTAACAGAAAAGTATAGTAGCTTTTGTCTCAA
TGAATTGTTGAAGGAGAGCTCATCAAAAGCGTGAACTGTTACTTTTGTTGTCATAGCTAT
TCAAGCAGAGATTACCCAAGTTCTCGTGATACAAGAGATTATGCACCACCACCAAGAGAT
TATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGCTAT
AGGTAGGTGACTTGACTGTCACGCCTTGATGTGAAATAAGTGTAAAAATTGATGCCTTGG
GGATTACATGTTTCTCTCTTTAATTTAGTGATAGAGATGGCTATGGTCGTGATCGTGACT
ATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAAGATAT
TGGTTGAGGGTCTTTGAATATCACCAGCTTGAGTTTTTAGGTTCATGAGCCAGTTTATTA
GGCTGTGTGGTGCTTGCTTTTAAAGGGATGTTCGCTTGCTTTTAAGGGGGTAACTTTATC
AGCTGGGCTTTTCCTAGTTTTGTGAGGGGCTTTTGTTTTTTCTAAGTTTTTTTTTTGAGG
CTGTTTGCTTGCTTTGGAGGGGATTTTGCTTGCTTAAATTGGCAGCCTTATGTGTTTTCC
CCCAACAGTGAAAATACAATTTAAAAATTTTATTAACAAGATCAAATGTTTACCATTGCA
ATATGAAGGAAAGTCTACAGTTCAAAATTGCAACTTATCACTGGAAAGTGGCTGAGTGTC
TACTATAAAATAACAAGCTCTCTGGAATATCCTCTTGAAATACACACCGTCTTCAGTCTT
TTCAAACAAACATTAAAACCCATCCATTTCCGTATCTCAGCAGATGAGCAAATCCCTGTA
ATGGCCAGCAATGGCAGAGTTTAAAACCTCCCAGTTGAGAAAGTAAACGTTTAATACAAG
AATTCTGTAAATTCAGATTTAAATGTTGTATATATACAATTTATAGTGTTGCCATATTAC
CTGACCATTGACCCTGCAGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCA
TCATATGGTGGAAGCAGTCGCTATGATGATTACAGCAGCTCACGTGACGGATATGGTGGA
AGTCGAGACAGTTACTCAAGCAGCCGAAGTGATCTCTACTCAAGTGGTCGTGATCGGGTT
GGCAGACAAGAAAGAGGGCTTCCCCCTTCTATGGAAAGGGGGTACCCTCCTCCACGTGAT
TCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAGGTGGTGGCCGTGGAGGAAGCCGATCT
GATAGAGGGGGAGGCAGAAGCAGATATTAAAAACAAACAAAACTTTGGACCAAAATCCCT
GTTCAAAGAAACAAACAAAAAGTGGAACCTATTCTGTCATAACTACCCAAGGACTACTAA
AAGGAAAAATTGTGTTACCTTTTTTAAATTTCCTGTTAAGTTCCCCTTCCATAATTTTTA
TGTTCTTGTGAGGAAAAAAGTAAAACATGTTTAATCTTATTTGATTTTATGACATTGCTT
TCAACAAGCAAATGTTAAATGTGTTAAGACTTTACTTGTGTAGTAGTGTTGTAATTTTCC
AAGTAAAAGTTTCCCTAAAGGCCACTTCCTATCTGATTTTTCCCAGTAAATAAGGCAAAC
AATTTTAAGATCTTCCACAGACATCTAGCCATCTAAAATGGAGAGATGGCTCTTTCTGCC
TACATAAACAAGCTAGCTCTATATAGAGGGTGGTCGGGTTATGCTACTCTTAGGATTTCA
GGGTGTCTTCAAACTGAAATCTCAATGTTCTCAGTCTGAAAAACCTGAGATCAGATGCTT
ATGTAAGGAAAGTGCTATTCACCCAGTAAACCCAAAACAAGTGGATAATGCTGGCCATAT
TGCCTTTCTGACATTTCCTTGGGAATCTACAAGAACCTCCCCTTTCCCCCTCCCCCAATA
AGACCATTTAAGTGTGTGTTAAGCAACTACAGAATACTAAATAAAAAGTTTGGCCAAAAC
CAACCATGAAGCTGCAAACGATGCTTGCTCTTACTGTTTCAAATTTTTGCAACTCTGTAG
TGTCTCACTTTTAAGGAACAGCTTGATTGCAAAGGAGAAAATAGATAAGCAATGAAGTTA
TCTCCAACTTCTCAAAGGCTTATGACTTCTAAAAAGTGAATCTATCAGCATTCCACATCA
GATTTAAAGCATCAAATGCCTGTGAAACAGCAAAGATGGTAAGCAAAGCAAACTAGTTTT
TCCGTCTAAGTCGAAATTGAACACTTAAACCTTCCTCCTAGTACAGTGAAACACTGTACC
TCATGGCGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1174, 2263..2391, 2597..2703, 3572..3743, 4259..4411, 4953..5067, 5156..5281, 5368..5450, 6079..6389
2283..2391, 2597..2703, 3572..3743, 4259..4411, 4953..5067, 5156..5281, 5368..5450, 6079..6386
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved