Equus_caballus Locus RPL39
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL39
Equus_caballus
RPL39
X
SNORA69
3426..3558
5279
GGAACTTAACCGCTGCGCCACCAGGCTGGCTCCTCATCTCTGATTTCTATTGGCAACCA
AGTACTGTAGTTTGTTGCATACATTGTAAATAAAGAAAAACGCTACATCTTAGTCAGTTT
GATGGAAATGAATTTGTGACTTTTTATCCAAGTTCACTTTGGAGTCTACACATCGATGCT
TTGTTGACCCCAGATTAAAAACTCCTCCCTTGACCTCTGGTGCAAATATGCTTGAGGTGA
CTGCAAAGACACAGAGGTTTTTGTTTTCAAAAGGGGAGAAGAAAAGGATGAACAGGGGAA
TCATTACCAAAAAGTATGCCATGAATTCCTATACATTTTGCCAAAGTGAGCTACAGCCAG
TCTGGGCTTCCTAGTGGCCAAAGAAGAGGTTCTGTCCAGAACTCGGCTTAAACCTTGACT
GGCAACCGCCTGCCCAGCCTAACGCTCCTCGGCCGGCCCTAGACCGACAGGGCCCACTCG
GTGCAGCCCCCGCCGACCTCTCCTGCTTCCTCCAACCTCACTGTCCCTCCTGGTCCCGCA
CCGCGCAGCCAGATGGAAACCACCCCCAGCAGTCAAGCAAAGGCCAGGCGGTCGTCACGC
CAGGCCGCTCGGGCGGGGCGTGCCCAGCTGCCACCCCGCGGCGCGCTCACGACCGAAGTC
CCTTGCGCTCGGACGTGACGTGTCCCTGGCCCTCCACCGGAGCAGCCCTGCCTCCCCCTC
GTGCCTTCCGAAGGATCTCTGCTTTGGCCGTATCGCGGGCCGTCTGCCTCGGCCACAAAG
TGGGGTGCCCTGGCATGCTGACGGGCCCTGAGGAGCCCACTTACGGAAGCGAACCCCATT
TCGCACGAATCAGTGCGGTCTCCCACGGCTCCATGGGACCGAGCAAGGGGGTGCGGCCTG
CGGGAGGCGGTGGGCCAGCGCACGAGGTCCCGCCCAAGCCCGGCCCCTGGAGCGCTTTGT
AACCACGTCCTTCTGCCCGCCTCTTCCTCTTTCTCTCCTCGCCATCGTCGTGTGCGCGGT
AGCTGCTCCTCCTCGCCATGGTGAGTCCATCCGTTACCATCAGCTCCGGGCTGGCTTCCC
GCGACCCGAGGTCTCCGCGAGCTCGCCAGCGCGGCGGGCTGCATCGAAGTTCCGGGGCAT
TTTTCAGGCTTTTCCCGGAGAAGGTCGAGTTTGGCCGCCGCTCTCGCCCGCGGGCCTGGT
GGGCTGTGGCGAGTAGACGAGGCCCTGGGAAGGGTGAGCTGCGCCCTCGGCTCCAGGCGC
CGCCCGGGAGGGAAGAGACTCCCGCTTCCCTTCGCCCTTCTGCCGGAGCGAGCTGTGCTG
CTGGGGCCGGGGGGCACCCCACAAATCGGGGCCTGGCGGCGGCTGCCCGCAACACGCAGG
ACGTGCCGGGCATCGAGAAGGGAAGGTGGGCTGCTGGTTTTCGGAGGTCTTTTCATTGGG
CGGCCAGGAACATAGCACGCTGTGAGCTTTCGGGACTTTTTAGCCCTTTTTTCAGGGTCT
TGAGCGGCACCCCGTGGAAGCTCCTGGAAGAAGGGGCGTTGTGGCATGAATCTATGCCGA
ATGGGCGTTCTTCGTAAAATGTCAGCTGCGTAAAAAGCCCATGTCGTGAGTTTTTCCGGC
GATGGTTTCCTGAGAAAATCGTTTATGGAGAGAATCAGTGTCTAGCGTTTGGTAGTTTTA
TCAGTCAACGGAAAATTTACGACTGCCGCTGGGAGCTGGCAGGGAGGAACGTTGGCTCTG
CCTTCTTTATAACAGCCCTTGTTACGCAAGGGTGTGTTGGGCCACATTGGCCCGACTTGA
GAGCAGCACTCATATGCCATTTCTGCGGATTGTCCTGCAAACTGGGGAGGAGGGTGATCG
GGTTTGGGTCTAGATGACCCAAGTTCATGAAAGCCAAAAATGGAAAAGTCAGCCTTGAAA
AAGTGACATTTTAAATAGAAGTAGTACCAATGGTCGGTGGGTTAGAAGGGACCTAGCGAA
TGACAGGGACTTTTGTGCAAATCCTAATTACTCTCACAATGACCCTTGAAAGTGGATACC
CCTGTTTTTCAAAGTAACGCACTGCAGTTCGTTGACTTGCAAAAGAGAGATTTTTTTTTG
GTTGACCGAAAGCTGTGTTCTTTTGTGAAAACCCAAGTTTCCCAGCCCTAGCCATCTTTC
ATGTGGTCCTGAGTCCTAGGGGGAGCAGGGAAGATTGGCCAAAGGCACCCCAGCCTTGGA
GCAGAGAGGACCTGGGTTTGCATCCCAGCTCTGCACGTTCAGACTCTGAGTTGGGGCAGA
TTACCTACCTCCCTGATTCTGCTGATTTTTATTTGAACAATGGGAATTACGGTATGTGCC
TCCAGCGAAGTTGTGAGGAACAAAGCAAAGGGTGGGATGGGTTTAGCATAGAGGGGGGTT
GTTCTTGGTATATGTTAAGGATTCAAATGTTGGATTGAGGGAGTTCCTGACTTTAGATTA
TGAGCTAGCTCTGGTATTGCTGTCTAAGCTGATTGCATTTCCTTCCCAGTCTTCTCACAA
GACTTTTAGGATCAAGCGATTCCTAGCCAAGAAACAAAAGCAGAATCGTCCCATTCCCCA
ATGGATTCGAATGAAAACTGGTAATAAAATCAGGTAAGGACCCCACCACCCCTCGCTTGT
TTTTTGTTAAATTTAAGATTACTCTTTGAGCATAAGTATGCAATTGAAAGTTATACGCGC
TCCACTTCATCCTGTAACGTCATTCTGAACTCTTTCTTTTAACGTGCTTCCTTTGGATTT
CTGGACAGTACCCAGCCCACAGCTGGGCTTAGGGTCAGACACTCCTCCAGTATTAATTTA
TTAATATTAATTTCCTGGTTGTTTTACGTCTGAGCAGAACATAAGGTGGAAGGCGATCTC
ATTACACAGCCCAGCGGGGACGACCATGTTGCTCACCCATTGAATTTTTGAGTGTTTCTT
TTCTAAAGGTTGGAAGATTACCCTCTACTGTAGTAGTAGTTGAATTGATGATTTTGGAAG
AAAAACATTGCTAGAATTGGTTTGTTTAAAATGGAGTATGAGCTTTCCTGGTTCTCCCAA
ATAATTGAGCCCAGAAGACCACAGAAGACACGGCAGCAAATATTACCAAAATTCTTATTT
TCAAAGCATTTTTCAGCTGACACTGTAGAGTTGGCCTAGCAAGTAGGGTCCCTCTTGCAA
GATGAAGGCTTTGAAACGCAGGAGCACAAAATGATGAAGCTAGTGTACAAGTCTGGTTTA
TATAAAGCTCGGTGCCTAGCTCAATAGAGGGTGCCTGTGGTTATCAGGATTAGTCTCTTG
CTCTGTCCTCTCCTAGAGCTGGGAAGGCACTTTGTATTTAGGATTACACACTCTTGGCCC
AGAGAATTGGCAAATTAAATAATTTTTCTCTTGCTTGAGTTGTCTTCTAACTTTGAAAAT
GTTTTTTAAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGACATTATCCTG
CTGAAAGAAAATCTTGTGTGGATCATTTTTGATTTTGCCTTTGTGAGGGTAAAATCATGA
CAGATTGACATGGACAATTCTGAGATGGCCTTAGCTCTGCAAATCACTTGGTTTGGTGTT
AAAATGGGGATGTTAATCTATTGTACAAATTACACAGGAGCTTTTATGTGTGTAACCTAT
TATATAGAAATGACTGTTTTTGGTGTAGTTTACGGGGGGGTGGGGGGGGGAGGTGCAAAA
TGTATGTCTCTGGCTACCCCAGGTCTGTGGAATCAAGAATGGGTGCTTGTCCACTTGCGG
AGAAAAGAGCTTCTCTACTACTACCGTCCCAATTAGGAACCGCTGTGTTTTCCTAGCCTG
GAATCGTTTTGAGAGGTAAAAAATTGATTTGACTAGTTCTTAAACACATCTAGCAAATCA
TTTTTTACTCTCCAAAAAGAGCTCCAAACTTGAAGGAAGGAAAAACACGGGACCCTTTGC
CTTTCGAGGATTTTATGGTACTTAAAAGGCAACGTTGAGGTCACATTGCCTTTGTAACTT
GCAGTTTCCTTCTGTGTAGGTACAACTCCAAGCGGAGACATTGGAGAAGAACCAAGCTGG
GTCTATAAGGAATCACAGATGAGATGACACACATATTTATGCTGTATCAAAGTCCTTCTT
ACATCTTACCATACCACTCTGAAAACGTGACTGTCTGGACAGTTGGATGTGTTTTATTCA
GGAATTGATTTTTCTCTTTGTTGCTATGCTTCTGAACTAGTAGGTTGGTTCAGTAATAAA
TATGTGAGACGTTTTGTTTGAACTGCTCTTGTGTTCTGGTTTGTGAAGTGTGGAATTCCC
CCTCCTGCCAGATCTCACGACACTGTCCAGTAGAACTTTCTGCAATAATAGAAATCTTCT
CTGGCTACCAATTATTTGAAATATTGCTAGTGCGTGTACAGAACTGATTTTTAAAATTTT
ACTTAATTGTAATTGTAATAGCTCCATGTGGCTGGTGGCTCTTAAATCTTATGTTATGGG
AAGTACATGTACTGCATTTATGTGTCATCCTTGTACCCCAGGGTAGCACGTTCTTAAATA
GCATCTTTGGGGGCTGGCCCAGTGGCACAGCAGTTAAGTTCACGGGCTCCACTTCAGCAG
CCCAGGGTTCGCTGGTGTGGATCCTAGGCTCAGACCTAGCATCGCTTGTCAAGCCATGTT
GAGGCGGTGTCCCCACATAGGAGAACTGGATGACCTACAACTAGGATATACGACTATGCA
CTGGTGCTTTGGGGAGAAGGAAAAAAAGAGAGGAGATTGGCAACAGATGTTAGCTCAGGG
CCAATCTTCAAAAAATTAACAAATTAAAAAAATAAATAGCATCTTTATATTCTCTTCTAT
GGTGCCAGTCCTCAATAAGAGTAGAAATCTGAACCAGGGGTTTGGCAAACTGGTCTGCTG
CCCGTGAGCTAAATTTCTCCATTTTTAAATGGTTGAAAGAAATCAGAAGAATATTTTATA
CTTAATAAATTTGAATTTACTGGGCATGTATGTGCTGGGCACTGTTCTAGATACTTGGGA
TTAATCGGTTGATAGACAAATGTATGTTATGTTAGCCTAATGAAAGGCCAATACGCAAGC
CATAGCAAATGTCTGAAAAAGGTGGGAAGAAACAAAAGTGCCCTAATTACTTGTGAATGG
GGATGAAACTGCAGCAGCAAGGGAAAGGGGAATCAAGTTTGGGGGTAGCTCCCTCCCCAG
CCTGTAGGGAGCCTGCACTGGACAAAGCTGAGAAGGCAAGGGGCAGGAGATGGTGGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 2509..2612, 4039..4279
1037..1039, 2509..2612, 4039..4084
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved