Equus_caballus Locus Q8MKB9_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q8MKB9_HORSE
Equus_caballus
Q8MKB9_HORSE
25
SNORD24, SNORD36, SNORD36, SNORD36
1205..1279, 1948..2024, 2335..2407, 2686..2752
4206
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGAGAAGAGGCCCAGAA
ACTTCGGGCTTCGTTGGAGCGGCGCGCGGGCGGCCCGGGGTGGCTTCAGGGGTTTGCAAG
CGGGGCTCCCGGGCGGGGGTCCGAGGTCTTGGTCGGGGCCCCCCAACTCTTCCGGGGCCG
GGCGCCTCGAGCTGCTTGCTGAGTGTGGAGAGAGGCTTCCGGCCCTGCGGCTCGCGGTGT
TTGCGTGCAGATGATGTGAAGGAATATTTGCTATCTGAGAGACGGTGACGACCCTTCAGA
CCACCAAGATCGCTGATGCACCTGCACCCTCGTAGGGGCGGCCCTGGCCGCGAGCGTGGG
GAGCGCGAGCCTCTCACGGCGTTGCCCTGTGCTTCCCAGGACAGGACATCCAGCCCAAAC
GGGACCTCACCCGCTTCGTCAAATGGCCCCGCTACATCCGGCTGCAGCGACAGAGGGCGA
TCCTCTATAAGCGGCTCAAGGTGCCTCCCGCGATCAACCAGTTCACCCAGGCCCTGGACC
GCCAGACAGGTGAGGTGCTGCGCGGCACGGACCCTGCTGGATGCGAGGCCTTGCGAGGGC
GGTGGGCATTTTCAAGCAGATGGGTTCATTAAGACGAGTCCCCCAGCTTTCGGAAGGTGA
AGGTAGCCTAAGCGAAGCGATTACGTTCGTGGCTCGAGGATTTCTCAACTGCAAATAGCA
CAGTCAGGACACAGATCTAGCGTTAATTACGTTGAGTGATAAAGATCAGAGCTTGAACTG
CATGTCTAAACTGGCTGTTTCTACAGCTACTCAGCTGCTCAAGCTGGCCCACAAGTACAG
GCCAGAGACAAAGCAAGAGAAGAAGCAGAGGCTGCTGGCCCGGGCTGAGAAGAAGGCTGC
TGGCAAAGGGGATGTCCCCACTAAGAGGCCACCGGTCCTTCGAGCAGGTGAGTGGGCCCC
TCCTCACAGGGTGCACGCGGGCAGGCTGTTGGCGATGATGCATGAATTTCTTCACCTGGA
ATCACCGTGAAGAGTAAAATCCGAGCTTTTTAACCCTGAGTCATAGTTGGGCCCAGACGC
ACCACACGTGCACACACAACACCCCCGTGCTCATGTAAGCTGGCTGTGTGTTCTAGGGGT
CAATACTGTCACCACCTTGGTGGAGAACAAGAAGGCTCAGCTGGTAGTGATCGCGCACGA
CGTGGATCCCATCGAGGTACGTTTGGCTGCTTTTTCAGCCATTGGTTCCTACACTTAGAT
TGTCTTTGCATTGATATGGGGAAGATACAGTTAAGCTAAATACTGAGCCTGGCACCGTAG
GCCAAGGTGGGGTGACCAGGACTGTCAGTACTGACAAGGGATCAAATCATGGCTCTTGCG
ATGATGTGAGTTTTTCACTGAATTAAACCGTGAAGTGCAAACACATGAGCTTTTTAACCC
TGAGCAATTGCTACCAAGCTAGCATTTAAATTACTGTTTTTAATGAGAATATAGCCTAGA
GCTAACGGTGTCTTCCAGCTGGTCGTCTTCCTCCCTGCCCTGTGTCGGAAGATGGGGGTG
CCCTACTGCATCATCAAGGGCAAGGCGCGGCTGGGGCGTCTGGTCCACAGGAAGACCTGC
ACCACCGTCGCCTTCACACAAGTCAACTCGTACGTAGGGGCAGCCCAAAGCTAACGTCTA
AGCTAGAGCGCGTGGCCTGTAAGAAGGGAGCACATTGTCTGAGCCTTTGCCGGTGATGGT
TGCGAATTTCTTCACCTGAATAAACCATGTGGCCATTTTGTATCTGAGGCAAAAGTCTTG
TTTGGAGCTAAAATGAAGGCATTCCTGCTTTTGGAAGGCCGCTGACCCACATTTTCCCTC
CTGCCCCATTAGGGAAGACAAAGGAGCTCTGGCCAAGCTGGTGGAAGCTATCAGGACCAA
CTACAACGACAGATACGACGAGGTAAGGAGCAGCTTTACGTTAACTGTCTTGGGGAAGTC
CAGCCTTTCATCACAGGACTGGCTGGCTCGGAACTCTTTCTGAGCAGTTGTTTGGCTAGA
ACAGCAAGGTCGAGGGTGCTTTGAAAGCCTCAGAAAACCACAGGCCAGGCTGACTGCCTT
TCTTTTGCAGATCCGCCGTCACTGGGGAGGCAACGTCCTGGGTCCAAAATCGGTGGCTCG
CATCGCCAAGCTAGAGAAGGCAAAGGCTAAAGAACTGGCCACCAAGCTGGGCTGAGCTGA
GCGCATGCAGTTGAGTTTTCTGTACATAAGTAATAAAAACTCTTCTTCAGTCAGTGTCAA
CTGTGCATTTTTGGGTCGTGGCTATGTTTTCAGACTCAAGGTCCTTCTCCCACGTAGGGT
GGGAGTTGTCGGTCTCATTGTGAAAAAGCGGTCTTAAACTGTTTGGTCCTATGTAGTACT
TGGGTATTTTGAACCAAGCCTGGAGTTTATGATCAACCAGCTGGCTGGCTCATTTAGACA
CATGGGAAAGAAGGCACAACATAGGTAGTGTAGGGCTTTATTTATACCAATACTACATGA
CGCCACATAACCCCAAATCTCTTGAAATAATGCTTACTCGGCAACTTCCTAATTAATTAG
GGACAGTGCTATATCAGTTAATCTCATCACATGCCAGGAGTCCGACGCAGGAATTTCTTA
AACCATAGGTATGATGTAGCTGCACACAGTCCGTACCTGGGGCGGAAGGTGAATGCTGTC
AGGGCTCTGAGGGGAAAAGCGGGGGAGCGGCGGGGGGTACGGGACTCACCAGGTGATGAT
GTACTGCATGTGCTCGTTCCTCAGAGTGACTCTGGTTTGCCCTCCAACGGGTCCTCCCGG
GACTGTGCTTTCTGCAGAGACAGTGGGCTCAGTCCTCGATTTCTTGTGCCACCAGCTTCT
TGGCACTTAAATGGCCAGCTGGTTTCCTGGAACCTTTCATAGCTCTTTCCTAGAGCAGTC
AGTTTTGAACAGCCAATTTCAAGTCACACCAGTAAGGCCTTTTACCTGAAACCAGCCAGC
CCCCAGTGCTGCCCTCTGTCACCCCTCCCTCACACAGAATGGAAGCAACTGGTTGGTGTC
CAGGGTTAAGAGGAAGGTAGAACCAGGGTGTTTACAAAAGCTACTTGGTCTTCTGGGGTG
GTCTGGCCACAACGTACGGAAGTCAGCATCAATGAAAATGGGGTCTGTGCCTGTGAGCCT
GGCCATGGCCTCCAGGTCCCGGTAATGCCAGTGGTTCCTTTCTGGATTGTTCTCAGGGAC
AAAGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 1359..1508, 1766..1906, 2096..2175, 2478..2608, 2832..2901, 3070..3206
1001..1031, 1359..1508, 1766..1906, 2096..2175, 2478..2608, 2832..2901, 3070..3171
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved