Equus_caballus Locus RPL3
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL3
Equus_caballus
RPL3
28
snoR38, snoU83B
3962..4055, 5467..5560
7691
ACGTGTGGATATGGCGGCTTCCGCCTTGTCTCCAGTGGCGGCACGGCTGAATCGGTGGT
GCATCGCCGCCATCTCGGCTCGCCGGGCGCTGGGGGCCTGCTCTAGGAGCACGGGGGCCT
CTGCGGCATCCGCAGTCAGGCCTATTTTCTGGAAACGGTGGAGGCGTGTGGTTGGCCTTG
AGCTTGCCGGTCGGCCCAGCGAGAGGCCTTGGGGCGGGAGCTGAGCGGGCGGGCCGGGTC
CCGATAGTTTTTACGCCTTGGGTTGTTTCTGAGTCCCGCCCTCACCAGTTTGGAGCTAGT
GGGGATCGGAGTCCGTGAGCACCTGGGCCGGGAGGACCTGGCGCGGGGGCCCTGGCGGTG
CTGTTGCCGAACCGGGAGGTGCGGATGTCAGAGCAGCAGGCGGGTGGGGGCCTCGGGCCG
GTTGGTCGGGCCTCGTTAAGAAAAGACAGAGACGGTTGGTGCAGCTCCTCGGGCCTGTAG
AGTTCCGCAGCCGCAGGTGATGAGCTTATTGACGGGCGGACAGAGACTCTGTGCTGATTG
TCACGTTCTGATGTGGCTGTCGCGCTCCGGGGGCCTGCGCGCCTCATCTGAGCTCCGCTC
GGAGCGGGAGGCGCCTATAGTACCTTCATCGTTACCCAGCCGTGGTCCAGAGGCGCTTTT
GTGGTCATTGTCCCTATCTTGCTTTCCTAAAGGCACCTGCTGAGCAAATTTTGGTGCCAG
CACCTGGTGTGCCCTCGTGTTTAGAGGAAAAAACCGATGGCTCGTTTTCCTAAATTATGA
AGTGCAGATTTGAGCTCAAGGTTCAGGTGAAACTCAGTTGGGTGCTGCTTTCTGGGCGTG
TGATCCTGCAAAAAGTGCACCGAATCCAGGCTGAAAGCCTGTGACCTGGGTTGCTGGGTC
TCGGTTCAGCATCACCGGAGTCCGTTTAGTACCCAGGCAGCTGGGATTCAAGTGAGAGCT
GCTGAAACGTTTGGGTGCTGACGGTGACCCTTTTCTCCTAGTCTCACAGGAAGTTCTCCG
CCCCCAGGCACGGGTCCCTGGGCTTCTTGCCTCGGAAACGCAGCAGCCGGCACCGCGGCA
AGGTGAAGAGTTTCCCCAAGGATGACGCTTCGAAGCCGGTGCACCTCACGGCCTTCCTTG
GCTACAAGGCCGGCATGACCCACATCGTGCGTGAGGTCGATAGGCCCGGATCCAGTACGT
AGGAGCTGCATTCTCCAACCTGGAGGCGCGGGGTCGGAGTGGAGGGTGGGACTGGCTAGG
TGGGGCAAAGCTGTCAGAAGAGGACAGACTCCTAAGAGATGAACAGAAGCTTTGACGGGG
GTGGAAATAATAATATATTTTAGGACTAACTAATATTCCTGAGGTTCAGATGCCTGGCAC
TGCTTGCCTTAGGCAGAGGCCTGTGATGAAGTCAGAGCACGATGTAAGTTTGTCGAGAGC
CACAGCAGAGAAGTATGCTGACTTGGGCTCACCCTCTGAGACTCAGATAGAAACTATTGA
CATGTTGCTGGCAGCACTGAGCTGCCAGCCTCACCTAAAAACTCGAGGTATTGAAGCACA
GTCGATCACGGGAGGTACTGTTATCACCGCACTGTACTTCGTTAGTACTCAGATCGTCTG
GGTAATAAGAAATTTGTTTGCATGTGGAGATTTCTCTGATAGAACTGAAGCCAGACTTAC
TTGGCTGATGAGGGTCCAGATATTTTTGATTGCGTTAGAGCTGTAAGTGCGTGCACACTG
AGAACGATGCAGTAAGGACGGTCCTTGGGGCCAGCTTGCTGATAAATGGGCTTCTGCAGA
CTTACCTGTTACCTGAAGCGCGTTGCCTTGCTGGCCTCAAAGGGCACTTCACCTTTTTGT
ACAAAACGTCGTAACCCCTTATTGGGGTCTCTAGTCAGCCCGCTGAGGTCTGAGTCCCTG
CTTGCTTTGCAGAGGTGAACAAGAAGGAAGTTGTGGAGGCTGTGACCATTGTGGAGACGC
CGCCCATGGTGGTTGTGGGCATTGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGTACCT
TCAAGACCATCTTTGCTGAGCACATCAGTGATGAGTGCAAAAGGCGCTTCTACAAGAACT
GGTAAGGGTGTGGGAGGCGTGCATGCCCTGCAGGGTTAGGGGCTGGAGAGAAGGACGGGC
TGTGCAGGGCTTCCTCACTGTAGCAGGGAGGGGCTGTGCTACTGGCAGACTTAGGTGCCT
CTTGAGCAGCCACTGGTGTATGGAGTTGGGAGCAGCACCTTGAGGCCTTCCCTCGGTGTG
CAGTGTAGTGGGTGTTGTCTGAGGACTCAGTGCTCCATTCTCTTGGCTGCTGGGAAGTGT
CGAGTCCTCAGAAGCTGAGAGCAGTGTAATTCCCAGTCCTCCCCAGGTGTGTGGTCTGGT
TAATGGTTAAACTGGAGCAAGAATTAGTGTGTATCTGAATGTTGGTGACTTGCATTAATC
TTGTGGACCTCTGCTAGCTCCGCTCGGCTCTGCCCGATGAGCTTCATCTAGGCTCCGCTT
GCCGGTGGAAAAGGCTCCTTAGAAGCCGGCAATGAGCCCCATCCCCATTTGGTGCCAGCG
TGCCTTCCGCTCGCCCCTTGGAGGGGTGATGAAGGCCTGCACCCGGCCCCTCCCCAACTC
TGCTCTGCTCCTGAAGGCATAAGTCTAAGAAGAAGGCCTTCACCAAATACTGCAAGAAGT
GGCAGGATGAGGACGGCAGGAAGCAGCTGGAGAAGGATTTCAGCAGCATGAAGAAGTACT
GCCAGGTCATCCGTGTCATCGCCCACACCCAGGTGAGCGCCCGCCCGTGCCTTCCCGTCA
ACACAGGTGACTGCCTACATGGTCACGTGTGGCTTTGGCTATCAAGTGCTACCTTTTGGG
GGTGTCTCGCTTATCTTCTGAGTTGATTCTGAGTTCAAACTGATTTTGTGTCAAGCCTCA
GGATTGTAGGGAATGGGAAGACGGGGTCAGGTTCCTGGAACTTATTTCCTAGTTGGAGGA
GGTGGGCCAGCGAACAGCCCGGGGGTGGTTAGAAGTTACACAGCCACACGGTCCAGCCAC
TGCCCTGCCCTTTAGGCCTGCCTTCCTGGGCCAGGTTAGGGACAGTGGGGACAGTGGCTT
GAGAATCCATCCAGTGCCTCCACGTTGGCGGGTTGGTTTTTCTGTTGCCAGCAGAGGGCA
CTGTGTCCCGTTGGCTCTTAATTAGGAAAACTGTGCCCTGTTTTAGAAAAACTGGTGGCT
CGTGATTAACGTCAAGTGCCTGACAACAGTCAGTAGGAAGCACTGGGCCACGCGTAGCGA
GACACTTTGTTAGATTAATTTTCTTTTCTAACCTTTGCCGCTTTGCTCGGCTGTGGTGCT
GCCCTGCTCCCAAATGTAAGTGGCTTGTAGATAGTTAAAGAGCAAGGTCGATGGCCGACG
GGGGGGCGGCTAGGGCAGTGCCCAGGGGAAGTGGCCGAGAGGACAGTGATGAGCACTGGG
CAAGTTGGGCAGGATTTAGTTAAGCTGGCTTGTCTTGATGTGGGCCCTGTGGGTCTGTTA
AGGATCAGCTCATCCCAATGGTGATTCAGACATCAGAATTGGAAGGTGAATTGTACCTAG
AGGAAGGACGTTGATTTTGCCGGTAGGGAAATGCATTTCCCTGACAGGCCCCAGTGTGCG
TCCTCCACCGTGGGAGGAGAGCTGGAGCTAAGCTGCCCCCATCCCCCCCAGATGCGCCTG
CTCCCTCTGCGCCAGAAGAAGGCGCATCTCATGGAGATCCAGGTGAACGGAGGCACGGTG
GCCGAGAAACTGGACTGGGCCCGCGAGAGGCTGGAGCAGCAGGTCCCTGTGAACCAGGTG
TTTGGGCAGGACGAGATGATTGATGTCATTGGCGTGACCAAGGGCAAAGGATACAAAGGT
GAGCTTTGCGGTGGCCCGGGTCGCTGTGGCTAACCTCTGGGAGAGAAGAAGGTCTCAGGC
TGGCTGTTCGATGAGGAGGCTCTGGAATGAGCGCTGGGCACAGCGCCCGAGTCAGACTGC
GGAAGCATTCCTAGCTGCCTTCCTTCTGAGAGCAGTTCTGGGGTCCAGTGCCTGGCGTAA
GGTGGGGACTGGGGATGCCACACATTGGAACCCTTACTGCTTGCACGCAGCCCATTGTAA
AATAAATGTCAAGGGGAACCTGGAGATTTGGCCGGCCCCTGCCGGTGCGAGCTGCGTGAA
GGCCTTAAAGTGCACACGTTCCTCTTTGGTTCAGGGCTAAGTCTGTGGCCCATTCTTGTT
CCCAGGGTTCTAACTCGAGGTTTGTGTCTGGGCAGGTATTCAACTTGAGTGGAAGTATAA
GAGGGGTGGGGAAGGACATGGGGGTTTGAGAGTGACGTGCAGATTCAACCCACCTTTCCC
TCAAACGTAGCTGGTCGTTGGGTGTTGGCTGTTCTGTGTATAAGCAGCAGAAATGAACAC
ACTTGAGTCGGGCCTTCACAGCAGGAAGCAGCCTGTGGCGTGAGTGCCAGACACCCAGTA
ACAGCGTGTTGTTCCAGGGGTCACCAGCCGCTGGCACACCAAGAAGCTGCCCCGCAAGAC
CCACCGAGGGCTGCGCAAGGTTGCCTGCATTGGGGCCTGGCATCCCGCCCGAGTGGCCTT
CTCCGTGGCGCGGGCCGGGCAGAAGGGCTACCATCACCGCACGGAGATCAACAAGAAGGT
GAGCTGCCCAGGGCTGTGTCTGGGGGCTTCAGCCTGGGAGGAGACAGACAGTCCCTGTCC
CCGCCGCTCCAGCTGGTGGCGGAGCTTTTGGGCGTCACACGGACTTAGTTGCTCATGTCT
GATGGGCACAGTTCTGGTCTGTGGGTTATGATTTGTAAGGTGCCATCCTCGAGGGTGGTT
CTGGTGCAGTGGACTCTTGGCGTGTGACTGGGGGTGACATGAGGTTTCGTCTCACGTGGG
TAGCAGTATCTTTAGTTTAGGCCCAGCCAGCTTTCCTTTGCTCTGAGACTGAATCGCCCT
ATCACTATGAGGTCCCAGTCGTAGCTGTCTTCCCAGAGTCTTGCAGGCTAGCCCACTGCC
AAGAGGGGGCGTTAACTTTTCCTAATGATGTCCCTCCAGCTCACTCTGTCTGGGGACACC
TGAGGCTCCTGGCCTGCGCCCTGTCCTGCTTCCTCCTTCCTGAGTATTTACAGTCCTTTC
TTTGGTTCAGATCTACAAGATTGGCCAGGGCTACCTCATCAAGGACGGCAAGCTGATCAA
GAACAATGCCTCCACTGATTACGACCTGTCTGACAAGAGCATCAACCCTCTGGTGAGTAA
TGGCAGCTGTCTTCTCAGCTTCTGATGCCTGGGTCTGGCTGGGGGTTCCCCCTCATTCTT
TGTGACTCTGCCCTAGGCCCCACTGATGGGGCAGGGAGCCTGGTGCTTTTGGGGCCTGGC
TGATTCACAGGGCTTGTAAGCGGCGGGTCTTCAGTCCACTCGCTGGTAAAAGGGGGCTCT
CGGGCCAGCTGTTCAGTGATGAGACTCTGGAATGAGCGCTGGGCACAGCGCCCGAGTCAG
ACTGCGGAAGCATTCCTAGCTGCCTTCCTTCTGAGAACAGCCTGTGTGTTGGGGCTGGGG
ACCACCTGAACCAAAAGGTCAAATGTGTCTGACTTGTTGCCAGCTCTATCCTGATCTGTG
CTGACCTGATGGCCTTGCCTTTTCCCAGGGTGGCTTTGTCCACTACGGTGAAGTGACCAA
CGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAACCAAGAAGCGAGTGCTGACCCTTCG
CAAGGTGAGGCTGGGGCCCTTCCTGCTGGTGGAGGGTGGCCGCGCCCCAGGACCCTGCAG
ACAGGAGCTGCTCCCTCCTGTGGAGGACAGGAGAGAAGTTCAGCAGCTGGGGGGCAGGGA
GCCGCACGCAGGGCTGAGCTTTGTCAGGGAGAAAGGGGGAGTTCAAAGGAAAAGGAGGGC
TTGCCACTCCCTTAGCACCGGCTTTGAAGTCCTGTGAGGAGGAAGTTCCCAGGCTGGCTG
GGCCCAGCTGTTTGCTTCAGCTTTTGCGTGTATCCTCATCCGCCTGGCCGCAGAGGGGAG
CTCCTTGGGCAGACCCCGTGAGACAGCGGAGGTGTGGGGGAGGGGGCGGCACTGCTGGCT
CCAGGGCTGCCAGTGCAGGTCTCACAGGAGAGGCCTGTGAACGAGGAAGATGTGGAGAAA
GGCCTGGCCTTTAATCACCTTCTCCTGGCCCACAGTCCCTGCTGGTGCAGACGAAGCGGC
GGGCCCTGGAGAAGGTTGACCTCAAGTTCATCGACACCACCTCCAAGTTTGGCCATGGCC
GCTTCCAGACTGTGGAGGAGAAGAAAGCATTCATGGTGAGCGCCTCTGCCTTGCTGCTTG
TGGGGTGGGGTGGCTCCCAGCTGCTGTCACATGTCAGCCTGCCAACTGCCCCTCTGCTGC
TGGTTCAGGAGGAGGCAGCAGGGCTGGCTCTTGGGGTCCCCAGAAGGGCCGCCTTGTGCC
TGGGCTCGGGCTGGGGCTCCTGGCCCAGGCCCTCTGATCCACTAAGGCGAGGTTGTTCTT
ACGTCCTGCTGCCGTCCTCTGCGTCTAGCCTTACTTGCTGCACCTCTCTCCACAGGGACC
ACTTAAGAAAGACCGAATTGCAAAGGAGGAAGGAGCTTGATGCCAGCAGCAGATCGTGCA
GCTGGTGGGGTCCCAATAAAGAGTATTTTCCAGTGACGTCTGCCTCACTTTATCTTTCAG
TCCCTGCTGCTTCCACAGGGACCTTGTGCTCCCCGGGGCATGCTGCCCTCAGCCTTTGGG
TACCCTGGGCTGCTTTTTGCCTGGCCACTCGCCTCGCCCCTCTCCCTGGAACAGACTAGG
TATAGGGGGAGGTAAGCGCCGAGCCTGGGGTGGCGAGTTTGGGCAAAGTGTTTGTCACCT
GGGCGAGGCGGCTGGGGCTCTGCTGAAGTTGTGTTTGCAAGCTTGGGTGGTAGCGCTGTG
GAGATGGAAGGAGACACGAGGCCTTGCTGTTCCCTGGTGCCTTTGGCATTCCCGGTGGGC
ATGGCAGGGCACACCCTGGGTCTCAAGTGTACAAATGCTCATGCACATAGGAGCAGGTTC
CAGTTCGGGCTTGTCGAGGTTCTTTCGTAACCTGCAGCCAAGTTCAGGTGGGGAGAGGGG
GCTGTCATGCAGAAGGCCTGAGCAACACCTGGTGCTAGGACAACACGCTGAAGTGTTTAC
TTTGAGGAGGGCCCTGGTTGGTTTAGTTTACCCACCCAGTGTCATGCAGCCGAGAACCCG
GCCTGCAGAGAGAAAGTTACTTGTCCCAGCTCACCCAGCTGGTGAAGTCACTGGGGCCTG
GGTCTGCCCCCATGACCCTGCAGGAGGTGCCCACCCCATGCTGTGTTGACCAGCGTATGG
AGCACCTGTGTGGCTTCCAGGATGCTGGTGAGTGGCTCGGCTGCCTTCTGACCTGCCCTT
CAGCCCAATGACTTGGCTCCCTTGTGGTCCCTGGCCATCCAGGTGTGCAAGATGCCCTCG
CTGGGACCTTGCCGACCCCCCGTTTATCTCATTCTTGGCCAGGGCTGCTCCCCACGTAAG
GTCTGGCTGTATGGCATGTTTCCTCAGCTCCACTGAGCTGAGGGCAGAGACCACAGCTGG
AGCCCCTTGGACTGCACCCTGCCCGGCGGTCTGGCAGCTGGCAGGGCCTCCACCAGTGGC
ATGGACTCAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 1932..2100, 2656..2791, 3711..3897, 4517..4677, 5170..5271, 5668..5763, 6215..6334, 6595..6691
1001..1193, 1932..2100, 2656..2791, 3711..3897, 4517..4677, 5170..5271, 5668..5763, 6215..6334, 6595..6636
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved