Equus_caballus Locus ENSECAG00000010622
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000010622
Equus_caballus
ENSECAG00000010622
25
SNORA65
3886..4013
5895
CCCTCTGGTCACCTCACCTGCCTGCAGGGATGGGGAAGAATCTAAAAACAGCCCTCCTC
CATCCCTCCCTGATGACCAGCTCTTACCCTGCTGCTCGCCAATGACTAACCCTCCCTCAC
CCCCTCCCCAAAGTCCAGCCCTCCCCACCTCCTTCCCAACGGCGGTGCCCCCTCCATCCC
TCCCAGAAGATCAGCTCTTCCCAACCTGCTTCCCGAGGCCCATCCCTCATCCATCCCCTC
CCCCGACGTCCAGCCCAGTCGAGGAGAACCACACCCATCCTCCCCTGGCTGGACTGGGCA
ATGCCCGACCTGGCTTTGTAGGTGGACAGGTCCCCGACGAGCGTCCCCTCGGGTGGACCT
GAAGGCAGGCCGATCACTCGTAGGGCTTGGTCATGGACGCGGGGTCGCAGACCACCCGGC
ACGGCCCCCGCGGAGCCCGAGTCTGGTCTCCAAACGCAGGAGCTGGGGACCGAAACTCAG
GATCTCAGAAAGTCATGCAGCCCAGAATGACGAAGTCCGAGACTCTGAGAACGGCAGAAT
CTCAGAATTAAGAGTTGAACCAGATTGAGAGCCAAATAAAACTGTTTCGATATCTACAGC
GCTTGCAACACTACGGAGTGAGAAGGGCGCCCGGGTCGCTGTGGTCCCGGGGTCTTAGAA
TCGGGGTGCGGAACCCTCACAGGAGGGGCGGGGCTCTGGGATTGAGTGAGAGGGACCACG
GGTGACCCTCAAGATAAGGGAGAATGGGGAACGGCGGGGCATACGATGTCGAGAGCACCC
TTCTCTTCTCTGCCTCCCCGGGGATAAACGCCACGAACCCCACTTCCGAAGCCCTGGTCA
CAGCTCACCGCAGCGCTGGCTTCTCCAGCCGACAGCCTCCGGCGCCTGCCCACAAGCAAC
ATGGCGGGCAGGGCGTCCCGGGGAGGCTGGGCGGAGACGGCGGTTCTCGCGAGAGCCGCG
CTTTCCTGTCTATATCAGGTCCCAGGGAGAGGCCTGCCAGTCTTTCCGCTCGGCTCGGAG
GAGGCTAAGGTGCAACTCTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGACGC
CTCCACCATGCCGCCCAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCTCTCGATG
TGGCCGGGGCTGCGGGATGTGGCCTCCCTCCGCGCCGCCTGTCGGGACTGCGGCCTTCGC
CGCAATGGGCTGTCCCACGTTTTCGGGCTTTCGGGCCGCTGCCTCCTAAAGTCCTCCCCG
GCGCTGCGTCCAAGGGCTCTGGAGGCGCTCCTGGAGCAGATGAGGTAGGCCTATCGCGGG
CCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATATTTTATATAATA
AAAAAAAAAAAAAAAATTAAAAAAATATAAAAAATAATATATTTAAACTCTTAAATAACA
ATAAAATATTATCCCGTATGATCTAAAAAGAATAAAATATTGCGCACGGCTTAGGAAAGG
CGTTTTTTACTAGCAATAAACACCATAAATAGAGATTAAAAGGCGGCCCGGACAATCACA
ACCGATACAAAGGCCGCAGCTGTCCCACGTGGCGCCGCGGGCGGTCTGCGCCCGGGGAGG
CGGCGGCTCGCCGGCTGGGGGGGGCGGGGGTGCATGTGTGGGGCCTGGTCCGCCTCGCTC
CCCGCCGAGGCTCTCTCGGTGCTCTTCCGAGAAGAGGCAGGAGGGCGCGTGGCGGGCCCC
GGAGGGATGTGGGCAGGGCCGCGGCTCGGGGCTCCCTGTGCTGGGGCCCTGACCTTTCTT
TTCTTCCAGTGTACCTGAGGTGCACCGGTGGGGAGGTCGGTGCCACGTCTGCCCTGGCCC
CCAAGATCGGCCCCCTGGGTCTGGTAGGTCGGCGTCGGGGCGGGGTGGGGGGTCGTTCAT
GAACCAGGGTGAGGAGAGCACAGAGAATCTCGGGCTCGTGCAGACAGCGTGCCCGAGGCG
CCGGTGGCGGGGAGGGATGCCGTCCCCGACCAGGTCTGAGCGCGGAGGTGGCGCCAGGCG
CAGTGCAAGGGTTAGACGTGCGGAGAGAACCTGCTCCCTTGAAGCCGGAGCTTCCTCTCC
GACGCCTCTTACCTGCTGCCATCGTATTTGAGGGAGGGCTGGAGGAGGCCACGGGGGAGG
GTTTGGAAGTAGAGAGGGTTAGTGACGCTGGCGGCCTACTTGGCCTTGCCTGGTCGGGGA
AGCGGACCTGTCGCTGTTGGGAGGGTGACACGGGTCGTGGATGAAGATTCTGGGGAAGCT
TCCAGTGGCTCGTGAAGAGCTCTGCTCTCCGTCTCCTGGTTAATGTGACCGGCATGCCCC
CTGACCAGCCTTATTGACAGGCCTCCCCTCTTCCATTTTATGTCATGAGGCCTCTCCTCC
TTGGACAGCGGTCTCCTGTCCCAAACCTCTCCCTCCTTGCTTAGTTTCCCTTGCCAGTCT
TCCTGCCCTTCTTGGGCCCTTAGCTCAGCTGGCACTCGCCGGACGTCTCCGGAGCCTTTA
GGCTGGTGGTCACTAGGGAGCTGTAAAGGAGCCCATCCCCACAGGTGAACTCGTGTTGGT
CTCACACAGGAACCCAGTATCTTTAAGGTTCCCCATGTAACTGGAATATAACTGGTTGAA
AGTCCCTACGTTACCACCTAGGTCCTTATGAGAAGGTAGGCAGCTAAGGGACTTGGCCCC
TTGTGGCCTTGAGCCTGTGGCTTAGAGCCCTGGACATTCTTGACCCCCAGCTTCATTTTC
CCAATTTACACTGTGGTGACAGTCACAACTTGAGCCGATAGGTGCAGTTCTGTGCTGCTG
ACAGCTTCTCTGTGCCAGATAAAGAAAGTGTGGGATCCTGCCAAGTGAGAAGGACTGGGC
AGATTTTCGGGCTCTGGTTCGATTTAGGCACAATGTGATTCCATTCATTTATTTCTACAG
TCTCCAAAAAAGGTGGGCGATGACATCGCCAAGGCAACTGGTGATTGGAAGGGTCTGAGG
ATCACTGTGAAACTGACGATCCAGAACCGACAGGCTCAGGTACTTGGTTCAGGGGGATGG
GGGCAGAGGTAGCAACGCCCTGGGATTCCTGGGGGTAGATCTTTGCTCCTGTAGGCAAGG
CTTTCTGGAGAGCGTGCAAAGACATGGGTTCAAATGTTAGCTCTGTCAGTTGTGTGAGAT
TGAGCAAATCACTTAGTCCTCCTCAGGCAGGATGTGTTTTCGACTGAAAATTCCTTGAAA
GTATAGCAAACCTGGTGTCTGGCCTGTGGTCTCAGGCGAGGTGCACAGTTGTATGGATCG
TGTTCTTGGAGGGTGGGGTAGGGTTTACTCATACTGGAATCTCTTGTGCAGATTGAGGTG
GTACCTTCTGCCTCTGCCCTGATCATCAAAGCACTCAAGGAACCACCAAGAGACCGAAAG
AAGCAGAAAAACAGTGAGTGGCCTTTTGCCTGGTAATCTGAGTGGTGGTGTCTACCCAGG
GTTTGATACTTTGCTGCACGTTTTCCCTTTAATGAAACGTAGGGATGGCATGGGCATTCA
ATGTTAAGCTGTGACCACGCCAGGAGCCACTAAGAAGTGTCATGTGGGTCTCCAGGATCC
CTGGTGTGGGGCTGGTCCCACTCACAGCACACAGGAGGGCTATATAGTAGGCAGGGGGAA
GCAACTGAGAATGATGACCAGGAATCGGGAGAGGCCACTGGTGAGCTGTGAGCTGGATGA
CACCCAGCAGCTCAACTAACCTTAGTAAGGGAAGCTTGTCTCTTCCCATCTCTGAAACAG
TCTCTTCCACGTAAGGTTGGCAAAGATTTGGTTTGGCCCCTAGCCACCCGCCACTGCACC
TGACCAGTTCTCTTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAACCCCAGCTTAGG
AAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTGGAAA
CAGGGAGCATGTGATGTGGGCTGCTCCAGCCTCGGCTGGTGACAAAGCTTTTTGCTGTTT
TCTGCAGTAAAGCACAGTGGAAACATCACCTTTGATGAGATTGTCAACATTGCTCGACAG
ATGCGGCACCGGTCATTGGCCAGAGAACTCTCTGGTAAGAGTGGGATGACAGGGAACCGC
CTTAATTGTGATGTGGGGTGTGTTTTCACTGAGCAGTAGTGGTTTCCCACTTGAAGGGGA
CTTTACTCTGTAAGACCCAAAATGAGGGTGCCATGTCTTCTGGGTTTGAAAGAATGGTTT
GAGATTGTGTGAGGGTGTGGGCTGGATGTGTTTGCTCTGGGTGTTGAGGGGCCCATGGAG
ACTGCATTCAGAGCCTAGAGAACTGAATGGGGCTCTGAATTTGGAGCAGGGATGTTAGGT
TATTCCTGGTGTGCTGTAAAATAGGGGTATTCCTCTCCTCGCCTGCCATGAAACTCCACT
GCTTGTGAGGATTGTGAGGGACTCACTGACAGCCCCTCGGATAATGCCATCTTTTTTTCA
TAGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCTGTGGGCTGCAACGTTGATGGTC
GCCACCCTCATGATGTCATCGATGACATCAACAATGGTGCTGTGGAATGCCCAGCTGTAA
GTGGCTTCTACATCAGTTTTGTTTGTTTAAAATCAAGGCAAAAGCTGGAGGGAAACTAAC
ATTTTCATGGAGATAAGCTAGAAAGTTCTAGAAATGGTCAGTAGTGGGGTCAGATGATAA
GGATTTCTAGTCCCGTTAACTGATGTCTCTTTTTTCTTTCCCACAGAGTTAAGACTTGGT
GAGGACAGTACTTCAATAAAGGATCACCTGACAACCAATGGGCTTTTGGATGTGGCCTCT
TTCTTGGAGGAGCTAGCTCCTTTGTGGTCAAATGGTGGTCAGGTGGCCAGTGGGCACCTG
TGGAAGTAGCTATCTGGGGAGCAAGCTCATTGTGGGTAACAGATTTCTGCCCTGTATGAG
CCTGGCTCAGAAGACACCTAGGAAGGAAGTTCAGTGCTTTTTCCCCGAGCTCCTCCTAAG
AAAAAATTGTTGGCTGGGAAGAAAACTTGTAGTTGAGCATGGCTACACAGGGAGGAAGCT
CCGCCCCAACCAGTTGAATCATTTGGTGGGTTGGGGGCCCATGGCCTGCAAGACTTCACC
ACAGCCAAGGTTCAGAACCACTGATGGACAACAAAGGAACCTGACCTTGATGTTGGAGTC
GTTAACAGATCCAAGTTACTGTGAAAGTTGGAAGGTCAAGTCAGTTGAGTTGTGGGATTC
CTGGCCCCACTGTTCTCCAACCATATTTGCTTTAAGCCAGTAACAGGCTATTTCCTAATG
TGTTTTCACCTCTCCCAAGTCTCTTCCTCAGCTTCTCTTAGCGCGGTTCCTTTGGACTCA
ACTTTCTAGAGCTCATCACTTCTTTGACATTAGTAGACAATATGCAGTGAAGGAAGCCGT
GAACTGCGAGACCTCTGGGTGCTGGGATAGGCCACACCTGGGTTGTATGAAGCACCACCT
GGGAGGGGCTTCAGGGTCCTGACTAAAGGGAGTTGGGAATGATGAACCCAGGAACCTCAC
TTCCCTGGCATTAGTCACTGTGCTTTGCCATGAATTTTGTCAGTAGTCCCTTTAAGCAAG
AGTATTTCATCACCCCAGGTGCCTTCACGGTTGGAGCACTACCTTGAGCAGAAACTTGGG
ACTGGGGGGTGGGGGGTGGGGCAGTAGCAGCAGCAATCTGGGACATGTGGCAAGTCACCA
AGGACCAATCAATCAGCTAGAGGCCTTAGGCGATGACAGCTGAAGGCACAACCAGCTTCC
CTTAGAGCAGGCCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 1869..1942, 3000..3098, 3411..3492, 4087..4173, 4563..4675, 4846..4895
1087..1123, 1869..1942, 3000..3098, 3411..3492, 4087..4173, 4563..4675, 4846..4848
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved