Equus_caballus Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Equus_caballus SLC25A3
Equus_caballus
SLC25A3
28
SNORA53
5860..6109
8447
CATGTCCCTACCCAGATCTGGGCCTGGGAACCCGGGGCCTCTGAAGCAGAACCTGCGAA
CTTAACGCTGCGCAACCCGGCCAGCTCCTATTGAACGTTTTAATGTTGTATAAACTATTG
TAAGGAAGTAGCAACCTGTCTTGTCTATCTGACGAGTTCTTGCTGCACATATCCTTTTAA
AATACTCTCCTGCAGTCTGATGGAAAATACAGACATATCTATGTGTAATGTCAATGGATA
GAAGTTTTTTAAAAAGTACCGTAGGGACAGAGGTCGTGACACAAAATACTGCAGTGACAT
TCTAATGACAACACTGAAATAATATATCATCAAGCATTGGGGTATTTGTTTTAAATGACT
ACTATACTGCGACTCATTTAGACGGAAAGCACTAAAGCGACGGCTTCAAGGAGAGGCTCT
TGAAGGTGAAGGGACAAAAAGAGGAGGTCACAAGGACAAGCCGACATCACTCAAACACCT
GGCCCTGAACGCGCGCCTGCGCAGAAGAATCTCTCCTGCGCAGAAGCCGGGCCGGAAGGG
CTGGGGCGAGCGGGGGCGGGGATAGGGTTGCTAGGAGAACGCGATGACGCTACGGCCTCC
GCGCTCTTCCCCGCCAATGGGTGCCGCCGCCCTGTAGCAACGTGCTGTGTGCGTCACGCT
GACGAGGCGCGAAGGGCACAAGACCTAGGGCCCGGGAGGACGTTCGGCCTCTGTGAGCCG
CAGCCCTTCGTGGGAGCGGGTGTGTTCGCCATCTTAGGGAGTGAGTGTGGCTGGCCTTCC
CCGCAGTGGGTGCCGGGAGCGGAGCGCGGAGCCCCTGTGGGGCGCTGCTTTGGCCATAGG
GCCTGGTCGGCCTCCTCCTGGGGGAGGCCGTCGTGACCTCCTCAAGGGCGCGGAGGCGGG
AAGAAGGCAGGCCCGGTCGGGGTCCCCGGTGCTGGTGACTTTGGCCGACCTGACGGTCCC
TTGGCCTGTCCTCTGACCGCCGCTCGCTCTTCCCCAGGAGGATGTTCTCGTCCGTGGCGC
ATCTGGCGCGGGCGAACCCGTTCAATGCGCCCCACCTGCAGCTGGTGCACGATGGCCTCG
CGGGCCCCCGCAGCAGCCCGCCGGGCCCCCCGGCCCGCCCCGCCGCTCCCGCAACCTGGC
AGCCGCCGCTGTGGAAGGTGAGGTCAGCCCCTGGCCCGCTCGGTCGTGGTGTCCCCTCGT
GGTCGGCTCGGCCTTCGCGGCCTGGGCCGGGCCTGGAGGACGGGGAAGGACGCGCCCGGT
TGCTTGCCCGAAGATGTCAGCCCTTTCCGCCCTAGGCCGGTGTCCGATCCGCGGCCCTCC
CTCAAGGGCGTGGACCCGCTTAGGGACAGCTCCCTCCGTGACCTCCACGACCTCGAGGGA
GTAGAGGCATAGAGGCCTGACTGGCTCCTTATCTTCTCCGCCCTGGGCGTCTTGGTCAGC
AGACTGGGTGTTGGGTAACGTGTCCTTAACCACTGGCTGCAGTTCTAACTGTATTCTCTG
TTCTTTGATTTGACTTTAATTTTCTTATTAAAATACTTCTTCCTCCCTTAAGTATTCCCG
AATATTAGTTGACATAAGGTATGTGAGATTAACTGGGTCTCTTGTTTTAATGCGATTGGT
GGAGGGGGCGACTTGCAGCCCTAGAAAGGAGATGATAATTGAGAGGGATCCCTTTGGTCT
TACCTCTCGGGCTTCTTGGTGGTTAGACCCAACTTTAACAACTGTATGCATTTTAAATCC
CAGTGGAGTGTGTGTATAGAGAAAGTAGAGACCGACTTACAGGAATCCTGAAAATGTTAT
CTATATTGTGCCTGTAAAATACAGTGTTTTTAAAAATCACTTATGTGTTTCTGTTTATGT
CTTTAGTGTGGGTAAAAAAATCTTTACACTTGAGCTATCATTCCATCCTTCGATTTAGAA
AGTTAAAGCTAACGTCATTTTTGTAGTAAAGGTACTTGACTCCAGGAATTTATCTAGTTT
TATGCTGTGGAGATCCTTAAGTGGGGATAGTGTTGGTTAGTGGCTGGGGGAAACTTAGAA
GTTTGCAGGCTTTTACTTGTCAAGTGCTCTTTCCGAGTTTGATTTGAACTCTGAATGTTC
TAATCAGTGGTTAATAATTTGAAGTTTGATTTTAATTGGAAGAGCCATTAATGTTGTGGA
GAACTTTTTATTAATATAGCAAGATGAGCTAGCTAGTATCTCACAGATAGAACCTTCATA
ATCTTTAAATGATTCTTTTGATCATGGCACTGAATTTCTTGTTGTTCGCACTAGGTGGAA
AATCATTTTCAACTTAATTCTAAGCGGTGGCCCAGGCTGTTCAGTTGTGATAACTGTTTC
ATAGGGAAACAGTTCCCTTTCATTCCCAGGGCTTTAGTCATCTCTGAAGAAATACTTACT
TGATTTTTTTTTTTTCTTCAATCAAACAGAGCAGTATAGCTGTGAATATGCATCTGGCAG
ATTCTTTATCCTTTGTGGACTTGGAGGAATTATTAGCTGTGGCACAACACATACAGCATT
GGTTCCTCTAGATCTGGTTAAATGCAGAATGCAGGTTTGTTTTGCATGTTGGACTAAATA
AAGCATATTGTCGAAGCATGGCTGTTAAGTTGTAAGATGTAGTCCTCTACTAACAAGCCG
TGTGGAAACCTAACTATCCAGGAGGTAAGTTGATAACCAGTAACATGAGTTTTATATTAA
AACGCATGGTGTGTCTTGTCTTATTACAGAGTACAGTTGTGAATATGGCTCCATGAAGTT
TTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGT
TCCTCTGGATTTAGTGAAATGCCGGATGCAGGTTTGTATTGAGATGACAATGAACCTATC
TTTCATGTGTGACTTAATTCCAAATAATCTTAAAGGACTTCGCAAGTGAGAAGAATTGGC
AGACATCACAACTGGTAGAAACTTTAATAGGAAACCAAACCCAAATTTCTTTAACTTAGG
ATCTTTATTTTAATTAGTGTTTTAAATCCAAGAAATGCCTCTTTAAAATAGTGTGGGTGG
ATTGTCGCGTCTCAGACTGACTGTAAATGGTTTTTTGCTGCTGGCCTCAATTCTGGCTAG
AGTTTCTCTTTAAGGCCTACTAGTTCTTTATGCTCCAATAGTCATTTTACAAGCAGTTAA
ATGTCAACAGTGGGTAATCGTTCTTTGCGTATTATGTGCAGTAACTTCTTGTCTCTTACT
TAGATCAAGAGAGCACTATGTAGATTAAAAAAATACTCTCAGGGCCGGCTCAGTGGCCGA
GTGGTTAAGTTCGCGCTCCGCAGCAGCGGCCCAGGTTTCAGATCCTGGGCGCGGACATGG
CACCGTTCGTCAGGCCACGTTGGAGCGGCGTCCCACATCCCACAACTAGAAGGACCTGCA
ACTAAGATATACAACTGTGTACAGGGGGATTTGAGGAGATAAAGCAGGAAAAAAAAAAGA
TTGGCAACAGTTGTTAGCTCAGGTGCCAATCTTTACAAAAAAAAAAATACTCTCAGTATC
TTAGTATTAAACATTTGTGGGTATAGCTTCTTGTATATTTATTTACATAAAAGTTTTTTA
TAATTAGAATATTGTAATTAGTTTTATTGAAACGAAAGTAATCAAACGTCAAAAATTTAT
TTGTCCCAAACAGGATTAGAAGTCTACTTACGTAAAAGAGAAAGGAAGGTGAAATATTAG
CAGGGAGAGGAAGGTGATGTATACCAGCCCTTGTAGTATTGGCAGAAATAGTGAGATAAG
ATTTTTTCTTTTCCCAATTGTTCATAGAGTGGATGTGAAGTATGCTTTTGCTAAACTTAT
TATGCATGTCTCTTGAATTTAATTTCTTAAGTCAAAAGACAGATTCTCATTATATTGATG
TACCTTTTTAATGTGTATTTAGTTTGTCTTAAGTTCACGTGACTTTATAACATCTTAATG
GGTAGCATATATCAGGGATATACACTTACCTATTATTTAGGCAGTAGCTTTAAAACTAAT
TTTTTACAAGTGGTAGAAAGAGTTGGATGTTGAAAAATCTCTTTGAATCAGTTTTATCAT
GTATATTTGTAGGACTTTTACCTTCTTAACTAACCCTTCAAGACTTAAGTCTGACTGAAA
GCTAGACCTTAATGTACAAAGTTACATTTACAGATAGAATGATGGATAGTAAGCTGATGT
CATACAGTGACGTTGTATTCACCTACCTTTTGTGTAGTTGCTGAAGTTTATTTTAGAACC
AAAGGGAAAAACTAATAATAATGAAATTGTATATTTATGAGAAGTGTTAGCTCTTTGGTC
CATCTAATTAGTTTTTTTTCTTCTTGTTTTATATAAAGGTGGACCCCCAAAAGTACAAAG
GCATATTTAACGGATTCTCAGTTACGCTTAAAGAAGATGGTGTTCGTGGTTTGGCTAAAG
GATGGGCTCCGACTTTCATTGGCTACTCCTTGCAGGGGCTCTGCAAGTTTGGCTTTTATG
AGGTCTTCAAAGTCTTGTATAGCAACGTGCTCGGAGAGGTATGTCATTTAATTTTGAAAT
TGAAAATCCTAAGATTTCAACTTAAAGTTCAAGACCAAAAAAGATCTTAGATTTTTGTCT
GTACCACCTTGTTTTAGAACTGAGGAAATGGTCTCAGAAAAGGTGAGCAACATGCTTCGA
ATCATAAGGCTGTTGTAGCAGAGACAGGATGAGAAAAAGAAAATGTATTTTGTTAGATTT
CAGTGCTCTTTTTATTATCCTATGCTGCCTTTCCAAAAGTTGGATTTTGAATTTTTTAAA
GAGAAAGACTCTGAGATTCCTTTGTGTAGTTCAAAGGCCAACTATACTTGGCACCTAGAT
GTTCAGAAAATAGTCACATTGTACTGTGGCTGATGAGGTTATGAGAGATGACATTCAATC
TCCTATTGTGTGTGTTATCCATGGAGTGTGATAAAGCAGCGCTTAGAGGCCGGCCAGCCA
GGTGGTGAAGCAGTTAAGTGTGCACGTTCCGCTTCGGTTGCCAGGGGTTTGCTGGTTCGG
ATCCTGGGTGCGGACATGACGCCGCTTGGCAAGCCATGCTGTGGCAGGCGTCCCACGTAT
AAAGTAGAGGAGATGGGCACGGATATTAGCTCAGGGCTAATCTTCCTCCAACAAAAAAAA
GAAAAGAAACACTTAAAATGTGTGAAATTTAACTGTTTCCTACAACTGTCCCTTTAAGTT
AAATTGAAAACAGCTAATGCAACAGCAATTCATGTCCCTCCTTATATTTTTCAATTAGGA
GAACGCCTATGTCTGGCGCACATCACTATATTTGGCTGCCTCTGCCAGTGCTGAATTCTT
TGCTGACATTGCCCTGGCTCCTATGGAAGCTACTAAGGTTCGAATTCAAACTCAACCAGG
TTATGCCAACACTTTGAGAGATGCCGCTCCCAAAATGTATAAGGAAGAAGGCTTAAAAGC
GTAAGTAAACATGCCTGGATTTCTAGTATAAAGATACTCATTGGAGGGAGCTGCGGTTCT
TAGCATTAAGCTCACCAGACCTTTTTTTTTTAAAATTATGTTATGAAACTATTATGTCTT
TTTAACTATTTAATTATTGTGTCTTTTTTTAAGTATTATAGTTATTTAACTATTGTATCT
GTTTCTCTCTTACATAGAACATAAATTCCAGGGGCAAGGATAAGTTGGTACATGGCTTGA
GCCCTGAATTAGGGATTTTTTGTAAAGTTATGAACCATTTGTCAGTCTACAAATGACTTG
ATATCTGACCTTAACATTTAATGTTAACTTTGGGGGGTGGGGACTTGTTAGAATTCTTGT
CATCTGTGTTTTCAGTTAAGACTTTGTATAGTCAGACCACAACATGCTTCCTTAGATCCA
CCTTTGTGGGTGTTAGTCTTGAACTGTGTTCTACTTGTAAACTTCTTGTTTCTTGTAGTT
CCGGTCAGAGAAACATCCAGCAACTTTTTTGGTTGTATAGTCAAAGGTGCTTGAGTCATT
GGCATGTGAGATAAATATACCTGCATGTTAGTCTTATGTTCTGATAGAAATGACATGCAG
TTGTGCTGTCATTTTTTTTACTATCAGGACTCGACTGGTGTGCGGACACTTCTGTTAATG
ATGAAAATCTCTGTTAGGTGAATATATGCAGCTGAGTAAAATAAGTCTCCTGGTTTCCTA
GATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCGTACACCATGATGAAGT
TCGCCTGCTTTGAACGTACTGTTGAAGCATTGTACAAGTTTGTGGTCCCCAAGCCCCGAA
GTGAATGTTCAAAGCCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGGTATGA
ATTATTTAGAATACACTTGTCTAGGAATTAAGGAAAAATAATTGTTTCCATTATTGGCCT
CTTTTGTGAGGAAGAAATATTCCAGAGAAGTTTTATCATCTCATAGCATTTTATATGCCC
TTCAGGATTCATAAATACTTGCTAATTAGTTCCTAAAATGTTTTATGGTTTGCATGTCAT
GATTAAGCTTGGGAACGTATTGATTTTACTACTGCACCATTTGGTTTTAGTTCAGTTTTT
CAAGAAAAAATTTTGGTTTTTTGGAGGAGGATTAGCCCAGAGTAACATCCGCTGCCAATC
CTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCATGCCCATCTTCCTCTGCTTT
ATATGTGGGATGCCTATCATAGCGTGGTGTGCCAAGTGGTGCCATGTCTACACCCGGGAT
CCGAACTGGCGAACCCTGGGCCGCTGAAGCAGAACGTGCGCACTTAACTGCTGTGCCACT
GGGCCGACCCCAAAGAACAAATTTTTAATACAAGAGAAAGTGTTGATTAAAATATGAATA
TAAAAACTTTTGAAGGGTTGTTCTGTTTTACATAGGGTGGACTACTTTGTAACCTTTTCA
GTCTCTAAATCTGATTTTGGTTTTATAACTAAAAGAAAATTTTATTACTTAGTCATGAAA
AGGTTATTGGCTATGATGTGAATTTTTTTTTTTAACTGCCCTCATTTGATCATTTGTCTT
GACTTTTTTCAGCTGGAGTCTTCTGTGCAATTGTCTCTCACCCTGCTGACTCTGTGGTGT
CTGTGTTGAATAAAGAGAAAGGGAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTA
AAGGTAAGATTTTTTTTTCCCCTCTAAAGAAAGAATAACCCTTTGGGGTATATTGCATTT
TTCATTCATGTTTCATACTTGGACCAGGTGTGTGGAAGGGCCTCTTTGCCCGTATCATCA
TGATCGGCACTCTGACTGCGCTGCAGTGGTTCATCTACGACTCTGTGAAGGTGTACTTCA
GGCTCCCCCGCCCTCCCCCGCCGGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGGTTAA
CTCAGTAGACAGATCACTGCAAATGTGGACTGAATCTGCTTGCTGATCAGTGTTGAGGAA
CGTGCAAAAGGAACTTTTATATATATTTGACAGTGTAGGAAATTGTCTATTCCTGGTATA
ATTACTGTAGTACTCTTGCCGAAAGCAAGAGTTTCAAACTTAATGTTGAAATAAACCCAG
CTGTTCATGATTTGTCTTTGACTTGATAATTATTTTTAAAACAAGTTTTTAAAGATTTAA
CTCTAAAATGGAAAGAATTAAGTGCAAATTAAAACATCAAGGAAAAATGCAAACTAACCA
CTGTTGGTTGAATACTCTGATCCCTATTCATAATGTCCTATGTCTTAAGTTTTGTCACTC
AAGGAGAGTTCCTATATTTTTAGGAAACATACCCTAAATTTTCAAAAGCTTAATTAAATT
GTAGTTATTTAAATACAGATAAATATTTGTTTGTGCTTATATTTTGACAAATTTAAGCCT
ATAATCAAATTTTTGCAACATGTACTATACTTTTCAAAATTTTAATGAGTTTGCTAATCT
TTATTTGTAAAAGAAGGTAATCTAAATTAGGTTGATTCTTAGAATGATAGTTTTTAAAAG
GACCAAAGCAATTGAAAGCTAAAAACCATTTCAGGTAACACTCGTCACACAAATCCGACT
TTAAATTACGATAAACCTACCATAAACTATTTTCAGTTTTATTTTTAAGAAAGGTACCTG
CTTGACAACTGAAGTAGGTAAATGCTGCCGGGAAGGCAGCTCTCTGGCATACTTGAGCAT
CTGAAATTTGGTTGTAGGTTTAAGCACAAACTGATTTAAAAGCTCCTAGAAAGTAAGCCA
CTCTGTTTAGTTTTGACTTGTGTTTGGTTAGAAAATATAACAGCCCAATCTATAATATAG
TTAATGTTTTCAAGCCTAATTATGTTTTACCTTGAGGCCTTTAGGTATAGTATCTGGGTA
GGGTTGACAATCCCTGCATAAAGCATACAGATGGAGCCTCAGGGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1102..1156, 2729..2850, 4358..4537, 5278..5459, 6181..6353, 7092..7202, 7287..7447
1001..1093, 1102..1156, 2729..2850, 4358..4537, 5278..5459, 6181..6353, 7092..7202, 7287..7444
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved