Equus_caballus Locus KIAA0515
snOPY snoRNA Orthological Gene Database
Equus_caballus KIAA0515
Equus_caballus
KIAA0515
25
SNORD62, SNORD62
50618..50702, 55209..55294
61637
GCCTTTTGTTAGTGGATGTTTTTACAGTTATCTCCATTTTGTCATTAAAGACACATTAT
CAATATGTGTAAATCGATGCTTTAGCTTTCTTTTCCATACGTTAATTCCAGTGAGAAATA
CTGGTTACTCAGACAAGTTTTTCTTTTTCGTGATCAAGTTTAGAACCTGTAGCCGAGGTT
GAGCGTAAGAAAAGGCACTGGCCCAGAGTACTCACTGACCTGTATTCACTAAGTATTCAG
ATGAATGAGTGAGTGAATAGATGAATGAACTCATGAGGAAAGTGCTGACGGACTCGTAGA
TACCTGTAGAAAATTAGAAAGTGGCACAGGGAAGAAGCTTCTTTCTTGGTGGTCTTTTCA
AGATTTTCTGTAAGTCGGGGGAGCACATATTGGCGGTGCAGCCCCATGTGGGCTTTCCCT
GGGGAGCACTTGCTTTCTGTTTTCCACGTCTGCACCTCAGAGAGCCCTGCCCTCGTTGCC
CAAGCAGGTGTTTTCTCTCTGGATGCTGGTTCTTTTATTTTGAAAAGTGTGGGCACCCGA
CTGTTCCCGAATCATTTACTGGCCTTGGTTGCTCCCTTTGATTTGCTTTTGCTCGTCCTT
GAAATGAGCAGCCTTGTGTAAGTGGGTTGTGGACCTCCCCTGTTATGCCTGCCTTACTTT
TGGTGCGTGTACTGCAAGTGATGAACATTTACTTTTCCATCTTGAAGAGCTGTCCTTGAC
TTAGAAAGAGGACTGCGTGTGTGAAAAGTTTATGTTTCTATGTAGTTGGTGAGCGGTGGG
TCCCAGTGATTCACATGGGGAGAGTTCTTAACGCTTGGGGCTGGGGCTATCTGCACAATG
CTCTTTAAATGTGTGCACAACTGCCTCTGCGTGCTAAGGGCATTTTCCTAGGGACAGATT
CCAAAACTTTCTTCAGATCTTCAAGGAGACCCACGCTGAAGGATTCAATCCACTGGGTCA
GAGGTTCTGGTGCATTAACACTTTTTCTTTTTCCATTTCAAAGGCAGATTGGGAGCGGTG
CCGAGAAAAATTTCCTTACTAGATGACATTTCATCGCAATGTCCGATCGTTTGGGGCAAA
TAACCAAGGGCAAGGATGGGAAAAGCAAGTATTCGACTCTCAGCCTGTTTGATAAGTATA
AAGGAAAATCAGTAGACGCGATCAGGTCCTCAGGTAAGAACCAAGCATGAAGGCCAGTTC
TTTACACTTTCCCTTCAGTGAGAACCTCTTGGTGAAGGCCTGTGAAGACCCGCAGCCCCC
GTCTCGTTAGGCGGATGGGGTCCATGCACACCCATCTTCTGGGTAGGTAGTGGTCACCCA
GTAGTTCTGAGGAAGCAGAACCCCCTGCTTCTGTTCCGAGCCTGCAGTATCCTGACTGCT
GCAGTGGGATTATTTCTCTGTCTCACTTGTTTTATTGAAGCCGTGGGTATTTTTAGCTTG
ATGAGTAGAATGGAACTTAATTTGCATCAGAGTTACTCTTTTTAGATTTCATGGTTCCAG
TCTTCTGGAATTTGGTGGGAAAAGTTCCTGTTGATACTCTCCACACCCTGTGAGGATTTG
ATAAATGTCGGGGCGCGGCTCAGGCTTGGCTCGGGTCCAGACAGAGGCTGTCCTTTCAGT
GCTGCTGCAGTGAGGTCAGAGCAGTCTCAGCTTGCAGAGAGGGGGGTGCTGTGTGGGATG
GAGGTTTCTGGCCTGGCTCCTCACCCATGTTGTAAACTCTCTGAGCCCTCTCCTGCCCGC
TGGTAAAATGGAAGCCTCTGCACAGATCGCAGCGGCTCCCGTGTCTCCTAGGTCCTCGGA
GAAGAGCTTGTGGAGTGACCACCAAACTCTTCTCGTTTGTTTCCGCGGCGGGTCTGCTCC
TTGTTTGTGTTCGGCTGCCTTTGTTGTTGTCACTCAGAGTTTGAAAGAGCGGCTGAACGA
ATCCAGCCTGTTTCCTTCTGTGACTTTCCTGTGCCACATCTGTTTCCACCCCTGTCTTCC
TACAGTTATTCCTAGACATGGCTTACAGAGTCTCGGGAAAGTTGCCACAGCCCGGCGTAT
GCCACCACCTGCAAACTTGCCAAGCTTGAAGTCTGAAAACAAAGGAAACGACCCCAACAT
CGTGATAGTACCCAAGGACGGAACGGGATGGGCAAACAAGCAGGATCAGCAAGACCCAAA
GAGGTGAGGGCGGCGGGGCGGGCGGGAGCCTCGCAGCGGCAGAGTTGGAGAACTGGGGCG
ATACCAGAGGAAGCTTTCGCCCCACTCCTGCTGCTGCTGAGTTGTTTCTTGCTCCCTGCC
TTCATTTTGTGTGGCTTTTAGAGCTGATGCTGCAGTGTTTCTGTGGGCTGCCTTGTCCCC
AGAGACCAGTGTCCCCTGTGCCTTATTAGGAAAGGCATCATCACCCTGGAGGAGCTTATG
CAATAACTGTGGACAGAGCTGGTCTTGGACCCTTGATTCTGGTGGTGGTCTGTGTGTGCT
GGGCTCCAGGTTGAGAAGGCAGCCTTCCCCACTGTGGGCTGAGGAGCTTCCCACGCAGAC
TGCTACAGTTGCTCCAAACAGACCCAGTTACGAAGGAGAACGGCCCAGAATCCTTGTTAC
CCGGAGTCAGTACGCAGCCTCCCTGAGGCTCACCCCTCTGCCAGCACAGCACTTAGGAAG
CCTTCAGAGGCCCAGGGTCTGGCACAAAAATCATCATTAGAGAAACAGAGCAACTGTTGT
GGCTGCTCCTGCGTGGTGGAGCTGAAAGCACGAGGCCGGTTCTGTTCCACTCGTGCCCGG
GGCACACAGCCTGTGCGATTCCCTCTGACCTCTGAGCCTTCAGTCATCTTCTCTGACTGG
GTTCCAGCCAGTGTTGAGGAAAGAGGATTTGTGCTGGGAGGGGTCTAGCGAGGGACAGGG
CCTTGCTAAGGCTGCAGGCAGAAACCCGCTGCTGGGGTTGCCTGTTGGGGAATGAAAACA
CAACAACCCACTCTCATGCACCTTCTTGTCCTGCATCCCTCGTGGTCTGGCTGCTGAGAC
TCGGGATCCAGAAAGGAAAGGTGAACCAGTGTTCTATTTTCATTGGAAGTGGCCGCAGTA
GCTTTTGTAAAACTTCCCTGTGGTTGCTTCAGACAGGATGTAGACAGCAGGTAATTCAGG
CAGATGATCATGTAGTAGTAGTAATCGGAGTCGAGTCTTAAAGCTGTTGTAAAAATTTTC
TGTTTGCTTAGGGATCATACTGGTTGATTGTTTAGCATGACTTTTGGAATCAGACAGACA
TGTACGTGATTTCCAGCCAGGCCATTTATTAGTTTTATGGAAGCTGGAGAATTATCTGAC
TTTGAACTTCTACATCCTCCTGTGAAGTAGAAGTAACAGCTGGCTCCCGGGGGTGGTTAC
AGGAAATAGCTGAGATAGCACGAGTCAAGTACTTAGCACAGGGCCTGGCATGGAGGAAGT
GCCTGGAAGATGTCAGCCATTATTGTCATCATTCTATTCAAATGGTAAACACTACGAACT
CTTAAGGAAACCGATATTACACATTTCAATGTAAGCATTGAAATGCCTCTGCTATCAAAT
TCTTGAGAGAGAAGACAAAGCATTGCTCCTTCCTCTTATGCAGTTTTACTCAGCATCGGC
ATAGAAAGTATCAGGCAGCTTTAATGAGGCCAGTCGTGCTGCACGTCTGCCAGGGAAGAG
GTAAGAGTGAGTGTTGGAGAGGGCAGCACACCCCAGGGGCTGGTTCTCTGCTGCCCTGGG
CCACGCCCTCCGGCGGGGTATGAGGGATGTGTTGGAGTGGGGGCCCCTAACTGCTGGGAC
TTGTTGCTTAGGTTTGGAGAACACAAAAGTGACACTACCTGGAAGCTTCCATTTTAGGCA
GAGGTGATGTGAAGGGAGCGTCAGTGGCCTTTGTTTTGTAATGATCGTGAATGTGAACAG
TGAGTTACTTGGGTTAAGTAAGCCTCGGAAGAGGATGTGTGTGTGGAATTTGGCTTCAGC
TTACAAATGAGCCACCGAAATTGGCCAAGTGGATCGCTGTCCTCCTTGATTCTCACTGGG
TGGAAGGTTGAATGGAAAGAGTGGCCAGAAAGCTGCTGAGTCAGCCGAAACCTTCCTTCA
GAATCCTTTCTTGTTGCTTTCTCAAAAGATTACCTGTGAAGTGTAAATTGACTGACACAA
CATTTTTTGGACAGCAGTTTGGCATCTTTTTTAATTTATTAGTTTGTTTATTTTTAAATA
TTTTATTTTTCCTTTTTCTCCCAAAGACCCCCAGTACATAGTTGTATATTTTTAGTTGTG
GGTCCTTCCACTTGTGGCATGTGGGATGCCGTCTCAGCATGGCCTGATGAGCGATGCCAT
GTCCGTGCCCAGGATTCAAGCTGGCAAAACCCTGGCCGCCGAAGCAGAGTGCGCGAACTC
AACCACTCGGCCATGGGGCCGGCCCCAGAACATCTTTTGATCCAACAATGTTATTTCCAA
GAACTGAAACACTACTGAATTAGTAATCCAAAAGTGTGCAAAGATATTTATACAGAAATA
TTCATTGCAGTTTTATCTATAACAGAAAAAAAATTGGAGATTGGTCAATTATGGCCCACC
CAGTTGTACTGTGTCGTTAAAGGGGTAGATTCATATGTGTTGTCATGAAAAGGTGTTAAA
TATGTTAAGTAAAAGACAAGTTCTGGAATGGTGTATATAGTGTTATTCTATTTGTGTTAA
AAATATACTATTTTAATATATATAGAAGAATCTGCTTGGACTTTCTCTTTGGAGATGATG
AATTCTGTGTTATATATATTTATAAACTTAGTTTTACTTTGAGCATATATTTCTTTATAA
GCCAGGAGAAAGTAAAAACATCTGCTCCTGGTTCAAGGCATCCAGCCCCCTGCGTAGCTG
TGAGCTGCTGGTCAGGAGTGAGGGACTCAGAGCCCCTTCTGTGCAGTGACTCAGTTTCCC
CTTTGGCAAATCCTCCATCACTTCAGTGTTTACAGTGAGCTTTTGGTCTTTGCAAACAGA
AGACTCTGCAAGAAGGCAGAGGACTGTCTGTCCTGTCAGATGTCAGCGAGGAGACCTCAA
GCCTGGATCAGTTCTCCTTGTCTTTGCCAGCGTGAGAGTCCACTGGGGAAGGTCTTATTT
GTGTTGGTCAGAAGAAGTTTTGCCCGCAGTGAGCAGCTGAGCAGCTGTGGCTCTCGGAAA
TGCAGAGGGACCTTGTCTGCATGGCCTGTGTCTTATCTAATCTCCACTCTGTCCTGCCTT
TGTCTAGTTCCAGTGCGACGGCCTCTCAGCCGCCGGAGTCGCTGCCGCAGCCGGGTTTGC
AGAAATCTGTCTCCAATTTACAGAAACCGACACAGTCAATCAGTCAGGAGGTAGGTGCTG
GGGGCCCCGTCCTGACTGTGGCCCAGGCGTCAGAGCGCCTAAATGCTTCTGTTGTTGGGG
ACTGGTAGGAGCCGTCACTGGGAAGGGTGGCTTTGCGTGACCTGCTTATTCCTAGAGGCA
AACCTGTTGGGTGACTTTGGGAAATGAGCATAGACATTGTCGTAGTCACTGAAGAGCGAT
TTTAATCTGCAACTTTTCGAAAAAGACCCCAAATATAGACTAGAATACAGACACCTAGTT
TGATTCCTGTTGACTTACCTTGAGGTGAGGTCACTCAGGCCAGCTACAGGCCAGACCAGG
GTTCCCCCGGATGTGCTCCCTGGAAACTAGTGCCATACGAAGACAAAAAGTGTGGCCACA
GAAAGGGTCAGTAGTCAGGTGAGTTTGAAAAACAGACTTGAGCAAGCTCCTTTACTGTTA
GACTTCTCAGTGTCTTTAATATGCTAGTGTGTCCTGTGACTCTAAGAACAGGACACAAGC
AACAGCATTCCCCAAATTCATTTGTCCTAGGAAGTCTTTTTAACTGAATGTGTCTAGGGT
CTTGTTCTCTCAGAACACACTTTGGGAAGTACTGAGCTGTAATCCTTTATTTGTTGATAT
ATTTAAAATGCTTTTCTAAGCAGAAGGTCATGATTTAACTAAGCAAAGCTGGTAATAGCC
TCAGTCCCTCGGAGTCTGTGGGTTACAGAGACCTACAGGAGGGTGTCCTTAGCTGGAGCT
AGAAATCTAGATGAGAGGTCTGGGAATCTTTTAGAAGACAAAAAGAAATCGAGATGTAGA
TACCTAGCATTCACCTGCTCTCTTGAAGACAACTTGAATTACTGTTTATTTTAGTTTTTG
TTGCTCCCTGAGCAATAGGAGATCAGAGATGCCATCCCCCATCTGTGGGGGATGCCAGTT
TGCCAGAAGAGCACCCCTCCTCCCCAACACTGAACTGTGCTTTTGAAATTTAAGAAAAAG
GAAAAAAAATCCATATTCATGTGAGACTCCGTATTCATTGGCCTAAATCCACTTGGGCCT
GTTAACCAGTCAGAGGACGTGGAGATGAGTTTGTATCTGTTTCCCAGAATTTGAAACTAT
TTGTACCCTGGCTGTACATCCACTCACCTTTGGAACCTGTGAAAACACATACATCTGCCT
GTACCCCACCACTGGAGAGTCTGAGCTGGGGCCTGAGTACAGTCCTGGGCATCTGTTGAA
AATAAATGCCGAGGGAACTGTGTGTAGTCAGGGTTGACGCCCCATCCTGGAGCCAGCACA
CAGGTCACTTGGCCCAGTGTTCAGCCTTCTTGGCTGTTCCCTAGTTTTCTCTCATGTGCA
GAGGTGGGGAGAAGGGGCTCCCAGTGTTTTCCACCTTCTCAAACCTCACCCCAGAGAGAT
GACAGCAGTTTTACTCTTGGGGGGAAGATTGCCAGCGGTGTTGGTACCCCTCCTTGGTCC
TGTAGGCCTTCTCTTCCAGTTCAGCGCCTTTGGTGGATGAGGGCGGGGTGGCGTTCCTTG
GGCTGCAGACAGCAAGTGGGAGGCTGTGGGTTGGCCCTGGTGCCCTCTGCTTCCTGCAGG
CTCTGAGGCTCCCTCCTCCCTGAGGCACTGTCCAACCCCAGCTGTACTGTCCCCTTATGT
TGCTGACACATCTTTTCTATGGTCTGTGTTGGGGAGACCCGTGGGCATTTCAGGCCACCC
GTGTCAATCACTCAGGGCAACTCCTGATAAATAAATGGACCGTTAGACCTGGTCAGCTCT
GCGTTGAAGGCAAGAGAGCAGCCATCTGCCTTGAGTGTGTTTAGTGGTGGTGGCAAGGGG
GCTAGATGTGGTTAGGAAAGAATAATTATTTAATCTGGTATCTGATCCGATAGGGGATGA
AGCTTCATGCTGCATCAGGCTTGTTTTCTGTATCTTCATTTCAGTTAGAAGGGGAAGGCT
AAGTTGAATGTTGTTGAGAAAGGCAGGTGAGCTCAGAGACTGGGGACCCAGAGGGGCTTT
GGATGCAGGTAGAGTGGGGACAAGTCCTGGTCTTGCTGTTGTAGTTGGGACTAGTCACTC
CTTCCTGAGCCTCAGTCGAGATACGACTAGAACCGTCCCATGGTGTGGGAGGACTTGGTC
AGGCAGAGCATGCCCAGCCCCTAGTGAGCTTTCAGCAGAGCTCAGCCAGGAGGACTGGAG
TCCAGGCCAGGCAGTCTAGATGAGTGGAGGGGAAGGCGTCTCGCCTGGGGAGTTGTGCCT
TGTAGAACGACAGTACAGTCATACACCGTATCACAACGTTTCAGTCAACGACGGACTGTA
TATATGGTGGTGGTCCCATAAGATTAGTACCATACAGCCTAGGTGTGTAGTGGGCTATAC
CATCTAGGTTTGTGTAAGTGCACTCTGATGTTTGCATGGCAAAATCGCCTGGCATTTCTC
AGAACGTGTCTCCATCATTAAGCAACACGTGACTGTAATTATGGAAAGTGGTGTGGTGGT
CTATCCAATGAAAGATCAGGCGTGTTGGCTTTCCCATGTTTGCACGCCTCTGTTAGCAGT
GGCACACAGTTTTTGAGACACATGCTAGAATTGGGTTTGTTTTTTTGTCTCTGGAGCAAG
ACAGAGTAGCTCTGTGTGGGCAGGAGAGGCAACTTGACAGAATATTCTGGAGCAGATATG
GGTTTGAGTCCTGGCTTTGTTATATAACCAGCTGTGTGACTCTGAGCTGGTCACTTCCCC
TCATCTGTAACGTGGGCTGGCCAGCTGCTGACTCCTCGGCTGCTGGACCCAGTGGGATCT
GCAGTGGGAAGCTCACGTGGTTAGATGCTGCTCAGCAGGTGGTAGTGGATATATTGGTGT
GGGATTTGAACCTAAGGTGCGGGCCTGTGGGCACCTTAGTTTAACTTGCTCAGTGATGGA
CTGCAGACCGATTGGGCTGGCTCTCTTCTAATTTTCTTCCTTCTTTCAGAATACAAATTC
AGCGCCAGGTGGACCAAAGTCATGGGCACAGCTGAATGGAAAGCCAGTAGGACACGAAGG
TGGTAAGTGTGTGCGTGTGGCGTTGGGGTGGGGGTTTAGGAGGGATGAGGACCTTTCTAG
ACTGTTCTGGTAGGGTCTAGGCAGTCTTTGTGGACTCTCTTCCCTGAGAGAGAGACTGCT
CTGTGGAGCCCTTGCCATTGCCCCTGTAGGGGAAGCGCTGATTCTGGGAAGTTTGTCGAC
TCTTTGATTTCATTCAGTGTTATTGCTAAAGACGTTCCTCCTGAGGCGTACAGAGACCTG
GGCAGCTGGCCCTGCTGCTGTTTAGTTCGGCTGTGCTGCTGATGGAGTTAATACCTGCTC
AGCAGTGTTGCCGCACACATCTGCCTCCTCTCCTGGGACCGCAAGGAGGAGGTGCTGCGC
GGTCTGCTAACTTTAGCATGGTTTATAAAGAAGCCAGCCCAGGCACCTGAGCTGCCTGCT
GGGGGACCGGAACACCAGAGCGTTGAGAGGGTTGTGTGGTATTTGTCACCTTTGGTGCCT
GCCTGACCCTCAGGAAGTGCTCAGGAAGTGTGGTCGGCTGAGCTGCTGCCATGCTAGTTC
GGTGTGATGAGGTAGGTGATGGGAGAGGTGAGCCCAAGGGAATGGGTCAGAGTTTTAAAT
GAATTGTGAACAACAAATTCAAATGGCTTCCAAGGCAGGCCCAGAATCCTTTGGGGTGAG
GGTGGGGCGTGAGCAGAGGGTAACCAGGCTCCCCTCCAGTGACTGGAGCCCTCTGAAAGG
CGGGCCCAGGGTCAGGGGCATTTTTGAGAGAAACCAAAAATCCAGATTTTTTTATGTGAA
CTCTTCTAATTTTTCAATGTTAGCTTAAATGTTTCTAACCCACTGTGCAGACCAAACGAG
GTGCCTCAGAGCTGGAAGGTGAGGGGCAGTGGTGTGAGTGGTTAACCCACAGTTGCTCCT
GCTTCTGTAAGCAGCACTGGCTGCCTTTTTTACCCCCTGCCCTGGCATCGCCCTCTGCCT
TCTGCTTGTCCCTGCCAGCCAAGGCTTTGCCAGACTTTACTTTGTGTAGCTTATATTAGA
AAACAGCTAGACGTCTAGCCTTCCGTATCCACCCTCCCCGGCCCACCAGGACCCCAGTGC
CCCTCTGGGTTGGGACCACTGTGTGGTTGAGGACGTTCCCCTCAGTCTCCTGTGGGGAAC
GGCATATCAGTCAATGTGCCACTGGAGCTGTGGGCAGAGCCCAGGCGCTCCTGATGTCAC
AACAGGCAGGGGAAGCTTGGGCCTTGTCGATAGGAGAGCTTTACGGATGCTGGAGTCCCC
AGAGGGTGAAGTGGAGGGAGCAAGAGGGATAGGGAGAGGCAGTGACAAGCAACCCTAGAA
TCAAGTCTTTAAAGAGCACTCACAGGGGCTGGCCCCGCGGCCAAGTGGTTAAGTTCGCAT
GCTCTGCTGCGGCGGCCCAGGGTTTGGACAGTTCAGATCCTGGGCACGGACATGGCACCA
CTGGTCAGGCCATGCTGAGGCGGCGTCCCACATGCCACAACTAGAAGGACTTCTAACTAA
GATATACAACTATGTACTGGGGGGATTTGGGGAGATAAAGCAGAAAAAAAAAAAAAAAGA
TTGGCAACAGTTGTTAGCTCAGGTGCCAGTCTTGGGGGAAAAAAAAAGCACTCGCTGAAC
TGTTGACAGTGCTTCTTTGGCTCTCTACAGCTTATCTTTCTGTAAAGTTAGGTTATTTAT
TTATTTTTTTTGCTGAGGAAGATTAGCCCTGAGCTAACATCTGTGCCACTCTTGCTCCAC
TGTATATGTGGGTCGCTGCCACAGTGTGGCTGACGAGTGGTACTAGTCCACACCTGGGAT
CCAAACCTGCAAATCTGGGCTGCCGAAGCAGAGTGTGCCAAACTTGTATGCCACAGTGCC
AACCCCTGTAAAGTTAGAATTTTAATTAAATGTATTAATTTTTATTTAAAAAGAATTACA
AAGCCAGCCCTGATGGCATAATGGTTAATATTCACTGTGCTCCATTTTGGTGGCCCAGGT
TTGGTTCCTGGGCATGGAACCGTACCACTTGTATGTCAGCAGCAGTGCTGTCACGGGGGC
TCACATAGAAGAATGAACTTACAGCTATACACAACTGTGTACTGGGGCTTTGGCAGGGGA
AAAGGAGGGAAAAAGGAGGAAGATTAGCAATAGATGTTAGCTTAGGGCAAATCTTCCCCT
GCAAAAAAAAAAAAAGACAAAGATTCAAAAAAAGCTAGTGTAAATGGACACAACCGCTGT
GGAGGACAGTTTGGGACTCCCTCTCAAAATATTAACACTTAGACTCTTTGATCTAGCAGT
TCCACTTTGAGGAAATCACTCTGTAAATTACACTTGCCTGTGTATGAAATGACANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTAGCCCCGTCCACCAATGCTTGATCTCGTCCCCTG
GGACGAAGCTCTCTCATCTTACTGTGTCACTTTCTCATTGCGGAGAACTCATGGTATGGG
AGATTCGTGCGTGAACAAGACGGAGCATTGAGACCTTTAGGAACTCCGCTGCTATTTATT
GAGATTTGGAAATTTACCCTTTATCCTTGTAATCCGGGGAGAGTAAGTTCAATGTCTACT
TAGAATAATACCTTCATGACTGTTGAGGCAGAAAAAAAGTACTGAACATTTTTCTTTAAA
CTTCCAATATCTACCCTACTTTTTTCTTTTTTAAGGTTGGCACCTGAGCTAACATCTATT
GCCCATATTTTTTTTCCTTCTTTTTCTCCTCAAAGCCCCCAGTACATGGTTATATATGCT
AGTTGTAGGTCTTTCTGGCTGTGCTATGTGGGACGCCGCCTCAGCATGTCCTGAGGAGCG
GTGCCATGTCCACACCCAGGATCCGACCCGGAGAAACCCTGGGCCCCTGAAGTGGAGCGT
GCGAACTCAACCACTCGGCCACGGGGCTGGCCCCCTAATCTACCATACTTTTGAAGTGTG
ACTTCGGTATTTCATTCTTGCCAGTGACCTTTTAGCATAATGAAGTGACTATATGATGCG
TCAAAGTCCCCCTTCACAGAGCAGTAGAGCCCCTTCCTGACACTTGGAAATTGTCTCTCA
GGTTGATCATTGGTGAATAATGTGTCCATTGATTACTCTGGCAGCTTTGTTTGACCCTAG
ACCTTTTTACTAAGTGGGATGGTGAATGAATTGCTGTGTTGTGCATCGACACTAATCCCA
CTGCATCTTTCTGGCAAAGTCTTCCTTGGTTACAGGTCCGTGAATCAGTGGTGCTAAGAA
TGCTGCCTAGAGAAAAATTTGGCTCTTCTGTCTAGGGAGCAAGACATATCACAGTCCGAC
ATTGTGCTGTGTGATCTTCCTGTTACTAGGTGTATATGGTGCTGGAGATGTGCTGCGCAT
TCCAGTTAAAAGGACCAGATCCCACTCTCGACCCTAAAATGCATTATTTGTCATTATCCA
TTCATCCAGAAGATGAGTGCAGGTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGCAGGAGTTGG
CAGGTAGGTTAGCTCCAGGGGTAATTTTTCCCCAAAATAAAAAAAAAAGGCTTTCTTCTC
TAAAGGGTGGTTTGGTGTTGGGGAATGAATGAAAGAACAAAGAAAAGCAAGTGTCCCAGG
ATTCCAAGTGGAAAATGTTTGGTTCTTGTAGGGCCTTGAGGACCTTTGTAGAAAGTGGTA
AACTGAAACGGACAATGAGGAGGTACTCAGGAGTGTAAATCTAGGATGGAGGCCTTTGGG
GAGGCACGAGGGGTGACCTGTTGGCAATTACCTCCACACGAAAACGGTTGACTTCCTTGG
GCTGACTTTGTGGAAGACGGCTCTTGTCTGCCCCCCGGGGCTGCCAGAAGGACCTTACTG
TCTTCTTTGTCGTCTTCTGGGAGCTGGGAAGGATCTGGGCTGGGGCAGCTGTGAATCTTG
CCCCGTGCACTTGGTAACCAGCTCCTGCAGGTTAGCTGGCAGGGGGCCTGATGTAGTCTG
TGACCAGCTCTCCTTGTCACCTTTGGGGAACCCTTGTGCTGCTCTGCACGGTGCACTTAA
AATGAGCCGGCTGCAGGGCGCTGTGGCTTTCGGTGCGTGGAGTCGGTGGGGCAGAGAACT
GGTGATGCCCATCTCCCTTGCTCCATAAGTCTTCCTGGTTTTCTTGGCAGGTTTAAGGGG
CTCAAGCCGACTATTATCCTTCTCTCCCGAGGAATTTCCGACGCTGAAAGCAGCTGGAGG
GCAGGACAAGGCTGGCAAAGAAAAGGGCGTCTTAGATCTGTCGTATGGGCCAGGACCAAG
CCTCCGCCCACAGAGTAAGTGACCTTGCACACATGTGGGACAGCAGAATTTCCCTTCTTC
TCTCTGCCCTCTTAGAAGAAGTATGCTCGTTCTCAAAGGGCCAGAGCTCCTTGAGTCCAG
GCTCCTGCCTGGGAAGTGGTTATTGACCCTCCACCTGACCTCTGCATCTGTTGAACTTCT
TTCCTAGGCTGCTCTGGAGGTCATTTCTTGTCTTTTTGGTTGGGCCAGGCCTGTGCGCCT
TCCCAGCTGTCGTCGTATGTTAGTTCTGATATGCCTGCGTGGTCATGGCAAGGATGGATG
GGCCAAGGGCCAGTTACCTTGGTTCCTGATTTGGGAGCTTGTTTTCTAAACCGGTGATTC
CTAAATTTAGCTGAATCCTATCAGAATCACTTGGGGAATTTGTTGAAACGTCTAATTCCC
AGCCTGCTCTCTCCCCGAGCCAAATTAGAATCTTTTTTTTAAACGCGTTCCCCTGGGGAT
TGTTATGTAGCCGGCCCAGCGCCAGTCTCCATGGTCTCCTCATCTGGGGTCTGGCCAAGG
AGTCCGCAGGATTGTATTGTGATACTTGCTGGTAATGTTTTCTCCTTAGTGGCCTTGGGT
GGTCAGAGGTTGGGGTGTTGTTTGGGAATGAGACATTCTCTCTGTTCTAACTGGGGATTC
TGAAATGGCTCCTGTTCTTTTAGGGGGCATGGGAGCTTGATCAGGTCTTGAAATAGGAGG
GATTTTTGTTTGCTTGTCTTGATTAATCCTTGAAGTATTCCAGAGTCAGAATTGATATCC
TGTAAATGAAATGATCACTGTGTGACTCTTTAATAAAACATACTGCTTTTCACTAGCCTA
AGCTGGGTTATTTTGTCTGCTCCAAATATGTAATTAAATTCCTTAGGCCAAGAATTGTAA
CTTTCTGGGATTAATTAAGATGAGCTGCTTTGTAGGACTATAAAAATTTAAAACTAGGAG
AAGCTTCCGGGATCAATTCCATCCTCCTTCGAGAAGCCCCAGATGGCCAGAGGGGTTACC
GCAGGGCTTGCCTGAGATCACACGCAAGGTGGTTGAAGAGCTGGGAGCAGACCTGGATTT
TGTAGCTCCCATCCTGGGTCTCTTTCTCCTAAGGGTCACATACTTAGGGACCTTTCATGT
TTCAACCACTAACCAAAAGTTGACTCAAAAGAGGAGTCTTTTGGCTCATCTGATTTCTTG
CTGGCCTGTAATTCTGCCAGATCTTGTGTGCGTTTGGCAGTGGAGAACATCATCGTGAAA
AGATGGGCAGATAGGTTGGCAGGTTCTTATCATGACCTGTGGAAGGGCTCCACGGGATGT
ATGCAGCAGCAAGCGGGGGCAAAAGCCTGGTGGGCTGGGCCTCAGGCCCCTCCACACCCC
CACTGGAGTAGGGGCAGCTCTGCTTTGTCTTATGACCTGGGCAGTCTCTTTGACTAGCCC
TGCCACTGCTAAACCGAGTTTGAAAATGTGTGTCGGGAACTCAGTGGTTTTAATGTAAAC
GTCCGCGCAGGCACAGTGCTGATCCTGACGGGGCCAGGTCAGTATTTCTGGAATAAAGCA
CGCAAGGCTCTATTCATCAGGGCTGTCTTAATTTCTTGGGGGCATTAGATCTGTGGCTGA
TGTGGTTTCTGTTAATCAGTGAAGACTGTGTCTTGTTTTCACTTGTCTTCTCTCTCAGTG
GACCTCATTTTGTATTCCCTTATGATCAGACTTCCCTCAGCAAGTTCATACTCATTGGCC
AGGTGTCTGCCCCCCACTTTCCCTGACCTACTTGACCAGTTGACTCGATTCTTCACTTTT
TGTTTTTTTTTGTTTTTTATTTTTTTGGTGAATGAGGGGGTCCCTTGACCTTCAGAACCT
CATACAATCCCTCCTCCCCCTCCTCTTTCCTCTCCCCTTTTGCCCCCTTTCAATTTCCAG
ATGTGACAAGCTGGAGGGAGGGCGGTGGGCGAAACATAATTTCTGCCACGTCTCTGAGCG
CCTCCCCAACTGAGCTGGGCAGCAGGAACTCGAGTGCAGGAGACGGAGCCCCCTCCTCGG
CATGTACCAGCGATTCTAAGGACCCCTCTCTCCGCCCGGCTCAGCCTGTCCGCAAAGGGG
CTTCACAGTTCATGGGAAATGTATACCACCCACCTACATACCATGACATGCTTCCTGCTT
TTGTAAGTCTTCAGAGTGTCCCCTTTTTTCCCATGAAGTCGGATTGTTCATGTCCAGTGG
AACCTGCTTCACATGGTTGAATGTCCACCTTGGCTTCTCCCTCCCAGTTTCACTCTTTGC
CTTGAAAACCCTACTCTGGAGGTTCCCATTAGTTTTGCATTTTCTCTCCCCTTTTCATAT
CTTAAGGGCCTCTGGCTTCTTTCCCTGGTGATGTGGATATTATTTTAGCCTTGGTTCTTT
AGAAAAAGGAGAGGCAGGTCTTCCCCAAGACACAGGTCCCTTACTTACTTACTGACAGCA
GGAAAGAAATGGGGGAGATGGTGGTAGGATTAATTGGGAAACCCCAAGACTTTCCTGTTT
CTTTTTCCCGTGTTTTATTTTCCAAGACAAATTCTAATGTAAGTGGAACTTAGAATTACC
AGAAAATCCTGTTCATTGGTGTTATGTTTCAGATGTGTGCGCCACAGTCATCAGAGAACC
AGGGTACAGTGGAACGAGGATCTTTCCCCCTTCCCCAGCTCCGCCTTGAACCCCGTGTTC
CTTTTAGACAGTTCCAGATGAATGACCAAGATGGGTAAGGCTATTGCATTGTAGTCACAT
ATGTAGTGATTACCCCTGGTGGTGATATTGGACAAGATACTAAGCTGATGTTTGAAAGTA
CTTTGCCTTCTGGAGACCACAGTGAACCTAAAAATGAGCTCAAAACCCCAGGGTGTGTGG
GATGGCTGGGATCTGGGGCTGCCCAAGAGATTGGGTTACAATTTCAGGTTCCTGGCATAG
TTGAAGTTTTGGCATGTGCTTATTACTAGGCATTTGCATTGAGCATATGAAACAGGAGAA
TGAGGCAGAACTTCTCTCTGGGAGGTATTTGTTCATTGTCTATTTCTTTTAAAAGGAGAT
GATGTGTAAATATTAAATGCAAACAAGAACCTTTGCAATGTAGAACTTATTTTTGGAAAA
GTATTTGGTTTTACTTCCATCTGTGTACTTGACATGAGTCCAGCATCTTTACTCTTCTTT
CCCTCATCAGAAAAGAAAACAGACTGGGAATGGCTCGCCCTATCCGTCCACTAAGGCAGC
TGGTGGAACGGGCACCACGGCCCACCATCATCAATGCGGAAAACCTGAAGGGCCTTGATG
ATCTGGACACTGATGCTGATGATGGCTGGGCAGGTGGGTTATGGTGTCTCCTGATGGGTT
TATCACTGCAGTGTAGGAAGGCAGGGCTGAAGTCAGTCTCCGCTCTCCAGCGTTGAAAAC
CCTCTGCCGCAAACGTGTTTTCCCTCGGCAAGCTGGGATGAAGACAGGGCCAGGGAGCAG
CCTCTGTGCCCTGAGTTCGGATCCTCGTTGGTGGTCAGACCAGTGGTTGCTTCCTGATGG
AGCCATCATCTTCTTTTTGGTCTTTGGTCTTGATCTTAGAGCTATGGGTGATTTTGCTGT
TAACTTTATTGAAAAAAGAGCTTTTATAATGGGAAGGTTAAAACAAAATAGTACAGTGAA
CCCCCAGCTCCCCACCATCCAGCGTCACCAGGGACACAGTGTTCTGCCATTCTTATTTAT
CTTCACCCTTGCCCCAACCCTGTTATTTTCTTTTAAAATTCTTTTTGTTTGTATTCAAGT
AGATTTTAATTACACTGAAAGGCACATATCTTATTGGTACAATTTTGACAAATGGATCAC
TTGTGTGCCACACCCCTTATCAAGATAGAGAACCTCCCGCAGCACCCCGGATCCTGTCGG
CCCCAGCCCTAGCTCTGCCCAGGGCCTCCCCCTCGTCTCGTGACCTTACTGTAGGTTAGT
TCTGCCTGTTGCAGAACTACCAATGAATGCAGTCATGCAGCGTTTACTCTCAGGTAATGT
TTTCGAGATGGAACAATGTCGTTATATATCAGTAGTCACTTTTACTTACTGGAATATGTT
TCATTGTATCAATATACTGTAATTTGTTTATCTATTCGGAAGTTCCATGATGAGTGACAT
TTTCCTTTCTCTTGAGTAAATGTCGAGGAGTGGAATTGTTGGGTCAGAGGGTGGGTGCGT
GGTTAGGTTCGTAAGAATCACCCCAGCCTTTCCCGTGGCGGTTGTGCTGTTTTGCATTCC
CAGCAGCAAGGTGTGAGAATTTGGTTGCTCTGCGTCTTCACAACACTTCTGTGTTAGTCT
TTTTAATTTTAGCCATTGTAGTGGGTGTGTAATGGTATCTCATTTAATTTGCATTTTGCT
GATGACTAACAATGATGAACACATTTTCTTGTGCTCTTTGGCTACTGGTATATCTTTTTT
TTTCGTTGTGAGTGTTAGAATGTAAGTCATGGATACAAGTCTTTTGCAGCTTATATTTCA
CAAATATTTTTTCCCAGTACCTCCCTTGTCTTTTCACTTTTTTCTTTTTAAAAGATTTTC
ACCCGAGCTAACAACTGTTGCCAATCTTCTTTTTTTTTTCCTGCTTTTTCTCCCCAAATG
CCCCCAGTACATAGTTGTATATTCCTCTTGTGGGTCCTTCTAGTGATGGCATGTGGGACT
CCGCCTCAGCATGGCCTGACGAGCGGTGCCATGTCCGCGCCCAGGATCCAAACCGGTGAA
ACCCTGGGCCACTGAAGCAGAGCGTGCGAACTTCAGCACTCGGCCACAGGGCTGGCCCCG
TCTTTGCATTTTTTTTAAAGATTTTATTTTTCCTTTTTCTCCCCAAATCCCCCTGGTACA
TAGTTGTATGGTTTTAGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGATGCCACCTCAGC
ATGGCCTGGGATAAGCAGTGCCATGTCCGCGCCCAGGATTCAAACTGGCAAAACCCTGGG
CTGCCACAGCGGAGCTCGCAAACTTAACGACTTGGCCGGGGGTCTGGCCCCCCGTCTTTT
CATTTTTTTAGCACTGTGTTTTGGTAAGAAACTTTTGATTTTGGTGAAGTTTAATTTATA
AATTTGTGTTTTTTTATGGTTATTACTTTTGTGTCCTGTCAAAAATCTTTGTCTCTCCTT
GGTGGTGAAGAAATTCCTTTATGTTTTTAAATAGTTTTAATTCTTTATTTTTGGGTCTGT
GATCCATATTGAATTAATTTTTGTGTTTGGGGTAAGGTAGGAGTCGAGGTTCATTTTTTT
TCCATTTGTTGGAAATGCACCATTTGTTGATAAAACTTTCCTTCTGCTATTGAATTGCTT
TGGCACCTTTGCCAAAAATCAGTTGACCATATAAGGGTGGGGCTGTTTCTGGATCTGCGT
GTTCTTCCTCATCCGACACCACACTGTAGCTTTATAGTACGTCTTAAAGTCAGGGAGTGC
AAGTTCTCCAACTTTGTTCTTTTTCAAGATTCTAACTATTCTGAGTTCCTTTCATTCCTG
TATAAATTTAGAATCAGCCTGTCAGTATTTACAAAAAGCCTGTGGGCATTGTGGTTAGGA
TTGTGTTTGAATATATTTCTGGATACATGACATCTTAATTTTGAATCTTCCATCCAGGAA
GCTGATGAATGTCTTTATTAGGTCTTTGATTTCACTCAGCAGTCCTTTATAGTTTTCAGG
GTAGAGGTCTTGAACATCTTTTGTTAAGTTTATTCTTAAGTATTTTATGTTTTTTTTTTT
TTTTAAAGATTTTATTTTTTCCTTTTTTTCCCCAAAGCCCCCCAGTACATAGTTGTATAT
TCTTCGTTGTGGGTCCTTCTAGTTGTGGCATATGGGACGCTGCCTCAGCGTGGTTTGATG
AGCAGTGCCGTGTCCGCGCCCAGGATTCGAACCAACGAAACACTCGGTCGCCTGCAGCGG
AGCGCGCGAACTTAACCACTCGGCCACGGGGCCAGCCCCAGTATTTTATGTTTTTTGATG
CTAAGTGGCATTGTTTTTTTTTATGGTTTAATTTTTTAGTGTTTGATGTTATTATGTGGA
AATAAAGTTGATTTTTGTCTATTGATCTTGTACCAAGCACTTTGCTGAATGCGCTTATTG
GTTTCACTCGTTTCTGTTGACTTCTTAGAATTTTCTACATAAACCATCATGTCACCTGTA
AATAGGGACAGTTTCCTGTCTTTCTTTTCAGATTATATGCCTTTTGTTTCTTTTTCTTGC
CGTGTTGCACTGTCGTAATTCAGTACAATGTTGTGCTCGAGTTCTTTGTTTCTGGTACTA
GGGAGAAAGTGTTTAGTGTTTCAACATTAAATGTGATGTTAGTTGTAGGTTTTTGGAGAA
CCTCTTTATCAGATTGAGGAGGTTCTCTTCTCTTTCTAGTTTGCTGAATGTTTTGTTTTT
TAAATCAGGAATGGATGTTGAATTTTTGTTAAATACTTTTTCTTTCTTTGTGGTTGTATA
ATTTTTCCTCTTTATTTTGGTAATCTGATGGTTTCATTGATTGTTTTTTTAATGCTAACC
AATGTCACGTTCCCAGAATAAACGCCACCTTTTTTGTATGCCTAGATTCAATTTGCTGAT
ACTTTATTAAGATTCTTTTTCTTTTTTGGAAGAAGAAGCTTAGCCCTGAGCTAACATCTA
CTGCCAATCCTCTTTTTTTTTTTCTGCTTTATCGCCCCAAATACCCCCGGTACATAGTTG
TATATCTTAGTTGCAGGTCCTTCCAGTTGTGGCATGTGGGACACCGCCTCAGTGTGGCCT
GATGAGTGGTGCCATGTCTGCGCCCAGGATCTGAACTGGTAAAACCCTGGGCCGCTGCAG
TGAAGTGTGTGAACTTAACCACTTGGCCATGGGGCCGGCCCCGAATCCTCCTCTTTTTGC
TGAGGAAGACTGGCCCTGAGTTAACATCCATGCCCATCTTCCTCTACTTTATATGTGTGA
TGCCTGCCACAGCATGGCTTGCCAAGCGGTGCCATGTCCACACACCCGGGATCCGGACTG
GCAAACCCTGGGCTGCCAAAGCAGAATGTGCGCACTTGACCGCTGCGCCACCAGGCCGGC
CTCTATTAAGATTCTTAGTGTCTGTGTTCGTGGTGAATATTAGTCTATAATTTTCTTTTA
ATATCTTTCTTGGATTTTGGTACTAGGGTTATGCTGGTCTCATAGGATGAGCTGGAAAAT
AGACAGGACAGGACACCTCCTTCTCTGCTTTGTGAAAGAGTTTCCATAAGATTGGTATTA
GTTCTTTCATAAATGCTTAATAAAAATTGATTAAAAAATTGATAAAATTTACCAATGCAA
CATTTTGGCCCTGGAGTTTTCTTTGTGGAAACATTTGTGATGGTAAATTTAATTTCTTTG
ATTAGTGATGGGGCTGCTTGTATTTCCTATGTCATTTTGTGTCAGTTTTTGATAAGTTGC
GTTGGAAAGAATTTGTTCGAGTTCGATTTCTTGGTGTAAAGTTGTTGATAACACTCCTTT
TCCTTTGGATATCTGTGGAATCTGTAGTGATGTTCCTTCTTTTATTCCTGATACTTAGGT
AATTTGTGTTTTTTCTCTTTTTCTTGTCACTTCCACCAAGGACTTACTGGTTTTATTAGC
CTTTACAAAGAGGCAGACTTTGCCTTTAATTTTCTCCATTGATTGTTTTGTGTTTCGTTG
ATTTGTTCGTTTTAATTATCAGAGATTTCTAGATTTCTAATTCCGTTATAGCCCAAGAGC
ATGTGCTGTATGATTTCAGTTCTTTTCAACTTACCGAGACTTGTTTTATGAACAGGATAT
GGTCTGTCTCAGTGAGCATTCCAAGTGCATTTGAAAAAAATGTGTGTTGTACGGTCGTTG
GGTGTGACGTTCTGTCAGCAGCAGCTTTGTCGAGGTGGTTGGGAGTGTCGTTCAGACGGT
GGGTGCTTCCTGATATTTTCGTCTGGTTCTATCGGTTACTGACAGCGAGTGCTACCCTCT
CCACTGTAATTGTGGGTTTGTCAGTTTCCCCCTTGAATTCTATCCGTCTTTACTTCACTT
ACTTTGAAGCTGTTATTAGGCATGTACACTTCACAGTGTTTGTGACTGTGACATGCTGAC
CCTTTGTGCTGTTCAAGTGTCCTGTATCTCTAGTGATGCTTCTGGTCTTGGAGTCCGTTT
TGTCCTGTGTTCGGATCCTCGCTCTAACTTATTGTCCACTGTTTTCATGGTTTGTCTTTT
TCCACCCTTTTCCCCTTATACCGTCTGTGTTTATATTTAAAGTGATGTTCTGTGAGACGG
CATACAGCTGCACTTGCTCTTTGATCCAGTCCAGCTCTGCCTTTAGTTGGGATTGGGGCT
TTGGTTGTTTGGTTTTTTAAAGATCTAATTCACATAACTGATTTTTGTATAATCTAAAAT
TCACTCTTTTAAAGTCTCCAGTTCATTGATGTTTAGTACATTCACAAGTTTGTGCAACCA
TCTGCACTCTCCAGTTCCAGAACATTTCCATCACCCACAAAAGAAACCCTGTACCTATTA
GCAGTCACTCCCAGTGACCCCTGTACCCCCTGCGCCCGGCACATGTCCTCTGGGAACCAC
TAGTCTGCTTTCTGTCTCTGTGGATTTGTATCCATATTAATGGAATTACACAACACGATG
TGTGGCCTTTCGTATCTGGCCTCTCCCAGCATGTTTTCAAGATTTATCATATTAGAGTCT
GTGTCAGTATTCATCCTTTTTTTTAATTTTTTTGGCCACCAACTGTACCGTTGTCTGGAT
CTCCTACATGTTGTGTACCTACTCCTCAGTGATAGTGCCGCCTGATTCCCCCAGGGGTTG
GAATGTGCCCTGGGGCAGAATGGTGGCCAGCAGTCTCACTGGTTGAGTTTCCTCCTTGCT
AGCTAGACTCCTTCATAGATTCTGCCTGCTTTTGCTCCCTCGCCTGCCCCTTCTAATAAA
AATTTTAGGAATATCCTGTCCAGATTTAAGAACCGTTGTCTGTGGGAGAGTTAGTCTAAC
CAGCTGCATTGCTGTTGCCGGAAGCCAGAACTGTCCTTCACTTTTATCTGCAGTGTTTGT
TTTGTAGTGGCAGCTGGGTGGTTAGCCTTACTCCCCAGTTGGGTTGGCATCAAGCCTGAC
GGGAGGCAGCCCCCAGTGGTGCTGTTAGCGCTGTCGAGATGCTCATTTTTTCTCATTCTT
CCTGGCCCTCCTCCTGTTGTAGGCCTCCACGAGGAAGTGGACTATTCTGAGAAACTGAAG
TTCAGTGATGATGAAGAGGAGGAAGAAGTTGTGAAGGACGGCAGGCCGAAGTGGTAAGGA
TCCCCCTGCCTGCTCCTACACCGTTCCCCTGGAACTTGGCATTAGCAGGAGGTAAATGCG
TCAGTGCTTATGGCGCTGCCGTGTGCTGGTCGCCAGGCCAAGTGCGATTCCTGTTACCCC
AGCAACCTTCCAGGGCAGGTGCTGTTCCCGTTTGGCAGATGAGCGGACGATAGCTCTTGA
GCACAGTTGTTCAGGAAAGGAGCCAGGATTTGCATCCAGGCGCGGCTTGTGAGGCCTGGT
GATTTTTAACCGCTGTGCCAGGATTTTCCTGAGTGTGTGGTTCTGCAGGTTGCTTATGGG
TGTTGTGCCCAGAAAGGCTTCTCTCCCGAGGCAAGTTCGGGAAACCACCCTGGGCTCAAC
TTACTCCTTTCCTGCAAGGTCGCTCAGAGCCTGGAGTGTCCTGAAGTGTGTGGGGACTCT
CTGGGGATGTGGGGGAAGCAGGAAGCAGAGCATGCCAGATTCCCTAACCTTATTGGACCA
CTTTAATCTTTTCTCTCTCTTTTGGATTGTTTTTTGGACTAATTTTACTCATAATGCTCT
TTGGAAAATACTTCATTGTACTCTGGTCCGTCTAGTTTTTCTCATGACATCAGTAGCAGT
GGCTAGTACTTTTAAAATAGGACCTATGCTTGCTTTAATTTGCATTTTTTTGAGTACTAG
CAAATGTGAATGCTTTCCTTTGTGTGGAATTGCCTGTTTCCTTTGTACATTATCTATTGG
ACTTATTACGCTTTCCTTCAAAATGTAGTTCATGCATTATAATTTTTAGATATTAATGCT
TCAATATTTTTCCCTTTGTCTATTTTATTGTCAATAATTGAATGTTTATATAGGTGCGTC
TGCAAGACATTTTCTTTGTTTCATCTTTTGCTTCAAAGCTTTTGAAGTAATTCCCTCTCT
TCTGGAGGGAGCTGGTCACCATCTTCTGCCACTCTCTCTGATGATACACAAATAATTAAC
TAATCAAGGCTTCTGTAATTGATTTTAATTATTTATTTTTTTAAAGATTGGCACCTGAGC
TAACATCTATTGCCAGTCTTTTTTTCCCCTTCTTCTCCCCAAAGCTCCCCAGTACATAGT
TGTGTATTTTTAGTTGTGGGTCCTTCCAGTTGTGGCATGTGGGACGCCACCTCAGCGTGG
CTTGGTGAGCGGTGCCGTGTCTGTGCCCAGGATCCATACCGGTGAAACCCTGGGCCGCCA
AAGTGGAGCATGCGAACTTAACCACTCAGCCATGGGGCCCACCCCTTTAATTTACTTTAA
TGCTGTTTGGTTTTAACCGAAGCTTTGGGTGCACTTGGGAAATGTCCATCAGTCAGTTCC
TGGAACACTAAGCTCAGAAGGAGAGGTAATCAAGAATTTAAATCAAAGGCAGACACATGA
AATTTTACAGACTTATTGGAGCAGTACGACACTCTGTTCCTTGTCTTTTCAGTTGATGTG
AGTTGAATATTCAACTGAAAGAGTTAGATATGGGTTTTGGACCCAACTTCGCTACTGCCT
ATGACCGAGGACCCCCTCAAATTGAGAGTCCCCTAACCACCTCCTCCCTAAGCCTGCTCT
TTTTCCAATGTTCTCTGAGCTGGTTGATGATTTCCAACTCCCAGACACTTCGACTAACAT
GCCCCCAAGCCTCCTTTGACATCTTTATTTCCCCATCCATGATGGGTGCCTGAAACTTCC
TTTGACTCCATGCTTTCCTGCTGATTGTCTCAGGGACCACTGGTTCCAGCATCCTTTCTT
TCCTGGACCATTCAGAGGTTAGCCAGCTTGTCTCCTTCCTTTCGTATTATCAGTGACTGT
GCCTTAGTCGTCTTCTAAAGAGAAGTCTTCTCTGGAGGATCAGGTGTGGTCTCCATGTCT
CTCGGAGTGAAGGCAGGAGTCGCTAGCGGTTGTTGCCTTGTCGTGGTCTCCTCATGCACC
TTGTCTGCTTCCGCCCCATGTACATATGTGTGCGTGGACACATGCAGACACACGATATTA
GCCAGACCCGACTCCCTGCCTTTCTCTGAACTCTGCTGTGTTTACTGGGCACTTCCTTTG
CATACAAGAGGTGCTCAGCAAATGCACATATGTGTTTTGCCCCAGTGCCTTTGTTGACGA
GCCCTCTTGCAGCCTCCTTTTGGCATCTTCTCTCCTTTCTTGCTGTGTGTGCTCCTCTCC
TCTTGCTCTCTGTATCACAGCGTCATACTTCACTGTTTGGAGGAGCATTTATTAAGTGCC
TCCTTTATGGAAAGCACAGGGAAGGAGCTGTGATTTAGGGAGAAGGACCTACACCTTCGA
GTCCTGGGTTCCAGTCTGTTAGCTCCTTCCTTGGAGAGGGGCTCCCAGCCACCCTGAGAC
TCAGCTGCCTATTCTTTAGAATGCGGGGAGCAACGACTTTTTTTTGCAGTAAATGGAGAA
ATGCATGTGAAACATCCTGCCTGAAGCTTTGTGTGTACGAGTGACTTGGTGAATGTTGGT
ACTGAATTTCGGTGTTCTGGGCATGTCCTGTCAGCCATAAGGTTGGGTAGGTGTGTTCTG
ATGAAGGAAACTGGTATATAGACAGCTGGCTTTGGGATTCCTAAGTGCTTCTGGCTGGTT
AAGATCACACCACTGACTGGGAAAACTAACACTCACTGTGGTTTGTCCTAGGAACGGTTG
GGACCCTAGAAGGCAGCGGCAATTGTCAATGAGCTCTGTGGACAGTGCTGATGCCAAACG
TACCCAAGAGGAAGGAAAGGACTGGGGCGAAACAGTAGGCGTGACCCGTGTCATCCGGAA
GGTGCCAGAGCCTCAGCCACCTTCCAGGAAGCTTCACAGCTGGGCGTCAGGCCCTGACTA
CCAGGTACCATGGGCACTGGAGGGGTTTTGTGCCTGTAATTAGCTGGAACACACACACAA
GCTCTTTTCACGTTCATTTGACCAGAGTTCCAAGACAGTGACTAGAACTGGCCGTCTAGT
TGGCTGCCCCGTGCGTTTGTACTTTACTGAGTTCGGTGGCTGGGTTTTTGAAAAGTCCTT
GGTGGATGTTTCTCTTTTTCTTTTTTTTTAAAGATTTTATCTTTCCTTTTTCTCCCCAAA
GACCCCCCGGTACATAGTTGTATATTTTTAGTTGTGGGTCCTTCTAGTTGTGGCATGTGG
GACGCTGCCTCAGCGTGGCTTGATGAGCGGTGCCACGTCCACACCCAGGATCCAAACCGG
CCAAACCCTGGGTCGCTGAAGTGGAGTGCGAACTTAACCACTTGGCCATGGGGCTGCCCC
CTCTTTTTCTTTTAATTTAAAAAATTTAAATTTTTGCAACAGTCACAAACTTAGATAAAA
ATTGGAAATACAATCCAAAGAATATTTTTTTCTGAACCCTTTGAAGAGTAAGTTGCCTAC
CTGATCAGGTCCCTTCACCACAGAGCACTTTGATATCTATTTCCTACCAAAAATGACATT
CCTTTCTAGGGAACCACAATCAAAACCAGGAAATTAGCATTGATACATCCCTGGCATCTG
ATCTTTTCCACTTTCACCCCCTTCCACTTTTACCAGTTGTCCCATTGATGTCCTTTATAC
GAAGAATCCAGTTCAGAGTCACATGCTGCCGTAGTTGTCCTGTCTCTAGTACCCTGCAGT
CTGGCCCAGCTCCTCAGCTTTGCCTTAACTTTCATGACTGTGACACTTTTAAAGATTACA
AGCCAATTGTTTTGTGGAATGCACCTCAAATTGGGTTTGTCTGCTCCTTCCTCGTGTTTA
GGTTCAAGGTTTCCATTTTTGGCTAGAATCTCAGAAATGACACTGACACTTGTCATTGCA
TCCAGCCAGGTGACCGTGATTCCCCTCTGTCCCTCTTTGACAGCCTTGACTTTGATCTCT
TGATTAAGGTGGTGTCTGCCAGGTTTCACACTGTGGAATTACTCTCCTGCGCGTGTGTTA
ACTGATGAGGATTCTGTGGGGAGGTACTTTGAGGGCATGAATATCCTGTTCTCATGAAAC
GTTGACTTTATTTATATCAATGGGTTATAATCTGTTACTCTCATTGTTTTGAAGCTCAAA
TTTTCTTTGATTTGGCTGTCAGGAGCCTCTTCAAGCTGTCTTGTACATGTCTTCATCCTT
TTTTTGAGCAGTTCTTTGCTTTCTGATAGAACAAGCTTTTCCAAACTCATTTTCACCCTA
CGCTGCCTTAGGCGTGGAATCAGCCCTTAGGACATTTAGAAACCAGTTTGTGGGCACTGG
GAGTGCTCGCTGCTGTTTGGGGGGTCACTGCTCCTGGGCCCTGGATATGTGTGCCCTGTT
ACTGTATGTGTGTGCATATACACACATGCCCACATCTTTATTATTTCTGTATCTCTATAG
AGAGCCCCGAGTTCGCAGTGATATCTCCGACTCCACCGAATTCTTTCTAGTTTTCTCCCA
TTTCATATTTGTAATCCTTTCTCCAGCAGCAAGAAATCTGTCCCCGGTCATTCCCGATGT
TTATACGTACTCGGTCAGCTCCCCTGTGTGTGACCAGTCTCCCACTTCTGCCTCCACCCT
GCAATTAGTCCAAATTTCATTCGTATATTGAGGTTGCTCAGTATTCAAAAGGTTTCACTT
TGATCTGCTCATAACAACACTGTGAATTAGCTGAATAGAATCAACAATGATGAAACCTGT
ATAATTTTATGCATCCAAATTTCTGAAGAGATTGTTGCAGTTCAAATATTTTGCAGAACA
TTTAGTGTATGAAATGGTAGCTAATCTTAGGGCAGTTTAGAAAGGCACATTGAAAGTCTT
GACAATGTACGCATACCTTTTGATTCTGCTATTTTGTTTCTAGGAAATTCTGAAGGAAAT
AATCAGGGGTATGCATTGAGGGTTATCTGCAAGAGTGTATTGAACACCAGGGGTCTGGTA
GATACTGTGGTACAAGCTGTGCTTGAGGCAGTCCCAGCTGTCACAGAGCATGGAGAAGTT
CGTATTCAAAGGCAAAGTGAAGGGAAAGCACGCACTTCGGTCCCAATTATATTATGTAAA
AAATACCTTCGTGCTTCTAAATTGCAAGTTTCTGGTCTTTTATGATGATAGCAATTGTCT
CTGGATTATGAGAAGTTAATTTTTAGGAGAAAACTCTCTGATTACAGTAAATGTGTTGCG
TATTGCCTTTGAGGAGGTATAATTAATACACCAGAAAAGGCGTGAATCTTGGTTATTTAT
GTTTGTTGACTTTTGACAGTTATTACCTCTGTGTAACTACCACTCAAAACAGGAAGTTTT
ATATTTTTTTGATAGTTACATATCATTGGGATTTCAGTGGCTGAGGTTCAGTTAAACTTG
CCCATCATTTGTGCTATTATATATTCTGCATGCACCTTCCTGAAGATCAGTAAGAAAGTC
CCAGTGCTGAGCATTTTTCACACTGCATATTTGACATCTGGTTGTTGTCCAGTAACTGGC
AACCAGTGAGAGACTCAGAAGTGGATGAAATATCCAAAAGACAAGCTTTTAGAGATGCTT
TGTTTTAAAGATCACATTGAAAAAGCATATGTCTGACTGTGAATTTCAGTTTCTCGTGGC
TTTTTATACCTAGAGGTTTATATTTTTTTCATGAGGGGGAGGGGTGGAGCAGAAATAAGG
AACATGTGGTTTCCTGCTCCTGTTCATGAGCTCTGGAGGCCCTAACCCTGTGTGCCTCTG
AGTAGTGGTGAGTGTCTTGTTCACTGAGTGTTTGCCATGTGTCAGTCACAGCATTGAGCG
CTTTGCAAACATTTCATTGCAACTTCTCAGTCCCAAGGGCTTCCTTTATTATCCCCAGTT
TACAAATGAGGAACTAAGCTATAGAACATTGGCGCATGCCCAAACCTCATTCCAGATATA
ATACAGGCCGGAGTGGGATTGAAACCCAGGTCTGCCTGTTGCCTGACTGTGCTGCCTCTC
AGAGGTGCTCACGATTTTGGGAAGGAGAACTGATCGTGTAACGGGAGTGGCCCTGTCTCC
TGGGGTGTCACCCGCCGTTTTATCAGACTTTCTTCTTTTGGCAGAAGTCCTCAGTGGGCA
GCGTGTTCCGGCAACAGTCTGTCGAGGACAAAGAGGACAAGCCACCCCCACGGCAGAAGT
TCATCCAGTCAGAGATGTCCGAGGCCGTGGAGCGAGCCCGGAAGCGCCGGGAAGAGGAGG
AGCGCCGAGCCCGGGAAGAGCGGTTGGCTGCCTGTGCCGCCAAACTCAAACAGCTGGACC
AAAAGTGCAAGCAGGCTCAGAAGGCGAGCGAGGCCCAGAAACAGGTGGAGAAGGAAGTCC
CTCGATCGCCGGGCACCGAGAAGGTGTCCCTACAGGAGAACGGCCCTGCTGTCCGCAAAG
GTAAGCGATGGGCCCTCGTGCCACTAACTGGAAGCCCTGGGCTGTTTTCACTTGCTTGTA
CCTCCCTGGCTTCTCAGCACAACTTGTGGCTTGCAAGTCAGTGATAGCGGGAAGCATCAG
TCAGAGTTTTAGCCTGGGTCACATCCTGTTTCAGCTCCTTGCACTAGCTGGCCGCTGCAC
CTTACCTCTCTGGAACCTGTTCTGTCATCCGTAAAATGGGATGATGATAGTGTGTACTTC
CCCATACGCTGAGGAGCCTCATGAGATCATGTACGTAAAGCACTGTGCCTGGTTTCTGGA
TATAGAAAGCGCGCATATACTTATGTTATGCTACCAGTTTTGTTGTCATCGTCATTAATA
CTGTTATCGTTACCACTACAAAGATGCACACGCAGGGGGACTTTACTAAAAGCGCAGGAT
CCTTTCATGTGAGTCCTTGTTAGAGTACATTTTTCCTGGCCTTAATTCTAAAAGGAATGG
ATCACATAGCTATGTAAGAGACACTGAACAGCGCTGAGAGTCTCTGGTAGCAGTTTTAGA
GAATGTGATCAGCTGTATTCTTCATGATTTTCTTAAATCAACTAAAACCAACTCTTGAGA
AGAGAAGGGCCTGGGTGTTAGTGTCAGTCCCTGAGAGCTTCTCAGGTGGGAGTCTTATTG
GTGATGTGTTGTCAGCGCCCTTCTGGCTGAGGAACTCAGAGAAATTGACAGCGGTCATTC
TGTAAATTTCCTGTCACTGAAGTCTGAGTGAAGCCTGCGCCCGGTCTCCCACTACTCTCT
GAGATGGCGCAGGCAGACTCCATCTGCCCTGATGTGAGTGTGGTCAGTCGATACTGGGCC
TGGGTGTTGTGTGCACTGGAGCGTCACTGCCCTTCTGCAGCATCCCTCTGTTGTGCCGTG
AAGAGTCCCTGAGGCTGTGCCTCAGGGTTTGTTTGCCCTTTGCAGTAGAGTTAAGAATGC
AAATGTCAATTATACCTCAGTAAAGCCAGAAAAAAATGCAAAGCTGGGATGGAGGCAAGA
AAGAAGGGAATTTCAGAGGGAATGATGGTGAGAAACTGTGTGGAGTGTTTACTGCTTGTG
CGGCGCTGTCGTAAGTGCATTATGTGGATTATCTCATTTCACTGTCACAGAAGCCCCGTG
GGGCAGGCACAGTCGTCATCCTCATTTTACAGGTGAAGAAGTGGGCAAGGAGAGGCTCAG
TGACTTGCCGGGTCACACACCTTTGGGCGTGTTGACTCATGCTGTTTGGATGGTGGCTGT
GTGGGTTGTCCTCGAGCTCCTGGCTGTCTCTGATTTACCGGAGTCCTTTCTAATAAAACC
TCTCCCACCTGGAGCCAGACCCCAGCTGCACTGCTGACTGTGTGATCTCGGGCAATTTGC
CTCCCCTCTCAACCCTTAGTTTTCTCATCTCTAAAGTGACGCTGGGTGACGTGGGGGCTC
CATGAGCTTGTGCGTGTGAAGCATTTCCCACAGTGCCAGGGTTCGGGGATGTGAATAGTC
CAGCAGTGGGATGTAAGTGCCAACAAGAAAAAGCATTTGCTGTTAAACATTTGGTGGGCC
AAGCTTTTGTGAGCTCACCTCAGCCATTTCTCTGGTTATTTGTTCCCTAGGCTCCCCTGA
GTTCCCTGCCCAGGAAGCCCCCAGCACATTTTCAGAAGAAGCCCCCGCAGCTCCTCCCGC
TGTGACTCAGAGCAGCAGCAGTGAGGAGGGGGCCAGGGAGGTGGGGTCCCCTGCACAGGA
GTTCAACAAGTACCAGAAGTCGCTTCCTCCCAGATTCCAGCGCCAGCAGCAGCAGCAACA
ACAGGTAAACAAAGAAGAAACTTACAAGGTTGTTGTAAACAGACCTGAGTACTGAGTGAT
GCCCCCTCTCCTCTTCCCCATGCCCCCTTCAATCAAAACAAACACCAAAAATCTACTGTC
CCATATCACAGTCATCCGTAGGGATGTCAGAAGTTGTACCTGACACTTATGGCCTTGGTA
GGTCAGCCCTGCCATTATTTGTTTCTCCCAAGTTATTTCTCCTGTGAATGAATAAAAACC
CTTGTTGGTAGTTTATTGACCTTGCTGTCAAATATTGGTCAGGAAGAGTTGGTGATGTAT
GCGCTGGATTCACTGTAGTTGAGCTGGAAGAGTGGTTTTTCATTCAGAGCACCGCCCTGT
GGCCACTCCTTAGACTGAGAATGGCCCCACCTTGGGATCCTCTCAAGGAGTAAGGGAGGC
CTGGGAGCTGCTTGGAGAGCTGTCAGAGAGAGGCCTGTTAGCTTTGGGGTAAGACGTAGG
TTTGTCGGGTTTGAGTCGGACAGTTGTGGGTTCTGATCCTAGTGATGCAGCTTATCTAGT
CGTGTATGGCCTTGGACAGATCAGTGTAAACCAGGAAGAATGACCACCTGCCTCTCAGCA
TGGCAGTGAGTGTTTCATGACGCTCTGTAAACTGATTTGTCAGTATTAGCAGTATCATCT
TTATTGGTGGGTCATAAACCTTAAGAGGGACCGACTCTTTGCCCTGAAAGTCGTGTTGGG
TAATGGTTGTAATCATACCAATTTCTTGTAGTCTTGGTCATCTTGACCAACTGGAACCAC
TCATTGGCGATTCTGCATCTTACAGGGGTAATAAACGAAGGAACAAATGATTACTGATGA
GCAGTGCATTTTGGTGGGAAACTGAGATGATACCTGGACATTACTTACCCCACAGCTGGG
TGTGTGGTAAATTGTTGATCATAACCAAAAATGTTCCGAAATGTGTGTGCCCTGGAGAAA
TAAATCAAGGTCTTGAGCCTTTTCCCAGCATCTCTTTTAGTTTCCTTTAAAACCTACACC
CCAGATGCTCCTTTCCTTGAGCTCCTAGGAAGCATTGCAGGAGCTCACCAGGTCCTGTGC
TGTAAACAGGAAGTACGTTCGTTGGGCTTTTATAGCGTTGTAGTGTAAGTGAGCACGATG
CAGCTGCTCGTGGGCTTGGCAGAGAATTACCGAGTGGGGAGATATCCAGAGTAACTGGAG
CCAGACACAGCCGTAACGGTTGCTCTAGGTAATTCATCTGGGGCATAGTCACGGGTAAAT
CCTTCCTTTAGAATAAAAAGAAGTCTGAAAGTGCCAGGGCAGCCTGAAGGAGTCTGGCAA
ACAGGCCGTCTGATCAGGTTCCCTGGGGACCCAGGGTCTAGATGGGAGGAGGAGCTGTGG
GTAGAGGCCCACAGCCTCCTGTGTGGGCTGGGAGAGCTCTATTCAGTGAGTTCTGAGTAC
TCCTAGGAGGTGCCTGGAGCGCTGACGGAGCTGTCCGGGGAACCCAGCCTAGGCAGGCTG
GTGAGGCGGCCTCTTGGTTGCAGACTGGAAGCGTGTGGCTGGGTTGGCTGTCCTCGTCTG
ACTTTGCACCCGAGTCCTCCTGGATTGCTGGTGTTGGGTACACTTGTGAGGGCAGCCCCG
AGGTCACTGACAGGATGGAGCATGGTCTGAGATGAACCCTCACTGGGTCCCAGTCCTTGA
TTTTGAATATTCTGTCAAGCTTTATGTTCATCCTTGTGCAATGGATTTTCTACATAGCAA
GTCTGGTGGTAGGAGGCAAGGCTACCACAGTGAACTTGGCATGTGGTCTCTTATGATTTA
GTGAGGGAGACCAGCAACAGAGAATAAGAGCATATTGTTAGTGCTACAAAGGAAACTAAT
ACCAGTGCTGTGAGAGCAGACAGGGGACCTGATCTTGCCTAGGGAGTTGTAACAGGCTTC
CCAGGGCAAGTACTTTTTAAGCTGGAACCTAAGGAATGAGATGGGGGAGCTGGGTTTGGG
GGCGGAGGGAACAGGAACCTCCCAGACAGACAGCCCAGTATGTCACCATGGCCTGAAGCG
GGCAGCAGGCATATGGAGCAGAGGGCGAGAGCCGTCGCGTGAGGTGAAGCTGGAGAGGCA
GATGGGGCAGGATCCTACAGGACCCTGCAGGTCACTTGGAATCTTGTGGGGTTCGGGCTG
TTAGACGGAGAGCTGTAGAGAACCATCGGAGGCTCTTGTGAAGCATGTGTGGACATGATC
GGGGGTGTGTGTGTGTGTTAGATGATCAGTCTGTTAGGTCGATCGGTCTAGAGCTGGAGA
ATGATTGCAGCAGGCAGCAGTGAGGAGGAAAGGATGGTGACTGTCCTCGGGTGGTGGCTG
TAGATCCAGAGAGAAGCGGCCAGCATCCAGGTGTGCAGGTCAGCTGTCAGTTCCAGAGAG
GGTTTGGTCTGAGTGAAAGCCCAGTCTGCCTTGGGTAGCAGTGGAGCACATGGGCCCCAG
TTGTGATAATGGCATGACTGTCCATCCAGTTGTGGGAGAGGGACCGCAGCCAGAAAGCTG
CAATGCACCAGGGTCTTGCCTTCAAGCAGCTGCACGTCTTTCCCTCTTTGGTCCTCTGTT
CTGGGTGGGCTTTCTGTGCCTCCTCATGGAAAGCTGGAAGAATGAGTGGACATGCACACA
TGCTTGCGGGGCCTCTGCCCCCAGCCCCTGTCTAACCAGGCCTCTCTCCTGCTGGACAGG
AGCAGCTGTACAAGATGCAGCACTGGCAGCCGGTGTACCCTCCGCCTTCCCACCCACAGC
GCACCTTCTACCCACACCATCCCCAGATGCTGGGCTTCGATCCCCGGTGGATGATGATGC
CTTCCTACATGGACCCACGCATCACGCCCACTCGGACCCCAGTGGATTTCTACCCCTCAG
CCCTGCATCCCTCGGGTAAGCACGGTGGTCTAGTGGGCCATAGCTGCAGAGCCAGGACAG
TGTGGCATTAAGGGTGTTGCCTCAAGAGGTGGAGCCACCTGGATTCCAGTCTGACCTCTT
CCTCAAGTCACATGACCAGTCTGTTTGGAGACCTCCTTGTTTGCAAAATGAGGGTCTCAT
AACAACACCTGTCAGAGTTGTTGGGGAAAGTCCTTAGACCACGCTTTATAAATTGCTTTG
GTTAATGTTGGTCTCTCTGCTGTGTTGGCTTTGCCCTTTCCATTCTTGATGTTCTTTGTG
CCTTCTCTCTCTCCTTTTTTCCCTTGATTAGTTTTTCCCATGGTTTGTCTAATGCCATTT
TTAAAAAGCAGCTTTTGGGTTTCTTAATTCCTCTATATTGCATTAATTTCTGCTTTTTTT
CCTGTTTCCTTGTAAATTATTCTGTTCTTTTTCTAACTAATTGTGTTGGATGCTTAGCTC
ATTAATTTCTTTCCTGATGTGAGTATGTAAATATCACCTGCGCTCTGAGCTGCTGAGTTT
TAAGGTACATTGGGGGCTGGCCCAGTGGTGCAGCAGTTAAGTGCACATGTTCCACATCAG
TGGCCCAGAGTTCGCTGGTTTGGATCCCAGGTGCGGACATGGCACCACTTGGCAAGCTCA
AGTGTAGGTGTCCCACGTATAAAGTAGAGGAAGATGGGCACGGATGTTAGCTCAGGGCCA
GTCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGTTAGCTCAGGACTAATCTTCCT
CAAAAAAATAAAATAAAAAAATTTAAAAAAGAGACATTTGTATTATTGTGAAGTTTTAAA
TGTTAGCTTGATTTTTGTTTATTTTTGGTGAGGAAGATTTGTTCTGAGCTAACATTTGTT
GTCATTCTTCTTCCATTCTATATGTGGGTCGCCACCATTGCATGGCTTGGCGAGCCGTGT
ACTCCCGTGCCCAGGATCCAAACCTTAGAACCTGGGCTGCTGAAGTGAAATGCACCAGAC
TTACCCACTATGCCATGGGGCTGGCACGTAATTTATCTTTTTGATTGATGATTTTTAATA
GTATGTTGTATGTTTTCCAAGTATTCTATGGTGTTAATTTCTAACATGAATGCTTTGTGG
TCAGATAATATGGTATGTATGATATAGACCAGCTGTCAGCAAACTTTTTTTTTTTTTAAA
GATTGGCACCTGAGCTAACAACTGCTTTTTCTCCCCAAATCCCCCCAGTACAGAGTTGCA
TATTTTAGTTGTGGGTCCTTCTAGTGGTGGCATGTGGGACGCTGCCTCAGCACGGCCTGA
TGAGCGGTGCCATGTCTGTGCCCAGGATCCTAACCGGTGAAACCCTGGGCCGCCGAAGTG
GAGCACGTGAACTTAACCACTCGGCCATGGGGCCAGCCCCAAACTTTTTCTCTAAATACC
AGAAACTAAATATTTTTGGCTTTGAACTACTCAGTTTTACTGTTGTAGAATGAAAACAGC
CATGGACAATAGTAAATGAGTGAATGTAGTCACTTTACAGTAAAACTTTATTTTTAAAAA
CAAGTGGCAGATCGAATTTCACTCAAGGGCCATGATGTGGTAACCAACCCCTGATCGGGA
TTGCTTGACATTGTTGAGATTTTCTTTGTGGACCGTTACACGGCCCTTTTTTTTTTAACA
TTCTGTATTTGCTTGAAAAGAACGTATGTTCTCCAATGGGATGTGATCCATTAAATTGAG
CTAGCTAATTGCGCTGTGTGAATATCTATATTATCACAATTTTTTATCTCCTTGATCAGT
TACTAAGAGGTGTGTTAAAACCCCCCACTATGTTTGTAGATGTGTCACATCTTCGAGGCC
TGTCAGCTTTGCTTTCTCTCTCTGGGAGCATACAGGTTTGGACTTCACTCTGTCTGGGCT
TTTAATCTGCATATGGCACCCCTGTTGTCATTAATTGTGTTTCTGCCTTTACTCTCTGCT
TTGTTTGATAGTACTATCATCATGCCAGTTTTTCTTTTGATTAGTATTGATTTGGTATCT
TGTTTCCAACTCTTTATTGTCAGCCTCTCTGAGCCCTTTTTGGGGGAGTGTGTCTTTGAC
GTACACGATGGTGTGTTTGGTTTTACTCGTTGTGAAATCCCTGACTCGAATTGCCAAAAT
TGGGCGCTTTAAATTTGTTGGGATTTGATGTTCCAGTTTCCCACTCTCCAGTGTTAGGCT
TTCTGTTTATCTTTTTCTATGCTTTTCCTGTTCTTCTTTTGTTTGGATCAAAAAAAAAAA
GTTTTGCTATTCTTTTTGTCTGTGTGTTTTTCTTCTACGTTCTGTTTCTGCTATATTAGT
GGTTACATTAAATTCTAAGATGCAACCTTGACTTAGAAAGGCTGAGCTCTGTGTTTACTC
TTAACCTGAACTCTAGCCACCTCCTTGTCAGTCTTGCTTGTTTTTGCTGGGAATTTTAGT
CCTGTCTTGTTTTATGCCCACCAGACTAGTCGTTATTATTGAGATGTCGCACCCAGCCTG
TGCTTGTTCGGGTTTGCGTGTGTTCGCTAGTTCCTTTGCTGCTTTTTCTTCCTTGCGTCT
TCCTCCATCTGAGTTCAGCTTACTTCATGGAGTGCGTTTCGTCGAGTCCTCCAGGAGAGG
TTCGGCAGTAGCTTTCCTTTGCCTGGAGGTCTTTGTCGCCCGTTCTCTTGAACGGTAGCA
TAGCTGGGTGTAGCATTCTGGGGGGCAGTTGCTTCCAGGACTGTGAAGACAGCATTCCGT
TTTCTTCTGGCTCCTGCTGCTGCTGGAAGTCGGGGTCGTGTCTGGGTCATCTCCCGGGCT
CTCTTGGGCTGCTTTAAAGTCTCCTCTTTGTCTTTGGTCTCCTGCAGCTCTGCCTCAGTT
GCTGTGTCCAGGTTTATCCCTATGTCTGTCCTTCCTTTATTCTGTGTGGAACTCATCCTC
CTCAACTCTAAGGTGTAAGTCGTTAATCACTTCTAGAAAATTCTCTTCTAGTTATCGCTT
TGGATGTTTCCTTCTCCCCATTCTTTGTATCCTTTCTGCCTAGGACTTCCACTTAAATTA
TTTTATACCTCCTTCTGTCTTCCGAGTCTCTTAGACATATAGGAGAAGTTATCTCTGTGG
TGCCTTCTGGAGAAGTGCCTCAAAACTACTTTCCAGTTCAGTTTCCTCACCAGCTGTGAT
TAATCTGCTTTTTTTCTTTTTTTTCCTCCCCCTCTAGTGGGTTTTTAATTTCAGTGACTC
TTTGTTTTTATTGCTAGAATTTTTTCCTCAAATTCATTATTTTTGCTTATGTCTTATATT
TTTCTTAAGTTTTAAATTCCTTCTTTTGTGCTTTTAATCACCAAAAACATGATTTTCTAG
TGTTTAACAGATGATTCTGTTGTCTCAAGTTCTTGGGAAGCTGTATAATCCTGGGACTTG
CTGTGGACTCCTGGTGGATTGCTTTCCACTTGTGTTCTGGTGATTTCAGATTCAAGTTCG
TTTTCAACAACGCTTTATTTCTTGCAGGGATGTGGTATGGCTTGGGTTGAGAGTGTATCC
CTCCCGAGTGTCTTTACAGTTTTTTCTGCCAGCCTAGAACCACCTTTTACTTGAAGTTGG
GAAGTTTCTGGACCATTCTGGGTTATAAATCTGCATTCTTCCCTTCCCTAACCTGCATGA
AATCCAGCGTGTGGCTATGAATTCCTGGTGGGGACTATTTTTTCCCTACCCTGGCCCAGG
CCAACACACAGACTTAGTCATTGTCCTGTAGTGAAGAGCATGCATTCTTCTAATCCGCCT
TTTAATTGAGGGCATAGCCCTTCGAGGGTCTTTGTTTTAATGAGCATCTCAGCTGCAACT
CTGCCTTGTGCAGAAAAGCCCCCTCCTTGTCCTTGAGGGTGTTGAAGACCAAGCCCTCGG
GCTCCTCACGCTGTGTGCCCTGCTCCCCCTGCTCCCTCCAGGAAGCACCCCCTCGTGGCT
CTGGCCTGGGGCCGTGGTTTCAGCTCCCTGAGGATTTCCCATTTCTTTGGGGATACAGCT
CTGCAAGTGCTGTGTTTGCTGTATCCTGTCCAGCGTTTTTGTGGCAAGAAGTATGTGTGG
CAGGAGAGTTTTTCTGATAATGAGGGCTGCCATATTGCCAAAAATAGGTCAGTATACTGT
GTTGAGCAGTCTAGCATGGTTATAATCAATACTTAATGAATGCTATGTCATTTTCAGCTT
CCAGAGAGGGTCCCCACCACTCCTTGACTCAGACTATCTTTGTATTGGACTCATATAGCA
ATAGCATTTGAACAGAGCACCCCACAGCTAAAACAAAGCTTAAAACCACTGGCCTCATGC
AGAACCATTTTCCTGGCCAGATTGTCTCAGTTTAAAAGATGGGCACAACAAAATTTTTGA
CTACTAAGAAGCTTTGTGAAGAAAGTGTTTGAAAAATCAGAGCTTTTCTCCTCCACAGGC
TTAGGCCCACTGAGCCCTTGAATATCATCTGCACCAACCCACCCCCTCCTTTGATAGACA
CGGACAGAGAGGCCCTGGAGGGGGTACACATTCTCCAGTTAGTTTATACCTGGTAGGGCC
GAGCTGTCATCTTTATCCTAATCTCCTCCTGCCAGTTAACAGTTACTGTCATTTGTGTGG
TCCCCCATCCCCATTTCCTGTACAAAAATGAGAAGTGTTGCTGTCCCTCTTGGGGTTAGA
AATAAAAGGAACTAAAACCAACATCCCTTTGCTTTTCTTTTTTTTTTTTTTGAGGAAGAT
TAGCCCTGAGCTAACTGCTGCCAGTCCTCCCCTTTTTGCTGAGGAAGGCTGGCCCTGAGC
TAACATCCATGACCATCTTCCTCTACTTTATACGTGGGATGCCTACCACATCATGGCTTG
CCAAGCGGTGCCATGTGCATACCCAGGATCCGAACCGGCGAACCCCAGGCCGCCAAAGTG
CAATGTGCGCACTTAACCGCTGTGCCACCAGGCCGGGCCCCAACATCCCTTTGTAAGTCT
CCCTGCACGGGTTTGGAGCAGGTGGACCTCAGCTTGCCCTGCGCAGGCTGTGGTGTGTGG
CTCGTCTTCCCCGTGTCTGTGCAGAAAACCTTCGGCGCTGCAGCTTGCGCAGAGGTTCTC
GCTGCTGACCCATTGGCCTCTCCAGCCTTCTGCCGACATTGATGAACTCGCCAACTGGCT
ATTTCCAGTTTCTGTTTGCCAGGTTTATATACCCTTCAACACCGGTTCTTAATCTGGGAA
CAGATTGCACTCCACAGGTCTTTGAATGGGTCTCTCAGCACCTCAGATTGCATGCGTGTG
TGCTGTCAGAGGTTCTGTGGTCAGAAAAGGTTAAGAGCCCAGGGACATTAAGCAGGAAGG
TGCTGTGTCCATGTCGAGTCAAGGGTAACCATTGTCTCCTTTGAGCCTTTGGTTGACCCT
GAGATTGGAGCCTGGCTTTCTAAATGAGATGATAGAGATGAGTTCTTTGCCTTCTTCAGG
ACTGATGAAACCTATCATGCCCCAAGATTCCCTCAGTGGGACTAGCTGTCGCTCTGAGGA
TCAGAGCTGTGTGCCTCCACTGCAAGAAAGAAAAGTGACTGCCATCGATCCAGCCCCTGT
GTGGAGCCCAGAGGGCTACATGGCACTGCAGAGCAAGGGCTATTCGCTCCCCCACCCGAA
ATCGAATGACACTTTGGCCATGGACATGCATGTCAGGTGAGACGAAACTTGGTCCTACTG
ACCTGCCGCTGAAGGAAGAATCTCCAGGTCTAATTGAGAGGGGCTCTGGGAGGAGGCACT
GTCCCAGGAGACATTGCCTGAGGGACAGGGTGCCCTCCGGGAAAGGGTGTGAGAAGGGTT
GCTTGAATGCTTTTGGGAGAGGGGCACCTGTCTGATGGCAGGACTGAAGGCCGAGGAGAA
ATCCTGGGGTCAAAGGCAAATCTCGCTGGACTTTGGGCGGGGGATGAGGGGGTGGGGCCC
TCGCGGGGCAGGTGGGGTCCAGCGTGTGGGTTGTGGCTCCTTCCTGTGAAAGTAAAGCAA
GCTGGCCTTGCCAGCCCAGTGCCCCAGACTCTTCACGGACTCCAGGCTCCAGCTTGTTGT
TTGAACCCGAGGATCCCCAGCTGCTCTCTGTCTCCAGGGTGGCACGCTGAGTCCACCAGC
AGCCACTGCGTTCTTCACTCTCTGGACTCCCGGGGCCACCGACCAGTCTATGGCCCAGCA
CCTCTGAGACCTGTGTAAAGATAGAGCAAGTGTTGGTGCTTAGGTTTTTTTCTTTTTCTT
TTTTGTAATTTTTTTCTTTTTAAAACTAAGCTCTGTGTTCAGCATGGAAACCAGGAACCA
GGCTCCAATCGCATTGACTGATTTTTCTGGTTCCTTTTCAGGAGTGAAAGCTCTTACTCT
GCCTCCCCTGGAAGGTCAGGGGGCGTAAGTGCCCAGCGCGATCTCCTTGAGGAGAGAGGG
GAGGAGTACTTGAGTGCTTTTGACAAGAAGGCCCAAGCAGACTTTGACAGCTGTGTCTCT
TCTCAAAGAATAGGCCAGGAGCTTTTGTTTGCACCCCAAGAAAACGTTCAGGAAACAGGT
GCTCCTGGGGGTCACACCCCGAGCCTCAGGGGTTCCCCACTGGAGCCCGACTTTGCCCCG
GCAGACAAAAAGCCAGAGTATAGCAATTGGGACATTAGCCAGCAGCCTAAGACCACTGAC
ACAGCCAGCGGTGTCGAGAAGGAGGCGCCCCCAGAGGAGCCGTCCTGTAACGTCTCCTCC
TGGGAGAAGGAAGGGAGCCCCAACAAACAGCCGACCCTGGAGCCTGCGTGGACTCCCGAC
CCCCGGGGCTCTGGAGGCCAGCACCAGGAACAGACCAGCAGGACCCGGAGGTCGGGGCCC
ATCAAGAAACCTGTCCTGAAAGCCCTCAAGGTCGAAGACAAGGAGAAGGAACTAGAGAAG
ATCAAGCAGGAACTGGGGGAGGAGAGTGCCCGCCTGGCCAAGGAGAAGGGGCCGATTCTC
AAGGCAGAAAAGGACGAGGATGAAGAGAACGATCCCGCGCTGGCCAACTCCTCCCCGTCT
GCCTTGGAAGACCAGGGCTCTCCCAGCGCTAGTTTGGGCCGCGAGCCCAGCAAGTCTGAG
GAGGATGAGAAGATGGACAGGGCCTGGGAGACCAGAGCCTCCCGGGAGTCCGGCGATACA
CCCCCAACAAAGAGGAATAACTGGATCTTCATTGATGAGGAGCAAGCCTTTGGGGGCAGA
GGGCAGGCCCGGGGCCGCGGCCGCGGCTTCAGAGAGTTCACTTTCCGCGGTAGGCCCGTG
GGCGGCGGCGGCATCTGTGGTGGTGGGGTCCTTGGGGCGCGGGGCATCTACAGCAACAGC
CAGAGAAGTGGCCGCGGCCGGGGCCTGCGCGAGTTCGGTCAGCCCGAGGACTTCCCCAGA
GCCAAGCCCCGGCGAAGAATTGCCAGCGAGACCCACAGCGAGGGCTCCGAGTATGAAGAA
CTTCCCAAGCGGCGTCGGCAGAGAGGCTCGGACAACGGGCACGAAGGCTCGCTCCTGGAG
AGGGAGGAGAGCGCCTTGAAGAAAGGCGACTTCAAAGATTCCTGGCGGTCCAACAAGGTG
TACTCTGAGGAGCACGGCGGTCTGGATGCTAAGAACCGAGGCCCTCGGGCCTTTGGGCGA
GCCCTCCCTCCCCGCCTCAGCCATTGTGGGTACGGGCGGAGAGCCTTCGTGTCCAGAGAG
TCAGCCCCCTGGCACAGCAAGAGTCCGGGCGCCTCCTGGCAGGAGTACAGCTCTCCTGAC
GCCTGTCCGTCCCGGCGACCCGCGGACAGAGACTGCATCCCAGATGCCTACAGACATTCC
GACTCCTTTGGCACCAGGGGCTTTGAGGACAGCCGCTTGGAGGATAAGAGGTCCTTCTTC
CAAGATGAGCACGGGGCAGATTCTGAAAATGCAGAGAACCGGCCCTTCAGGAGAAGGCGC
CCCCCGCGCCAGGACAAACCCCCTCGCTTCAGGCGCCTCAGGCAGGAGCGTGAATCCTTG
GGTCTCTGGGGACCTGAGGAGGAGCCCCACCTGCTGGCAGGTCAGTGGCTGGGCAGGTCC
AAACTCTGTCCTGGGGACAAGAGCAGCACTGTGGGCCACAGGTCCCCCGAGCTCTCGTAC
CAGAACTCCTCTGATCACGCCAACGAAGAGTGGGAGACAGCCTCCGAGAGCAGCGACTTC
AGCGAGAGACGGGAGCGGCGAGAAGGCCACGGGGCCGAGCCCGACTCCCAGGTGGATGGC
AGCCTGCCTGGGGCCAGTTTGGGTGAGAAGAAGGAGTTGGCCAAGAGGAGCTTCTCCAGC
CAGAGACCCCTGGTGGACAGACAGAGCCGAAAGCTGGAGCCGGGAGGGTTTGGGGAGAAG
TCTGTTAGGCCAGGTGGTGGTGAAGCTTCTCCCCGTTATGAGAGCCAACAGAATGGGACG
CCTTTGAAATCCAGAAGGTAAAACAGAAACAAAATCCCAGGTTCTTATTTGTTGCTGCTG
TTCTGTTATGAAGCCAGTTTTGTAAGCAGCACTTCATGCATGCATGTCCTGCCATGTGTC
AGGTGCCCCCAGTTCTCCCTGTTGTGCTCCAGGTGGGCGACTGCCCACCACGGCCATTGT
GTGTGAGCCTCTCCATCACTTGCTCTTGCACTGCTTGTCCGCTTCTCTTGTGGCGTGTTG
TTGTTGTCGTTGTGTGGCTTGAAAACCAAAACTAGAGTCCCCACTCCCATGGTCCTCCTG
TAGCAGCTGTCCTAGCACCTGTCCCAACAGTTCAGCCTCCACATGTGTACTCGGAGCTCC
GCCAGGGGCCGCTGCAGTGAAGGGGCGTTACCCGTGGGTGGAGCCTGGGGAGCACCAGAT
TCCTCTGTTCCAGGCTTGCTGCTGGGCAGTGTCCTGGTGGCGCATTGCTGGCCTCCTGGC
CCTGCAGAGACGGCTCTTCTCCGAGCCGCTCTGCTTCTCAGCAGTGAGGAGATGTGGCAC
CGTCTTGGGGATTGCCACTGTGGCATGGTTAAGGGCCAAGCAGTAGCAAAACAAAGCGGG
CTGCCTGAGGCCAGGCGAGCATCTCTTATCTGGAATTAGAGGCTTCGAGGTGGATGGTCT
GTGCTCGGTGTCGGCTCACTGCCCACAGGCTGCCCCAGAATCAGGGAGGGAGGAGCCCAC
GTGCAGGGCATGTCTCATGCAGCCCGCGTCCCTGACCATGCACAGGTCCTGCCCCAGCAT
GCTGAGGAAGACTGCTTCCCACCTTCCATCCTCCTTAGAATCCAGGGTACGGAGATGTGG
GGTGTAATTGTCATACCCCCAAAGAAGGAGTCACAGGAGGATGCTGAGGCTTTCAAGTAT
CGGTCTAGCCTAGCTTTCCAGGCCTCCGATGCCAAGACTTGGCTTTGCTTCTATTTCTGC
CCCAAGAGCCTCGCAGTAGGTCAGGGCCCGGGCTCCTTGCTGGTCAGTCTCCTGTGATAG
GAGCAGAAGGTTCAGCTCTGTTCTGAGTGTGCCCCCTTCCTTCTCTCCTTTCTGCAGCCC
CGTTGAGTTAGGCACACAGTGGAAAGGAGCAGAAGTACTGAGCCCTGGGAATGGGGTCGG
GGAGAGACCAGCTTTCCCCATGAGCAGGTGGAGCGCTGCTATAGTAGTGAGGCTGGGGGT
GGCCTTCCCCCTCGGCTTACACATGATGAGGTGCTGCTGGTGAGCAGCGTCTACAGAACA
AAGGGGCCGGTGGCAGGAACTGGAGGTGGATCAGGGCACTGCGTGTGTTGGCGTGCTGTG
TGCATGTGTGATTTTTCCTTTCCTTTCCTCCCCCAGCCTGTGGTTGCTGAGCTCAGGATC
CTCCTTCTTTTTATAGGTCCCCAGATGAGGCCTTGCCTGGAGGTCTTGGTTGCAGCAGTG
GGAGCGGCCACTACACCCTAGAGCGAGCAGCCCATGCCGCCTCTGACATCCCTGAAGCCT
CCTGTGAGAAAGCAGAGAAGGAGGCCAAGCTGGCTGCTCAGAGGGCAGGCGAGCAGGGAG
AGACCATCAAGCAGTTTGACCTGAACTATGGAAGTGAGTCTGTCCCCTCACATCTTTGTG
GGGAAGAACCCAGGCAAAAGTGAGGTCCACGCAGCTCCTCAGGGCCCTGAGTTTGCCCTC
TCGCTGACCATCTTAGCGTCTGGGCAGCTGCTGGGCTAAAGTTCTGGGGCTACAGCAGTG
AGCAAAACAGATACGATTCCTGCCCTCGGGTCGCTCATAGCCTTGCGAACCCTCATAGCA
GCCCTGCGGTGTCCCAGTTTTTTTAGAGGGGGAACCTGAGGCCCCGAGGGGTTGACTAGT
TTGTCCATGGTCACGCAGCTGGTTAGGAGCAGAACTGGGACTCCAGTGCATCTGTCTCCA
AAAACTGTTTTCTTAATTGTAGTGCTACTCAGGCCTCTTGTGTTTGAGATGGCATTGTGT
TGGAGGGGGTGTGGAAGGGTGTAGAAATCACAGCCGGTTTCTGTAGACCCCAGTGGATGC
AGTGCAGCTTCTTGGTGGTATCAAGCCAGGTATTGCCCAGCCTTCTGGACTGAGCCCATC
CTTAGCCGTCATGTGCCTGTAGGGTTGGGTTATTCTTGGCTTCTGATGAATGGAAACACT
GTCCTTCTTGTGGAATCTTGATTCAGATGCCATCATTGAAAATTGCGGGTCCAGCCCCGG
GGAGGAGAGTGAGGTGGGCTCTATGGTGGGTGAAGGCTTCATTGAAGTCCTGACCAAGAA
GCAGCGCCGCCTGCTGGAGGAAGAGAGGAGAAAGAAGGAGCAGGCCGTGCAGGTAAGCGG
CTGCAAAGTGAGCAGGGAGCTGGAGCGGGAGGGCAGGCTGGTGCAGAGAAACCCAGAGCA
GAGGTGAGGGAGTCCTGAGTGGAGCCCGAGAGAGAAGAGAGGAAGAAGGGAGTGTTTATT
AAGTGTGCATTGTTACCCAGTGCCCACTAGCCTGGTAGCCCTGTGGGATTAGGTGGTGGT
GTCCCTGTTCTTAAAGAGGGTGACTTGTCCTGGGTGACAATAGCTGAAATATGGCTGAGC
AGGTTGGAGACCTCCATCAGCCCCAAAGTCCATCCTCCTTCCACTGCTCCCGCCTGAGTG
GGATGAGACTTGTCACCCTGGGAGTCACGGGGGTCAGGGACCCTGTACTCAGCTGGAGTC
AGGGCTGGGCTCTGCATGCTTGCTCCTGCTGTCGACATTCAGATCGCAGTCTTGTCACCC
CTTCTCCGGGGTGGCTTGGTTGGCATTGCAGTTTGCACGTGGTTGAGGTCTTGAGACGAG
TGTTCCAGCGTCTCTGGAGCAGTTGCTGGTGGTGTGGTTTTGGTGTCTGGGGTACTCTTC
CGGGGAGAACTTGTTATTCTTCATGCCTGACATCTAGGCTGGGCTACGTTGCCTTATTTC
TCCCTAGGTGCCTGTCAAAGGTCGAAGTCTTTCCTCCCGGATTCCTCCTCGGTTTGCTAA
AAAGCAAAACAACTTATGCCTGGAGCAAGGTGACGTGACTGTGCCTGGCAGCAGCCTGGG
CACTGAGATCTGGGAGAGCAGCAGCCAGGGTAAGAGTTCGGGAGCGGAGCTCAGCTGCTT
GGCCCGTGGCCACCTCACAGGCCCGGGGTGTGTTCTTCAGGAACAGCCTGCTTTGAGGGC
TGTGAGTACAGATGGAGCATTACTGTTTCCCAGCTTTCTCTGCTGGGACTTAGGTGCCAT
CCTGGCACCCTTTGCTGCCACAGCCCCTGAATGGATGTAAACTTCTCTGCCTGAAATTTG
GAAGGGCAGAGTATTCTGTTTGTGCAGTGATCAGGAGAAGGATAGCCCCCCGCCCACCCA
GCCACGGTCATTCGGAGAGTTGGCTTGACCTGGCCCATGTCAGCTGTCCCTTTTCTGTAC
CTTATGGGAGAGCAACAGGTGACTGTGAGGGGGACGAGCAAGAGCCCAGAGGCTGTCTGT
CTGTGCTCTGCACCCTTCCTAACCCAGAGGGAAGGGACTGTTGGCTCCTCCCTAAACGCT
CTCTTAGAAAGACAGCCTTGGGACAAAGGGGGACCTTACTTGTTGGAAAATTTGTGTCCC
TAAACTTTAAAAAAAAATTCATATCCAATGCTGTTTTTCTGCCAACTTTTCATGTTAAAA
TACAAAACTGGGGGCCAGCCCTATGCATAGTGATTAAGTTTGGCACACTCTGCTTTGGCA
GCCCAGGTTCACAGGTTTGGATCCCAGGCACAGACCTGCGCAGACCTACACCACTCATCA
GCCATGCTGTGGTGGGGATCCACATACAAAATAGAGGAGGATTGGCACAGATGTTAGCTC
AGGGCCAATCCTCCTCACCAAAAAAAATAAAGTACAAAGCTGTTTTAATTGAAAAGATTC
TTCTTTAATGCCTATTTGGGGCAGGGCCCTGCAGGATGCACAGATGCATAAAACAAAGAC
ACGTGACACCTCAAAGGAGGAGCTTGGAGAAGTCCTCCATTTCTGGCTTATTTTTATATG
AAATAGCAAAAGCTCCCAGAGTGAAGTGACTTGGCCCCACAGCCACATGACGAACTCCCA
AGATTCTTGGTTCTGGACCTTGATTCTTTCAGCTTTAATCACATGGCCTCTCCTCATGTT
CCTGGTTAAAACCTTGCTTCCAACAATTGCCAAAATAACATTGGAAAATACTCAACTCCG
ATTGAAAGTATGATGATCCTGTAATAAAATATTGACATTGGTCAGTTGGGTGGTGTGTGA
GAGCGATGGTTATCATTATGTAAATGTCCAGAAGCACCCACCCGCTGGAGTGGGCAAGCA
GAGCAGCCTGGACTTGAGTCCTCCTGGGTTGTCAGGCCTCTCCCTCCAGGATTCTCCCTT
GTGGCTTCAGAGGGCTCCTGGACCTTAAAATAGCGTGTAGGGTTTTGTGTACGTACACAA
GGTCCGTGGCTTTCGTGGGAATCTCAAGAGTGGCCTGTGAGCTAATGAAAGTTGAGGAAC
ACTGGCTTGGATCTTTCGAAGTCTCTGTAGAAGTAGTTGACTTAAGTGTAGGAAAGCTTC
GCCACAGCAGAGGTGGTGACAGAATTCTAACAGGTGTGAGTGAGAAGTTGCTGGTCTGTT
TACTAGAGCATATACTCAATGAGATAATGAGAAACACGATTATTGAAATCCGTCTGCGGG
GCTTGGCAGGTTGGGTGAAGCTGTCAGACGGGCTCCTGTGTATTCAGTCTGTTCGCTAGC
GTGGTGTTTGCAGGGCGGGAGGGTGGTTCTGGGCTGGGGTGGATGTGTAAGCTGCACCCG
TGCCGGTTGGTCCTCTGATGCTCTGGTTCTGTCTTCCTCCCTCTGGCAGCCCTCCCTGTT
CAGGCCTCGAACAGTGACTCCTGGACTAAAGCTGCCACTGCCTTCAACAGTACCGAGTCT
GGCTCTGCCGAGGTGAGTGGCTGCTGTACCTCTCGAGTGCTGAGTGTGTGCTTACCGTCC
ACGTGGCTAGCTTGTCCCGGGCCCCCTTCATCCCAGCCACCCGCTGAGCTCTCCCTCAGC
CACAGCGGTGGAGCCTGGGTCAGAGGCCATTTCCATAGGCCCTGGCTCACTGCTGGTCTT
CAGCCTTGATTTCTGATCTGTGTGAGGTACCTGTGGGAGAGGGAGGAAGAGAAGGATGCC
CACAGAAACCCCCCTGGTAGGGTGAGCGATGAGGGCCTCTCCTCCGAACCTGGGATCAGT
GGGCGCTTGGCCTGGTTTGGGTCATGAGCAAGATGAGTTTGCGGTCTCGGCCCAGGGCAC
CGTGTGTCTCACAGTTATGAGCTCGGGCAGGGTTGGTCTGTTTGGTCATGTGTCTTCAGT
TGTCAGGCACCACTGGCAGGTCAGGACTGAAGTCAGGGTGAGGCTCTGCGAGGGGCCGGC
AGTCGGGGAGACCCAACTCAGGGCCGCGCTCAGCCTCGCTTTTTGGATGGTCGCGTTTTT
GAGCCTGGGGTCAGGGCTCTAACCCATTTTGTGCACAGCAGGGTTTTAAGAGCAGCCAGG
GAGATAGTGGCGTTGACTTGAGCGCCGAGTCTCGAGAGTCATCTGCGACCTCCTCGCAGC
GCAGCTCCCCGTATGGCACTCTGAAACCCGAGGAGATGAGTGGGCCCAGTCTGGAACCCA
AGACCGACAGCCACAAGGAGCAGGCTCAGAAGCCATCTGAGCACAAGGTAACCTGCAAGT
CCTGTTGACAGGGCCAGGGCCTGGGCAGAAGGGGCCCTGTCTTTTGTCCTCTTCTATTCC
TGGGTGCTTAGAAGCTAGCAATTGGGGTCGTCACAGTCTGTGTGTCTAAGCCCTCTCTGC
TTCTCCATCAAGGATTCAGAACAAGGCTCAGGACAGAGCAAGGAACACAGACCAGGACCC
ATCGGCAATGAGCGTTCTCTGAAAAACAGAAAGGGCTCGGAGGGGGCCGAGCGGCTTCAA
GGGGCCGTCGTCCCGCCTGTTAACGGGGTAGAGATTCACGTGGACTCTGTGCTCCCGGTG
CCACCCATCGAGTTTGGAGTCAATCCAAAAGTGAGGTTTTGACTTGTTCGCTTTCTTCCC
TCCCTTTTTTGTTTTTTTGCTGGTACTTGGAGAAAAAAGAGGGGCTTAGACAGGGTGTCT
CTTAGGGCAGCGAGACGGGAGCTCCGCACACTGCTGGAGGAGCTATGTTGGGGTGGAGTT
GTGCACAAGGGTGCGCTTGAGCAGCCTTCTAGATTGTCCTGCTGACTCCAGCCGGGTTCT
CAGGCTGAGCAGGCCGGCGATGCTCCCTTCTCTGTTGGGTCAGCCAGTGGGCATGGGCGT
GGGAGAGGATGAGGGGGTGGTCACCTTGCTCATGTGCCCTAAGGAAACATCTGGCCATGT
TGCTCGTGTGGTGAATGCTGCTTAGTGGAATTTCTGAGTCACTGAGACCAGACCATACCT
AGATCAATTAGTGTGCGTCTCCGCCGAAAGGCGAGCCCGGATGATTTCACTGGGCTCTCT
CCCCTCTCCTCAGGACTCCGATTTCAGCCTGCCGCCTGGTTCTGCATCTGGGCCTGCAGG
GAATCCAGTTGTCAAACTGCAGGAGGCCTTGGCCAGTAACGTAAGTCTGTGCTTCCACCT
CCAGCTCTGCTGGGCCCGTGCTGGCAGGCCCTGGGCGAAACGAGCCTTATGTGGCTCTGA
AGCCGAACCAACACCAGCTGTGGGGTCGGGCGGACCTGGGTTTGAGTCCTGATGCAGTCG
CCAGCTAGTTACATGTTCTCGGGCATGTTGCTTGAATGTTCCACGCCCTGATCTTGTGAC
CTTAAAATGGGATAATGTGATTGCTAAGGTCTGGTTTCTTTGGTGTTCTTTGATTTTACA
GTCTTCCAAGTTCTGTGGAAGCATGTGTTTGAGAATGCTGGGCTAAAGGCACTTGTTTAC
TCTGAGATTTCTTAGAGTCCCTGTAATATGCTGATGGGTGCTGGGCATCTGCAAGAGGAG
GGTCTAGCAGTTGCATTTTCAAACATATGTTACCTGGCACCTCTTTTCCAGTTTCCTGAG
GGGCTGACACAGGACTGGGGGAATCCAAGCCAGGTAGCAGGTTCCTGCGTGCTGGTAGCC
AGTCATTTTTATGTTGTCGAGACATGGCTGCCCCTGCTGGAGCGCTCCCTGGGCTGTGGT
GTGGAGGTGGTTTCCAGGGACTTCAGTCGAGGGAATCTATGATTCCCTGCTTGGAGGAGA
TAAGCTGTGGTCTCTGCTGCTGGCAGCTTCATCTTAGTGGTCTCGAGTGCATGCGGCCAC
AACGGAAGGTGCATTGTGACGTGCTGTCTTGTTTCCTCTGTGCCTGTGTGTGTTCCATGG
TTTTTTTCCTCCCCCCAGGCTGGGTTAACACAGAGTATTCCCATCCTCCGGCGCGATCAT
CACATCCAGCGGGCCATCGGCCTCTCCCAAATGTCCTTCCCCACTGCTGACCTCACTCTG
AAGGTAACACCAGCCCTGAGCGAGCAGCCCCGCCTACCTCCTGGCCTTAGATTTGTGCTG
TCCACCGCCTCCCTGGTGGTAATTTTCATCCCTCCCTTGCTTCCAAAGATGGAGTCTGCA
CGCAAGGCTTGGGAAAACTCGCCCAGTTTGCCAGAGCAGAGCTCTCCAGGCGGCGCTGGC
TCAGGCCTCCAGCCCCCGTCCTCTGTGGGAGCCTCCAGCGGGGTCAACTACAGCTCCTTC
GGTGGGGTTTCCATGCCACCCATGCCTGTGGCCTCTGTAGCACCTTCTGCTTCTCTTCCA
GGTATCTGCACTCCCCCTACCCCTGCCAGCTCAGGGAGCCTTCTCCATTCCCTCTCGCGA
GAAACCCTGGATTGACAGCCCGAGCATCACCCCCGCCTTGACTTAAGGAGTGTGAAGAAG
TGGGAGTTTGTGTCTAGGCTGGGTGGTTCTAGCTTCCCCTGTTCTGCAGATAATGTGCAC
TTCCTGCTTCCCTACTCTGGGAAGCAGGGCCAGGGGACTTGGGCGAGGTGCTCCCAGCTC
CTGGAGAAACCTGGCTTTGAGTCAGACCCGAGTCACGTGCAGGGCTGTGCGCCTCATTCC
TGCCCGCGAGTGTGTCTGCCCTCTGGGCTGCGGCTCCCTCTGTTAAATGGGAAGAGGGCG
GTGGTGGCGCTCTGTGTGGTGGCCGCGCTGAGGAGAGGAGGTGGTCCCTAGAGAGTGCTT
TGCATCCACCGAGCTCTCCACAATTGATAGCCATTTTTATTGCTCTGTTGGTGCCCCAAG
GGAAGAAGATGGGGTTTTTGAGGGCTCAGCTGCCAAAGTCTCAGTGATGCAATTCCAATA
GATCCTTCTGACCCTCCACTGTGGACTCAAAGCAGGGAGATGAAGAGGAAAGTGACTGAG
AGACCAAGGCAGCCCTCAAGTAGAGTGCGGCCCCCTCCTGAGCGTGCGGAGCAGGGGGCC
AGTGGTTGGTTGAGAAGGGTAGGCTGGAGCCCGCTACCCTTGGCCCCTGAGCCGCTGCCT
CCCCAGGTTCCCTGAGGGATGAGGTAGGGGTGTCAGCGGCGGGCGTGGTGCTGCAGGAGC
ACAGGCCCAGCAGCAGGGGACTGAGCACACTGTGCACGCTCCTTCCCTCCCACTGATTCC
CCAGGAAAACGTGCACTTGTAGAATGTCCCCTAAAGGGTCACTCAGGAGCAGTGGACTTG
ATCCTGTTGTACCTCCTCTCGGATTCTGTTTCCAGGCAACCACCTGCCACCTCTGTACCT
AGATGGCCATGTGTTTGCAAGTCAGCCCCGGCTGGTTCCTCAAACGATACCTCAGCAGCA
GAGTTACCAACAGGTGACGACAGCAAGCAAGGGGCCCGGTGGGGTTGGGGGTGCAGCACA
CAGCGTGATTATTGTCTTCATTTATTTGTTCGTTGTCTGTTTCGTTTTCTGTGTTTCTCA
CGTGTAACACCTAGCTCCTGGCACACCACGGCAGTCAGTCCATTTTTGTTGAATGACTAA
ACGAGAGACAAGATAAATGGAGCTCAGTACTCCAGACTCTGCTGGTTTTCCTTTCTCAAA
GTTCCCCTTCCTGTGTCCTAGCTGGGGAATTAGCTGAAATGGAGTTCTCTTTGGTGGTCA
GGTATCCTTCTGATGAAAAGAAGAAAGGCCTAGACCCCCAGGCATGGATGCATTTAGAGA
GAGGTAGTTTTAGAAACCAGCAGGTGTTTGTCTTTATGCAGGATTGGCATACTTTCTGTG
CTGCAAGGGGTTGATTTCTGGAAGTCTCCCTCCTGAAACTGGTGCAGGGCCTTCCAAATG
GTCCAGCACCCCCACAGACCCGTGTGCCTGCACAGACCAGGACAGTGGAGCTCTCGGGGA
GGAGCACTGCTCCAAGTGCAGATTCAGGGACAGAGGACTTGGCCTGGCCTCAGCCCTTTT
TAAAACATCTTCTTAAATGTTGCCTGTTTAGTTGTGCAAGATTCTGATCTTCGTGTCCTT
GGCTCGTACTGCAGTACTGCGTGTGCTCTTCCCCGTGCACGCGTCTGTTGACGGCTGTGT
TCCTGAAACCCGTCTCTGTTGCTGAGCGCAGCTAGGATCCATTTTGGTGCTGCGCAGAGT
CCAGTAGAGGAACATGCTGTGGTTGGGATGGCTACCAATGTTTTGCTTTTTCCTGAGAGC
AAGGGAAGCACAGGATGTGCCCGAATGTGCATGTTGGGCAGTGTTCCAGCTGCCTTGCAG
AGGGGCCGGGGCGGTGGACGGTGGGTGACGGAGAACCCGCTGGGAGGGCACGGTCGTTAG
CTCCCTGGCTTCCCGTCCGCAGGCTGCCGCTGCCCCGCAGATCCCCATCTCCCTTCACAC
GTCTCTTCAGGCTCAAGCGCAGCTCGGACTGAGGGGCGGGCTCCCCGTCTCCCAGTCTCA
GGAGATCTTCAGCTCCTTACAGCCCTTCAGGTGAGGTGCGAGCGCTCGGGGCTGGCAGCT
TGCACGCAGAGGTTCAGACCTTCGTGGCCTGTGGGTTTGTTCCTTTTGTCCTGCTGCTGT
TGTGCACGCTCTGCTTTCGGGGGCTGGGGGAGCTCAGTGATTACGGTTCATTATTCCCTG
TTTTGCAGGAGCGGCCATGGGTTCGACTGGGCCTTGCTTTTCTTTCTGTGTCCTTCTGCC
ACCTTTCCTTCTCTTCACCTCCCCTCTTCTCCCCCTCCTCCCTTCTTTCCTCCTTCCCAC
CTGGGACGTGCTCTTTCAGTGTGTCTGGCGTCCTGTGGTTTGGCATCACATAGGGTTTCC
TGTCCTTGTGCAGTCTGGATGTGTCCATGTGTTTAGTCCTGTGATGTGCAAACTGTGCTC
CGTAGACCAGCAGCATGAGCATCATCTAGGGGCTTGTTGTAAATGCAGATTCTCAGGCCC
CGTCGCAGACCTTCCGAGTTACAATCTCCGGGATCCGGGAGCGGGGCCAGCAGTGTGTGT
TTCAGCAAGCCCATCGGGGGTTCTGATGCGTGCTCACGTTTGAGATCCATTGTGTACTCA
CATACCTGACGCCGACTGTCTGTCTGGCTTTTGCAGATCTCAGGTGTACATGCACCCTAG
CCTGTCGCCGCCCAGCACCATGATCCTCTCTGGAGGTACAGCCTTGAAGCCTCCGTACTC
GGCATTCCCAGGCATGCAGCCCTTGGAGATGGTGAAGCCCCAGTCTGGCTCACCCTACCA
GCCCCTGAGCGGAAACCAAGCCCTGGTCTACGAGGGCCAGCTCGGCCAGGCTGCCGGTCT
GGGTGCCTCACAGATGTTGGACTCCCAGCTCCCACAGGTCGGGAACACAGTCACTGCCCC
CTAGACACTAGACTTCTTTTCCTTCATGCTGTTTGTAATCCTGACTGGTCCTCGGGCTGC
TAGAACCAGGGCTAGATCTTCCACCTGTTCAGAATAGTCACGTCACCTCTTCACCCCGGG
ACAGGCTGTCGCCTCAGAGCACTGCTGCCTCTGCAGCCTCTCCCCCCGCTCTCAGACCGT
GGGGCTAGGGGAAGCAGGGAGTGACCTCTTGGCATACTCACTGATGCTTCTAGACCGCTC
TCCCTCCCTTCTCCTTGAGACCCCAGCTTTGAAGCCCACACCGAGCTGGCCTCCGTGTTC
CTGTGCACCCGGTTCTGAGTCCAGTGTTTGGTTCTGCGTCTTCCTCTCCCTTGACCCGTC
GGCAGTGTTGGACGGCTTGAGGGTCACTCGCCTCAGTCCTTTGAGCCCTGGCTCAGTCTC
TCCAGCATGGCTCCTGTTCTGGTTCTCGGTAGTTTCGATGTCTACATAGATGACACCCCC
GGGTCTCCGTCCCCATTGGCTTTGTCCCCCAGTTATGTGGCCTCGCCACCGGGGCTTGGC
TCTGCCCACACTCCCGTCTGGACCGGTCACTGCCAGTAGCTGTACCTCTTCCATCATTTC
AAGTTGAAGGGTCCTACCCGGTCAGTACCTCTGAGTTTTCTGACTTGCTTTCTCTGCTCA
CCCAACTCCAGCCACCTCTCTATCGTCCCTCCCTTGACTGTGGGCTCGCTTCCCTCCTTG
GCCTGGTTACCAGAGCCAGCAGAGCCTCCCCTCCACATTTGCCCCAAACCCCGCCCTCAC
CTCCATTCATCCTGGTTAAATCCCGTGTAGCCTCTGCTCCAGCTGTCTGACCAGAGAAAA
CAGACCCTCGTTTAGGCTGGACTCGGGCTGAATGCGACCTTGCTCCGACAGCCCACCTCA
AGTGGGTCTGGGCGCCTCCCTGCACTCGGGCCCAGTCCCCTGCCCTCTTGGTGGCTGGTG
CAGACTCGCAGCTTTCTCTGCATTGCTTTCTACCCCACTGATCTTGGTTCTGTGTCACCA
AGGAAATAAAAGTAGTGAAAAAAAAAACCCCAGAGAACTTCTGCAAGCTCCCACCGCCTC
TTCTCTTTACCCGTGTGGGCTGTTGCCCTGCATCCGGTGTAGGCCAGCTGTGCGCTCTGC
TCTGGCACCCCTCCTTCCCACCTGCTCTGGGCCAGGCTCCAGCACGTCTCCCTCTTTCCT
GCCTCAGTGTCCTTTCCTGTCAGCACACAAATGTGCTACAGTGCTGCCCTCCTGGTATGA
GAGTCTCTGATTACATGCCTGCCTACCCCTATCCTTCCTCTTTTTAAAAAAAGCAAAACT
TGAAGGATGCAGTAGATTCTATGTTGCCAAATCCGATGGTTCGTTCTTCCCACTCCTCCT
GCTGGCCCATAAGCGGCATCTGACCGCTGATCACCCTTTCCCCCTTGAATCATGCTCCTC
TCGCGGTTGTGAGGACTCTGCTCCCGGTTTTCCTTCTGCCCCGCTGAAGCCCTCTTCCTT
GGTCTCCTCGGCTCTTTCCTCCTTGCCGCCCCCCGCCCCATCAGTAATGTCATGTTCCCC
CTGGGTTCTGTCCTCGGCCTAGAAATAGTCTGATCCATTTCTCTCAAATTTATGTCTTCA
GCCCAGATCTGCCTCCTGGACCTGAACTCCAGACCAGTGGGCTGCCCAGCATCACTATTG
TTATGTCTTGTGGGATCTCACACTGAGCATGTGCAAACATCATGTCCAAAACGTGATCTT
CCTCGCAGTCCTGGTTGTCCAGCCACACTATCTTGGGGCCCTACTTCCCCTCACACCCTC
TCTGCTCCTTCAGCAGAACCTGTTGGCTCTACCTTTGGAAAGTATTCAGAATCCAGCCAT
TTCTCATCCCCTCCACCCACTACTTTGTCTGGGTGATGCAGGAGCTCCTGCCTGATGATC
CTGCTTCTGCTCTTGGGCCCTGACCGTCTGTTCTCAACGCATCAGGCAGGGTGCCCCTTA
AAACACAAGTCAGCTTATACTATACCCAGAGCCTGCGCTCCGCGGGTGGCAACACTGTCC
TCATCTGCATCCTGCACCATGTTGTGTGCAGGGGGGAGCACGGGGTCTTGAGGCTCTGGC
TGCCGCATGTCTCAGTGATGCAGTTCCGATAGATCCTTCTGACCCTCCACTGTGGGCTCA
ACAGCAGGGAGATGAAGAGGAAAGTGACTGAGAGACTAAAAGTGGCCCACCCCGTTCCGC
TGTCCCAAGGGTCTCCAGGCCCCCCTCCTTCCTGTCACCCGTCTTGTTCTGGACTTTAGA
AGTGGTCACTTAGGCCTGCGGGCGTCCCCCCGTTCTCCTGTCGTAACATGCTTCAGAAGG
ATCCAGGAGGCTCCCTAAATCCCAGAACCCACTTGCGTCGTGTTTTCTCCCACCTTAGAC
ACGAAACAGTGAAGGTGTTTTCCCATTCTGTGCTACACAAAGGGCTGCAAAGATGCCCTT
CCTGTGCAGCTCTCAGCTTAGATGTTAGTGCCTGAGAAGCCTTCCTGACCTTCCCTGACG
CTTCTCCCCCGCGCCCCCCACCCCCTGCGCACAGGGTTTGCTGCCCACACTCCGGCACCG
TTTCTGTGTCCATCATGTCACTGCGCTGTCATCACCATTTCCCGGTCTGACAGTGTCCTG
GTGCTTCCCAGCATATAGCGTGCCTTCAGTAAACCTTTGTTGGATGAAAGCAAGAGGGGC
CGGGGAGACACGACCCTTTGTGAACTCAGAGAGGAGCCGCACGCTTACACCGTGAACTCC
TTGCAGTGTGGCGCCTGCCCGTTGTCTCATCACCTGCTACACACCAGTGATCAGACCTGC
CCCCTGCCATCGAGAGTGTAAAATCTAGGGTCATCTCTGCTGTACTCTAATAGAGACCTA
GGATCTTTACTGTTGTGCAAAGGCCCTGCTTTCATTCCTTTGAAATAAGAATCTGAAGTA
TAACATATAGTCACTCTTGGATGCATGTATAACCAGTGGTTTGTGGCTTTCTCCCCAACG
TCTCTTCCTCCTCCTGACTGTCCCTGTCGTCCAGCAGCTGACGATGCCGCTGCCAGGCTC
CCAGTTGCCCCTGCCTCGGTATGGCTCTGGGCAGCAGCCCCTGATTCTGCCACAGTCTAT
CCAGCTGCCGCAGGGGCAGAGCCTCTCTGTCGGGGCCCCCCGAAGAATTCTTCCACCTGG
GTCCCAGCCTTCGGTCCTTAACACCAGCAGAGAGGTAAGGATGACGTCATCCCGCTGTGA
TCCTGGGGACAGTCATTGTCTTATCAGCCCTTTCTAGCTAGTCAGGAACCACTGTTATGG
CAGAAGATGCCAGAGGTCTGGGGTACAAGCTCCTGGCCTCACCACGCCACTGATTTCCTA
CTTGTTGCAAAGTCCTCTTGGGATCCTATGACAGGAACAGGGTTCGGGGGTATGCTAGCA
ATGTGTGCAAGCTCGGGTGTGTGTGAAACCGCAGGGCAGAAAGGGAGGTGTGTGTGATTG
ACGCCCGAGGGCCAGCACGGCCTGGGAAGCATCTGTGGAGGCCGTCTCAGATCAGGTCCC
AGAGATCCTGTTAGCATAAGCCTAGGGCTGGGGTCCAGGGGTTCTGCTGAGGATGGCCTC
TGGGGTAAGGAGGTAATGTTCACAGCACTGCCAGTGCCCTGTGGTGGTGCACAGTCCGCT
GTCCCATCCCATCCAAAATAGAACAAAGACACGTCACAGCTCCTGCTGCTAACGAAACGG
GGTGGGAGGGCAGCTTGCCTTAGAAGATGCCTCTTTATCAGAAATTCTCAGGGGCTCTTA
CTGGCTTTGCCCATGGTGGTTCCGCGAGGGTCAGGCTGTCTCCAGGGCCATCAGGTGACA
GCTGGTTACCTCTTGGTCTCTCTAGTCCTCTCAGATGGAGATGAAGGGCTTCCACTTTGC
CGACAGTAAACAGAATGTTCCTCCAGGAGGCTCTGTGCCCTCACCGCAGGCCTACAGGTA
AGAAGGGCCCTGGGAGTCGGATGCTGCATAGCTGAGCGCTCGCTGTAGGTGCGACTCGGC
GCTTCAGAGGAACCCGTGGGGCCCAGGGAGGACAGTGGAAGGGCACTGAGGCTGGTCCCC
TTTGTAAGCCCATGTGTCACTGTGAAGTTTCAGTGCTGGGACACACTCGTGTTTTAGTTA
ACCACAGGAAAAGCAGCAATTGGGAGAGTGGTTTTGTTTTTAACCATCGTCATCAGATGC
TCTGGACTGGGGAGCTTTTTGGAAAGGCAGGAAAGGGAACGGCTAACGTCAATAATGTCA
GAACCGACGCTGACTACTCAGAGCTTCCTCACCGGACTTTCAAAAAGGATTCACTGGCCA
AGAAGCCACGCACCCCAGAAGGTTCCTTTCCCAGGGGCAGCTTTTCCCTGGACGGGCCTC
TGAGCCTGCCAGGGCTTGTGGGGCCGTGCCTTACATACTACGAACTGCCACCTCTTCTTT
GCTTCCTCTGTGTCTGTCTCTGCTTCCAGTAACTGTCCCAGGGCCCTCAGTTGGGTTCGG
AGGTGGCTTTGTACGAGTTATTTCGTGGAGTGACTTATATTAAAAAATGAGAGAACCTCT
GGTTCTGCTGACTTTTTCACCCCTAAGGAAGATGTGCTGGACAGGAAGGCGCATGCTCTG
GCTGTGGGCCCAGGGGTGGCACAGTCCACTCTTGTTAACATGTGGGAGATTCCTGGCGAG
CCCTCCTGTCTGCACATGAGTAGAGCAGACGTGCTGACTTGCAGTGCCTGTGAGGTCGAC
AGCGCAGCTGCGGAGCACCATGAAGGCCTGACCCGCTGAGGAGCCCTCTTCCAGTCAGAT
CACCTCACCGTCTCTGCGAGTCGTTCACGCTGCCCGCGATCGCTCTGCCCAGCTGGTCTG
GGGGTGTCCAGGCCGAGGCCTCTCCTGTCACATCGTTCTCTACTTCCCACTGCATTTCCA
GAGAAAGGGATTTTTGTGACATTTCCCCGTTTCATCATCTTTTCTGTTGTTTTCAGTCTC
TTGACTTCACTTATTTTTGTTTGTTAGTTCTGTTGTCTGACTATTTTTCACATAGGCCAA
AACAACAGAGCTGGAAGGAAAATATATAAGGAGAGCAGTACAGAACAATGCGTACAGTTT
GGAAGAAAGAAGGAAGCTTCACGTAGAGCCGGATGCTGCCACAGGCAGACTCCAGCAGCA
CCTGGCCCCACAGCGTTCCTCAGAGCTGCGGCCAGAGCGGGAGGCTCCCGTAACAAGAGT
CGTCTGTGTCCGTTTGGTGTAGGAATGGCAGCAGCTTTACTCTTTGGAGAATATTTAGGA
AGTATAAGCCTTAACTAGTAGCCTTTGTTTTGTTGGTGTGTTAGTAGGGTTGGGAAAATC
AGTGTAGTTTTACAGAGCAGCGTTTCCCAAGTTTTCTGGAAACAACCTCTGAGGCATGCC
CTGCCAAAAAAGGGTTCCCTGGTCACATCCTTGGGGGCATGCTGTACCTGAGACAGCTTG
TTGGGAGTCGTCGTGCTCCTCAGCCTGGCGTCTACACGGCCTCCCTGTCGAGAGTCCTGT
TCAGCTCGGCACACAGCACTTGCCACACGTTTCTTGACCACAGACTCTTTTCTCACATAG
CGCCTGATTAACACCCCTGAGAACTAGTGTCTCGTCAATGGAACAAATTTAGAAAGATGT
TCTACATTTTTGTCCCTCCTGGTATCTCTCTCTACCACCCCCTCCCCCCCAAATGAAGAC
CAGAAAAATATTCGGCATAATTCTCATGTCAGGTTTATAGACCTTTTTCTGGGTCATAGA
ATCACGTTGCTCCAGACCCTCCAAACCCTGAGAGATGGTTAGCGTCCTCCGTCCATCCGG
TCGGTGTCTGCCCACAGTGGGAGCCTCGGCCTCTGTCCCTTCGGGTGTGCCTCCGTGAGC
TGTGTTGGCGGCGCCAGGGCAGGCCGTGCTGACCGCCGTGGCCCTCTGCACTCCGGTGCT
GCGGTCCTTGTCTCCGCTGCGGAGAGGTCTGCGCCGCGTGCTAGGCTTGACTCCGTTTCT
GTGGTGACGCGTGTGTTCTCACCCCCTGCCTTTGGTTTTTTCAGGCCTAGCTCTGCTAGC
CCCAGTGGGAAGCCCTCTGGATCAGCAGTTAACATGGGCTCTGTGCAGGGACACTACGCT
CACCAGGTAGAAGATGGCTTTCCAGCCCTCCAGCCCCGGACGCTTAGGCCCGTCTCCAGG
CGCCAAAAGAGAGGGGACGGTCCAGCCCATTTGAGCACAGCTCTCAGACAGAGACGTGCC
CTAGCGCTTAGAGCATGGCGCCGGGAGCCGGGCAGCCCGAGTCCCTCCTGGCGAAGGCAT
TTCTCCTCTTGACGGGCGTCTGGATCCTTCCTTGTCCTGCAGAGAAGGGAGGATGCGGAT
TCCTCTGAGGAGGTGACGCCAGAAGGTGGACTATCCCTGCTAGTGATTTGGGCTGTGAAG
GCGCTGGACGTGGTTAGGTCTGTGGGTCAGCTCTGGAAGCCGGGGCGTGTGTGCGCGTGT
GTGTGCGCGGTGTCACTCCAGTGAGTGCTGTGTCTCTTGGTCCTCGGCCGGGTGGGGTCA
CAGATGCAGTGGCAGTTCCCCATCGTATGATGCCAGGGATGTCTCAGTGCCTTTGCCTGC
AGGCGCTGCTCTCTCCACAGTGCTCCAGAACTCGATGGGGCTGCAGAGCTCAGACACGGC
AGGCGAGGGTTTTAGTAGAACAGGATTCCTGGCCGGTGAAGGCGGAAGGTTGATGGCTCG
TTTCACTCCTCCTCACTGGGCTCCCCAGAGGGTCACTCCTTGGATTGCTTGGACTGAGCT
TCTAGGGCTTTCTTCCAGAGTTCACCCCACTGTGTGAGGCAGGATCGAGGCTGGTCACTC
TGTGACACGCTCCGCTGTGCAGAGTTGCAGACTGATGGGACCCTGACTGGGGATCTCAAA
CAAGGGTCCTGGGGGAAGGTTTCCACAGAGTGGGGGTCGGGAAATGGAAGGGTCTGGGAG
AAGCAGTCCGCCGCGTGGCCCCACGCCCCTTGTGCAGACAGTCGGGGGTTCTGAGCTCAT
AGGCTGCGCTGGGATCTGCTCGGGGCATTTTCACCTTGGGGCGTGGGGTGCACTGATTTG
AAAAGGTTCTTCCCATCGGCCTTGGATGTGCTGCTCCTGCAGAGGCCCCTGGGCATCGCA
GAAGCCTTCCCGGAGGGAGTACCCAGTGCCTCCCTGCCTCTCCGAATCACTGCACTCAGT
GCCCGTGGGAGGGAGCAGAGCAGCCTCATGCCAGTGTCCTTCCTAGGAGAGTTACTTCTA
AGGTCCTTCAACCAAAGGATGGCCTTCTTAGCGTAGCTTTTCTCTGTGACTCAGGAGCAG
GAAGCGGGTGGTGGGAACTATGTATCTGGACAGGTGTTCCTGACTCAGGGTAACTTTCTT
TGTCCCCATTCATCTGTCCAAAGGCAAAGCAACGAGTGGATGAAAAACCCAGCCTGGGAG
CCGTGAAACTGCAGGAGGCTCCTGCGGCCACCTCCCAGATGAAGCGGACCGGAGCGATCA
AGCCTCGGGCAGTGAAAGTGGAGGAGAGCAAGGCCTGAAGGTGCTCGGCCACACCTCGCC
CGGCGTGAGGACAGTGCCACCGCTCGGCCTCTGTGCAGCCTGATGCCCAGGAGTGTCCCC
AGGCCCCCGTCCAACCACCCGGCCGGACTCAGATCTCCCTTCTCTTCTCCACTCCTGAAA
GCTCCATTGTCCAGCCAGCTTGCACCGTGGATTTACGGCATTGACCTGCTTGCTTTAGTA
CGAAACAAACAAACAGATGAGCAAACGACTCCATTCCCACCTCCTTTCCACCTGCCCTGG
AGTGACTGGAGCCTCGTGCAGTGCAGCTTCCCCACCCTCCTGCCTCTCCTGGCCCGCTCC
GCTCCGCACCGCCGGGCACCTTCTCAGCAGTGCTTCCTGCCCTCCCGGCCCTCTGGGCCC
CAGGCACAGTGATTTGGCAGCAGGGTCATTTTAATTTGAGGCTTTTTATTTTAAAAAGCA
GCTAAGGTTTTGTCAAAGGAGAAAGGAAAGGAAAACAAAAACACAAGCTACGTCTGTACA
GCTAAACTTTTCTACTTTGTTCTCCATCCTCTCCCTGACCCCCACTTCTGTTTCTGGTAA
TTTCCTTTCATCTCTCTCCTGTTTAGTTTTATACATCACTGCGATACCTTAAGAGCTGAC
TCAAGAATGCGTCTCCGCCTGCTCTCAGTTGGTTAACCTTTGAGAGTTCTTGCAAAAACA
AGTGGAGGGTGCTAACATCCCCCTCGTGAGCACTCTGATGGCCAGCTACCTGCTGTGGGA
GGCGAAGGAGCAGGCGCCTCAGTTGGGTTCCACGCCCTGGGCTGATGAGCACAGGGAGCT
TATGGGCAGCCCAGTGAAGATGATGACATTTTTTAGCATAAGAATTACACAGAATTTCTG
TCCTGGACTCTTCTAAAGCCAGTGGATACGCTGACTGCTGGGCACCCAAGATGAATCATG
GAGATTTAAAGTCACTGGTGTTTTCTAGTTTGGCCTGGACGGGGCCAGCTGACCGCACCA
TAACCCCATCTGTGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1985..2162, 5227..5329, 8269..8341, 13550..13693, 15600..15841, 16292..16413, 16870..17012, 22882..22972, 25611..25803, 28964..29279, 30890..31107, 33779..33974, 39419..39635, 43756..43952, 44546..44691, 45307..45448, 47209..47291, 47858..48046, 48192..48389, 48853..48939, 49698..49802, 49908..50100, 51035..51132, 52102..52229, 52836..53088, 56164..56313, 56965..57056, 59144..59225, 60503..60637
2038..2162, 5227..5329, 8269..8341, 13550..13693, 15600..15841, 16292..16413, 16870..17012, 22882..22972, 25611..25803, 28964..29279, 30890..31107, 33779..33974, 39419..39635, 43756..43952, 44546..44691, 45307..45448, 47209..47291, 47858..48046, 48192..48389, 48853..48939, 49698..49802, 49908..50100, 51035..51132, 52102..52229, 52836..53088, 56164..56313, 56965..57056, 59144..59225, 60503..60634
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved