Equus_caballus Locus RC3H2
snOPY snoRNA Orthological Gene Database
Equus_caballus RC3H2
Equus_caballus
RC3H2
25
SNORD90
26669..26779
49135
CCATATGTCTTCTAATTTGTGGTGGCTTTACTTCTGTAGATGCTTTTGTTGGACATCTG
GTTTCACCTTGGAAAGTGCGTTGAGTTTAATTACAATTTGTGGCCATTTTCTTAATCTGT
GTTTTTCAGTTTCTCATCAGTCACAAAGCATACATACTATTTTCCTTTTAGGATTATTTT
GATGAGCAAACAAAATATAATAAGACCTGGCACATAGTGAATAACCCATAAATGTTAGTT
CCCTTTTTCCTATTCCCAGTCTGTTTCGTCATTTATAAAAACAAGAATAATTTCTACCTC
TCAAAGTGTTACTGTGAAAAGCCCTTCAACAAATATTTATTGAGATATTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGAGGGGGGGGCTACTA
CGCTTCTTTTCCACCTCCTCCACTCCCCGGTCTTCGGTGGTCTCGCGTGAAGTTGGGGAG
TTATCTTCTCCGGAGAGCTAGGTCGGGTCCTCTCCAGTTCCCGCTCCCTTTGACAAGAAG
AAGAAGCCGCAAGAAGCCGATGAAGAAGAGAAGTCCCCGCCGCGCACTTCGCCGCCGCCA
ACGGGGCTGTCCCTGTAGCTCTCCGATGGAGTTTGAGGGTCGTGAAAACGCCCGCCGAGC
TCTGCCCCGGCGAGAACAAGTGCCTCCGTTTCGAAACGCGCCGTCGCGGGGCTCCCGGGA
GCGGCCCTTAGCGACCCCGCCCGGGCCCCCTCAGGTAGGGCGGGGGCGGGCACGATGCGG
CTGGGGCCCCAGCCTGGGTCCTTGGTCCCCGGTGGTCGGGCGGGAGACCGGTCTCAGCCC
GGGGCCTGTGCGCTGTGGTCGCCGGTGCCCCGAGGTTGGGAACTAAGGGCCGCACCTGAC
GCCCAGAGTCCGGGGCCTGAGGAGGCCCCTTGCCCTGCCTGGTAGGGCTTTTTCAATACC
GAGCGCAAGGCGCAAATGGCCACCTCCCTTCGACACCAGCCGAGGGGAAGCCTCTGACCC
CTAAGGAACCCACCCAAGCTGAGGCCAGGCTTCCATCTCCCTTTCCTACACCAGTTAGTA
AGGGGGTTTAGAGGAGGTCCTCGAACCAAGTCCTCTCCTAGCTTTTCGGCTTTCTGCCCT
GGGGCTTCCCGATATCCTAGTGTAGGGATGGTGAAGGCGATCTGAGTGGTAAATAGGAAC
CCCGGCCAAACAATGCCTTGGGAGGGCTTAACCTCCTGGGAGGGAGATGGCCGGACCACA
GGGGTTGTACAGTAGATGTGACGGAGCAATGGCATGAAACACAGCCAGGGAATTCTGATA
TGGCTTTCTTCTTTCCCGCTTTCATTTTTCCTTCTTGGGGAAGCCTCTTAAGGAGACTCT
TCCACCATCTTAGAAGAATGGTAGAAAGCATCTTTGTTTCTCAAAGAAGCAGCTCTACTT
CTCTCTGTCCTTAGCTTTCAGGAAGAGAGAAGATGAGAGTAGCTGTCATTTCTATCCTTC
GAATCACAGAAGAGTTTAAGATACCGGCAGATAGAATCTTGACACCAAAATAGTCTCAAG
TAATCACTGACATAAAGTAGATCTAATCCCGTGATTCCCAACCTTTTTTTTTTTAATAAC
CACCTAGGTTCCGTTTTTTTAATTCCTACTCTCCCCTTACCTAGCTACCTCCTTTTTTAT
TCCTACTCTCCTCCCACCCACTGATAGAATGACTTTGTGTCCCAAATAAAGTGCTTAAGT
AATCTTTTTTTACATTTTTGCATGTCACACTTTTAAGTTCCAATAGGAACTTTTGATTAA
CCTGACAGAGTTAATGTTCCTGCGCGAAATTGATTTAATTTCACCCAGAAACAAAGAAAC
AAATGTTTTAGTTAGCCTCTGCAACCTTTTTGTAGTTAAATACACAAATTTAGTTAAGGC
TTCATGAAACATTAAGAAGAATTCATGGATTCTCCTATTATTACCTTCTTTTATCTGTCT
GAAAAGCTACTGTCCTAACATAACATCCCTTTCTTAGGTGGTTTACTTCCACATTCAGTT
CTTGAAGAAGTAGAGGCCATACATCCTGTGAAAGACCATTTTTCCATATTGCCATTTTTT
GTTGTTGTTGACTTGGAGATTCATGTTTTCCAAACTTTAGTTTGGAAAATTGTTAGAAGG
CCAAAATGTTAAACATATATTCCAGACATGTTTAGAAAAAGCGGATGTTATAATTCAAAC
TGGCTCCTGTTCTTTGAGGATTTAATTGCAGTCATGTTTATTAGTGGATGCTTTGAGTTA
CTTCTGATCTGTTACTGCTCTTGTGTTAACCTGACATGTAGGAAGACTTATGTCCTTTGT
TTATATGTTTTCATTAATTCACTTTTTACTTTTGTCATTTGGTGTGTCTTCCAGTTTGAA
AAAGTTAATAAAAATTCTTTTTTTGGAAAGCATTTTTCTTTACACAGAATTTCATATTTA
GAAATAGAACTTTTACATTGTGTGCAATATGCAAGAATGCTAAAAAAAAACATAATAAGA
TCTTATTATAATAAGTACTTATTGTTTTGGTTGGACTGGGTTGAAGTTTCACTTTCTATT
GGTGGAAAAAAGAAGTATGTGGTAAAGTAAAGCTAGGTGAAAATTAAAAATAATATTTTG
ACCCAGTCTCATAAATGTTCTAAGTTACATCTTTATGATCCTTTATGCAAGTTTTCTAGT
TTTATGAGAACTTTCTTAACTGTAGGTGTGACTTTCACCCCAAATTCTTATTAAAAGTTA
GTTTTGAGTATTACTTTATAATTTAAAGTATTCTGGAGTTGCACTGTCCAATAGTAACCT
ATAGCCACATCTGGCAGTCAGGCACTTGAAATGTGGTTAGTGTGAGTTGAGATGTGCTTT
AAGTGTAAAATACACACCAGATTTTTAAGACTTAGTACAAAAAAAAAAGAATTTAAAATA
TCTCAATAATTTTTATATTGATTACATATTGCAATGATATTTTGGCTAAATTGGGTTAAA
TTTAATATTAAAGTTAATTTCACCTCTTTTTCCCTTTTTTAACATGACTACTAGAAAATT
TTAAATTACTTCTTGCTCTCATTATATTCTTATTGGACAGCGCTGTTCTAGAGCATCACT
ACTCTTCCAAGAAATAAATTATCCGAATAAAAGTAGACACATGAAAACAGAAAATTTGCT
GACAGAGTATCCTCTTTACAATCAGGATAATCAAAAGGCTAAGGACTTTGGTAGTATGAA
GGATAAGGTTATCCAGTGGCCATTATTTAATAGGCAGAGTGAGCAAGTTCTGTCTCAAAA
ATGAGTATTTTTCAAGTCTGGTCATTGCTAAAGAATCAAAACTTTATTGGTTATATTAAT
ATAGAAGATTATGCCATTACTGCTCCATTAGAAGACATTAAATGTTAAATCTCATACTTA
TTTAAGAAACTGAGTGCAGTCCCATTGTGGATTTAAGAAGTAAAACTTGAGTCATGTATC
TTTCCTAATTTATACTAAAGTTATGTATAATAGCAATCTTTAACATTGTTAATTCAATTC
CTTTCTCTCCAACCCTTTTTCTATGTTTGAATGCTGAGTTTTAGAGCTTACAGATTATTT
CCATTGGTTTTGTTTGTTTGTTTATAGGTTAAGATCTAAATTGTGCCTGCGATACTTTAA
ATATAATTTTTTGAGTCCAAAACATTATTTTTAAAGTTTCTGAATTGAGAAGTACTGTTA
CAGTCCATTTCAGCAGCTTGAATTCCTCACTAGGTGAACTAGAATAAAAACAATGAATGT
TCTAATTAGTAGAACTGAGCCCTAATGTTTACCTCTTTATAAAAAGAATTGTAATATGCT
ATTTTTTTTATTATATAGTAATGAAAGAGGCATGAACTTTATTCTCACATCTTAAAATCA
GGTGTCATAGTCCTGAACTGTCTTCATAAGATCATGGTGGACTAATAACAGAAAATGAAA
GTACTTAGCTGATATGCAGTTTGCTCTTAATAAAGCAGTTTGTAATTTGCATCATATGAG
AGATGTCTATTACTCTTCCTATTTTATGAGTTAGTATTCATAGCAAGAAACTTACAGCCT
GAAAAAGTAATTGAGTAAAAATCTGTTTAAGGTCCCACCTCTAATTTAAGGTTTCTCACT
CCTATGCTTTATCTTGTTATCCTTCTTTAATTTTAGTGAATAGTAACTGAAATAAGTTAA
TATAAATAATTTAATTAGAATATTTTTCTTAAGTAGTTCCTTTATATATCTAGAGTTGTG
GGCTTTTTAATCTATTTTATCTCAATTTGAGATATTATGGGAATATCTTTAGGATGAATA
CTTTAGTATTAACTGTAAATATTATTGGCACTTTAGACTGCCGTAGATTCAAATAAGTTA
CTATGGAATGTATTAGCATAAATCTGGAAGTTTTACACATTAATATATATTCTTAGCTTG
CCATAGCTCATTTAAATGCTTTTTAAAATAAATTATAAAGACAGTAGGCTATATCATTTT
TGATAATTATAAAAATATTTTCTAGGTAAACGTTTACAAAGTGCCTTTTTGAAGGAATGA
AAGTCCAATTTTCTCATCACTAGTTAAACGTTTTAGTGGACTGTATAAGCTTCTGTGTTT
TAGATAAAATTTTATTTTGTCTTTAGCTTACTTGGGGATAGTGGTACTAAGGAAAAACGT
TGTAAAAAAATCAAACCATTCCTTACACCTTATTGTATAAGGAAAATTTAGTTTGTAGTT
TTCCTGTCACAAAGTTAGAATCTGACACATGGCAGAAGGAAAATTTGGCGGAGTTACTGC
CAAAAGTTTGGCAGAGTCTTTCTTTTTCTTTTAAAGGTATTAATTCAATTTCTGCTAGAA
ATTAAACTTCTCAGCATTAATTATATTAAAACATCTGATGTTCATAGACCTAGAAATACA
TATAGAATATTATGACATAAAACTATTAAGTGTATTCTGGAATAGTTTGAAACACTTCAA
AACTAATAAGTGAAAATATGAAAGAAAGCATTTTTATGTTTAGTTCAAACTTGAATGGTT
CCCCGCACTCCCCACTGATTAATGTAAAGCATTTCGGGATGTTTTTGGAAAAGTAAATAA
GAAAGTATTTGCTACTAGTCTCATATTACTCACTGGCCTGTGATACCCTAACCCACAGAA
TTAGCATTTCCACACAGGTGGCCATTATGAAAAGATAGATGCAGTGTCTTGTTTTAATGA
ATATTTTATAGGGTCACGTTATTAACTAAATTAGGGCTCTGAGTAGTAGATTTAAGATAA
AAATTCATTATTCCTCAGAGGCCTTTTCATTGTGTAATTCTGCAGCCTAGAAAAGTGAAC
ATTAAGAATGTTAAATAGAGGTCTGGCCCCGTGGCCCAGTGATTAAGTTCGAGAGCTCCG
CGGCAGGCGGCCCAGTGTTTCGTTGGTTCGAATCCTGGGCGCGGACATGGCACTGCTCAT
CAAACCACGCTGAGGCAGCGTCCCATATGCCACAACTAAAAGGACCCACAACGAAGAATA
TACAACTATGTACCAGGGAGCTTTGGGGAGCAAAAGGAAAAAAAAATCTTAAAAAAAAAA
ATGTTAAATAGTTTCAGGGAGCGATGTGTTCACTTGCTTAGTGCTTATCTCTATAAAGTT
GGAAGCAAACTAACTGGTTTTAAGATTAATGACATTAATAAATGTGGCAATGTGAGGATG
AACCGTGTAAAATAAAGTAAATATAACTTACAAGATTTGGCTAATTTAAAAATAAAGGTA
TTAGATACTTTGCATGAGAGCTGTTTGAGGGAAAGTTTGTATAGGGTGCTTTTTACGTAG
AAAGCCCTATAATTCAGTTTTACCAAGATATTTTTTTAAAACTTTAGTTTTTGTGAACAT
AAAAGCACAATAAAAGCTAAGGGAATTCTTCATTTGGATGTGGGGATATAGGAGACTCAG
TTACATACTTTTCTGTCCTGAATCTGACTACATTTTTAAACATCTAATTTCTGTGGAACT
AAAACATTTGGGTTAGTAAACATTCTCATGAAATAAAGTATTGGCTGTTTAATTGCCCTA
AATACCTAGATTTCTTGTTCACCAGAGAGCCTTTGTCAGACTTATATAAGTTTTGAATTG
GATGATATGGAAAATTTGTGAAATGTGGAGTGTTTAAGTTAGATATCTAAAGATTTTAAA
TTAGAGGACGATGTAGCTTTGATACTAAATATTTTATTTTACTAAAAATTATGGAACACA
CATTTTAATCTTAGGAATAAGAAAAGAAAATTCACTGTTATTTTCTCCATGTGCCTCTTA
ATCATATGCATATATAATTTTTCCCAAACTATAATCGTAGCAAAGAAATTTATTATTTTG
CTTTTTTTGTCTAATTAGAATTATTAGATGAGGATGTGTTGTATTCTTCTATATCTTGCT
CATTGGACCTGACAGTTTTTGCTTATATATATATATATATGTATATATATATATCACTAA
ATGATATAGTTTGTCTAAAGTGTTATGGGGGGCTGTCCCCGTGGCCGAGTGGTTAAGTTC
GAGCGCTCCACTTCTGCAGCCCGGGGTTTCACTGGTTCGGATCCTGGGCGTGGACGTGGC
ACCGCTCATCAGGCCCTGCTGAGGTGGTGTCCCACGTAGCACAACCAGAGGCGCTCACAA
TTACAGTATACAGCCATGTACTGGGGGGGCTTTGGGGAGAAGAATAAAAAAAAAAGAAGA
TGGGCAACAGTTGTTAGCTCAGGTGTGAATCTTTAAAAAAAAAAAAAGTATTGTAGGGAA
CCACATTCAAGATTTGTAAGACAATATTTTCTTTTTTTTACTTTTCATTGTCTGTTAAGG
TCAGCATCATTCTTTCATTTATGGACAAACAGCTCTGTGGTCACAATCTTCCCCTATACT
GTGGTTTTTGGTACCTTAGTTAGCCTCCTAGTCAAGTCATGACCAGAGATTTCCTCTTTT
GTGAAGCTGCCAAGTTGAACATATCCTTGACTGACTTGGTCATTCAGGTGGCAACCTGTT
TCTTCATACTTGACTCACTACAATATTGTTTGGATCAATAGTTTCCAAATAGTTTCACCT
CTTAGGCTATACCTTAATATGTTTTGGGTAGTAGATATCTAAGGGAAACGCTTCAAAAAA
AAAAAGCAGCAATCCAAAGTGATTTGTCTTCTTAAAAATGAAATGGGCAAGTTAATCTGC
TTATTTGATAGGATCTTTAAGAAAAATACTTGAAAGCTTTGATGACTGTTATATGAGCAA
CTGATATAAATATGTTTAGTTGAAAGGAACACTATTAAGATACTGTTTCTGGACAAAATT
TCGAAAATCTAATTCAGGAAATAAATTTATAGAAAAAGACATCTGAAGAATATAAAATTA
TTCAGAAGCATTTTAAGTTTTGAAACTGTGATGTTTAACTTTATGAATTAACCCTTGAAA
GGTGAATGATGAATATGTGGTTAATTCTTACTTTTGTCCATTTCCAGCTTACAAAACACT
ACACAGCAAAATAATGATCTGCTAGACTGCTAACCCGAGCATCCAGCTTCCACAATGCCT
GTGCAGGCAGCTCAGTGGACAGAATTTCTGTCCTGTCCAATCTGCTATAATGAATTTGAT
GAGAATGTGCACAAACCCATCAGTTTAGGTTGTTCACACACTGTTTGCAAGACCTGCTTG
AATAAACTTCACCGAAAAGCTTGTCCTTTTGACCAGACTGCCATCAACACAGACATTGAT
GTGCTTCCTGTCAACTTTGCACTTCTCCAGTTAGTCGGAGCCCAGGTAAGCTTTCAAGAT
TTTACTAATTTGGTATATGTAATAATTATAGAACTTTGTTCCTTACGAGGTACAAAGTAT
GTCTAGTGATATTTGAGACATTAAAAGTATTTAGTGTACCTGATTTTCATGATTGTATTC
TGCAAAAGATTTTCTTTAGATTATGTCATAAATCCTTATGCAAAACCGTAAATTCTATTA
TAGTTATGTATTTGTGTTCAATGCTGTGGCCAAAATTTATATTTATTAATGATTTTGGTG
GATTAGAAACATTCTTATGTAGCATACATAAATATTTATTCATTAGGTATTACAAAAAGA
AATGTAATCAAAGCTTTGACCAGAAGTCAACCAACTAGAACTCTCAAATGGAGATTTTTT
TGGTTTTCTTTTTAACTTCACTTGACTTTTAGGATAATATTATAAATGAGAAAATAAGAT
CTGTTTGGGGATGTATATATAGAAAACAAATTTTCAGAGTGTCAGTAAGAAATTCCACAG
AGTTTTTTATGCTCAAGTACTAGAAAATTATTAATATTTCTTGTTTGTAATCATCTTACT
AAATCAGAACAACACCCTAGATTTATAATAATTTCCATTTAATGAGTGCTGACTTTATGT
TAGGTATGATAGTAAGCATTCAACATCTATTATTGCTAATTCTTACCATAGTTCTTCAGG
TAGTTGTTATCCCCATTTTACAGGTGAGAAAGAAGATGAAATTCTGTACATGATGCACTA
CATATTAAGCAAGAAAGTAAGGATTTTTCTGATTAATCACTTCTTAGAAAATTCAGTGGA
TTCAAATACTCCATTCCTTTAGTATCTTGATATTTAAAGTTTTCCTTTTAAAGCACATTT
CAATGTTTATAGTCCAGTTAGACACTCTGAAATCAAGATGTGTCTACAGTAAGTCGTGTG
TCATGATTTAATTGGCAGCATTTTTTTTCATAATGGTTCCTCTTGCAAACAGTGGCATCT
TAGATCCAATAAAATAATGCAGACTTTTTGTAATAATGCTAGCTACAGTCTGTTTAGCGT
CTGCTATAGGTCAGATATTGTGTTTGTTTTTTATAAATCTTCTCTCTCTGTTGGTCCTTG
AAATAGTCTGCATACAGTGTGACTTCTGTTACTTTTCCAGCTTCACCTCCTACCATTGTC
CTCACTCTTTTCTGCTTAAGCCATACTGGCCTCCTAGCCAATTTTCCGACATGCCAAACA
TGTTCCCACCTGAGGGCTTTTGTAGTGACCATTATCTTCGCCTAGAATACTCATTCCCTC
TCCTCTTTCAGGTCTTTATTCAGATATCCTGATTCCCAGGAAAGCCTGTCCTGACCACCC
CTGTTAAAATTGCAGACCCTCTCCAGCACTACTGATCCTCCTTATCCTTGCTGTGTAATT
TTACTGATCACCTTCTATCATACTGTATGTTTACTTACTATGTGTTTTTATTTATTGGCT
GCCTCCTCTCTTCTCCACTAGAATGTGAGCTCCATAAGGGCAAGAAATTTTGTCTGTTTT
GCTCACTGTTAGATGCCTATTGCCTAAAACCATGGTTGGCATCTGGTAAGCACTCCATAA
AAATAAATATTTTTTGAATTAAATTGAATTTTCATAATCGCCCTATGAAATAGGGATTTT
CATCTTCATTTTGCAGATTGGGAAACCATGATTTAGAGCAGTTAAACAGTTTATTCAAGA
TCACTCATAGAAGTGGCAGAGCTGCAGTTTATACCCAAGTTTTGACCTTTTGTTGAGAAC
ACAGTGTTTTGTGGTGCTTATGATTCTAGCAAGGGGAGACAGACCATAAACAATAAATAT
CATAAGTAAATCATATAGTAAGAAGATGCTAAGGGGAAAAAATTTTGCCTCTTTTCCTGC
GTTTTTTTTTTTGGGCTGAGGAAGATTTGCCCTGAGCTAACATCCATTGCCAGTCCTTCT
CTTTCTTTTTTGTTTGAGGAAAATTAGCCCTGAACTGACATCTGTGCCGATCTTCCTCTA
TTTTTTTTTTTTTTCTCTAGTACGTGGGACACATCCACAGTGTGGTTGGTGAGTGGAGTA
GGTCCACGCCCGGGATCTGAACCCATAAACCCGGGCTGCTGAAGCAGAGTCTGCACAACT
TTAACCACTCGGCCCCTGGGCTGGGTCCTCTTTTTCTCCTAGTTTTTATTTTAAAATGCT
TTTAGAAAAAGTTGCAAAAAGTAGTATACAGAGAATCTGTGTAACTTTCTGCAGCTTCCC
TTAATGTTAACACCTTTAAAAATCATAGTATAGTCACCATCCCAAGAAATTAATATAATA
CTATTAACTACCTCCTTGTTTTTTCCATTCATTAATCTACCCAGCCCCTGCTATTAAGTA
TGATCGCCTTGGTTCTGAGAAAGCAGTTTAGCTAGGTGTTTGGCTTTAATTTTACTTAAA
ATACTTTAATGTATTATCTCTGTGTTATAATTTTTACTCACCAAGATTATTATCAGGTAT
ACAAATAACAGTTGCATGAGCGGGATGAATGTATTTCTTCATTTTTTCTTTGTTTTTAGG
TACCAGATCATCAGTCAATAAAGTTAAGTAATCTAGGTGAGAACAAACACTATGAGGTTG
CAAAGAAATGTGTTGAGGATTTGGCACTCTACTTAAAACCACTAAGTGGAGGTAAAGGTA
AGTTCATAAAAAGTGTGTTACTGGTGAGTAGGACTTGGTAATACATTTACGTTGAAAGAC
TTGGTATTAATACCCTATTAAATAATTTTAAGTTTTGAAAATAAGTTTGGTTGAAGAGAT
CTTGGGAAACTTTTTCTTTTTTTTAAAGATTGGTACCTGAGCTAACAACCGTTGCCAATC
TTTTTTTTTTTTTCACTGCTTTTTTCTCCTCATATCCCCCCAGTATATAGTTGTATATTT
TAGTTGTGGGTCCTTCTAGTTGTGGTATGTGGGATGCCACCTCAACATGGCTTGACGAGT
GGTGCCATGTCCACATCAGGATCTGAACCAGCAAAACCCTGGGCCGCCAAAGCCGAGTGA
GAGAACTTAACCATTCGGCCATGAGGCTGGCCCCTTGGGAAACTTTTTGATTGAGAAAAT
TTGTTATACTATTTTCTGAAAATAACTGATATTGTTAATAATTTAAGAATTCCTCAGATA
CATTTATATTTGTTGATTAATAGCGTTATATCAGAATATTAGTTTTGATAAGTTCTAAGA
CAGTTTCATGTATTCATGTATAATTCAATCATTTATTAACTTTTATTGAGTTGTTTTTTT
TTTTTGAGGAAGATTAGCCCTGAGCTAACTTCTGCTGCCAGTCCTCCTCATTTTGCTGAG
GAAGACTGGCCCTGAGCTAACATCTGTGCCCATCATCCTCTACTTTATATGTGGGACGCC
TAGCACAGCATGGCTTGCCAAGAGGTGCCATGTCCACATTCAGGATCCAAACCGGCAAAG
CCCAGGCTGCCAAAGCGGAACATGCGAACTTAACTGCTACGCTACTGGGCTGGCCCCTAT
TGAGCTCTAATAGTGGTTAGGGTCCCTTCTTCCATGGAACCCACAGTCTGTTGGGGGAGG
TAGGCATACAAGTGCGATAAATTATTTTAAGTGCTATGACAGAAATAATTCTGTTTTGTT
TATCATTGCATACCCAGTGACTGGCACATCATAGATGTATTAAAAAGTTGAATGAGGGGC
TGGCCCTGTGGCCAAGTAGTTGGATTCGTGTGCTCCACTTTGGCAGCCCAGGGTTTCGCT
GGTTTGGATCCTGGGCACAGACATGGCACCCCTCATCAGGCCATTCTGAGTCAGCGTCAC
ACATAGCACAACAAGAAGGACTCACAACTAGAATATACAACTATGTAGTGGGAGCCTTTG
GGGAGAAAAAGAAGAAAAGAAAAAAGAAGATTTGCAACAGATGTTAGCTGAGGTGCCAAT
CTTTTAAAAAAAAAACGTTGAGTGAATGAATCAGTCAAGTATTTATTTTGTACCTGCTCT
GTGCTTTTCACTGTTGGATATTTTAGACATAGTGATTTCCTTGAGAAACTTACCCTGTCT
ACCACATTTGTTCATTCATTCATTGAACACATCTCTAAAGAATATGTACTATTTTGGTAC
TTTGGATACATTAGTAAAAATGCCTGTCCTCATACCATTTATGTTTTGGAAAAGGGAGAA
AGTCTAATAAACAAGTATAATAAAAAATAAAATTATATAGTATGTTATAAATGAAACTTG
GAAAGAAAACAATACATTTAGAGGGATCAGAAATGTCATGGTGAGGGGAGATGGGTAGGT
TGCAATTTTATTTTATTTTATTGATTAATTTATTGAAATACAATTGACATAGAGGTTAAA
TATGGTGATTAATGTAGGCCTCATTGAGAAGGTAGCTTTTGAACTTGAAGTGAGATGAAA
GAGGTCAGGTAGTTAGCCATGTAGGTTCTAGGGAGAAGTCTGTTCCAGGCAGAAGGAATA
GCAAAGTCCTCAAGGCATGCCTGGTATCTTCAAAGAACAACAATAGGAGAGTGTGCTGGA
GCAGTATGAGTAAAGGGGAGAGCTGTATGAAATAGATGAAAAGAAATGGTGAGGCCAGAT
GATGCACAGATTTACAGGACATTTTAAAGACTTGAGTTTTTACTCTGACTGAAATTGGAC
AATCACTCTAGGGTTTGGAGCAGAGAAGTGATACAGTCTGACTAATATTAAAAGGATCAC
TCTAGCTGCTCTCTTGAGAATTCAGGATAGAAGGGCAAGGGTAGAAGCAGGTTATCACTT
AATAGGCTGATGGAACAAGGTTAGTAGCAGTGGAGGTAGTGAGAAGTGGGTAGTCTGGGT
ATATTTTGAAGGCAGAGTCAAGAGGATTTCCTACATTATTGTATGTGGGGTATGAGAGAA
AGAGCAGTGTCAAGTAAGACTCCTGGGTTTTTGGACCTGAGCACTAAGAAAGAGGTTGCC
ATCTGTTTAGACAGAGAATACAGCAGGTAGATCAGTTTAGGTAGGAAGATCAGGAGTTCA
ATTTTGGCATGTGAAGTTTGAGATGTCAGATCTTCACTTGGATGCTACTGAGTAATCAGT
GCATATATGTTAAGGAATGAGGTATAGGAGCTCTAACTGGGAGTCATTGATGTATAGATA
GTATATAAAGCAATACAACTGGATGAGATCACCTAAGTAGTGAGTGTAGATAGAAAAGAA
AACAAAAACTGGGTTTTCAGGCCCTTTAACAGAAAGAAAAGATGAAGTCAGAAAGAGAAA
AGATGAAATCAGCAAAGAAGACTGGAAAAAAAGGAGAAGGAAGGAAGAAAACCAAGAGAA
TAGGGTTTTCTGGAAGGCAGGTATTTAGAGGAGTTAGGGGTGATCACCTGTGTTGAGTGC
TGTTGAGAGGTCAGGGAAGATAAAGACTGAGAATTGACCATTGATTTAGCAAAGTAGAGA
CAGTTGTCATGACAAGAGCAGGTTTGTTCAGTGATAGTGGCAAAACGTTGGAGTAGGTTT
TAAAGATTGTGAAGCAAAGAATTAGAGATAGTGAATAGATACAACACTAGAGGATTTGCT
ACAAAAGGGAGGAAAGAAATGGAGCAGAGCTGGTAGGGGAAGAGATTTCAATAAAAAGAT
TTATTTATTTTTAAGGTGAGTGAAGTAACAGCATGCTTGTTTTTATTGTATGCTGATGGA
AGCGATCAAATAAAAAGGGAAAAATTGATGATGTCGGGGAGAGGGGAGGGTTGCTGGAGC
AATATCATTGTGTCAGGAAAAAGGAAATAGGATCTAAGATCTTGCCATTAAGCAGTGTTA
TCAAATGCCTTGTATACAATAAAAAACAATTAGAGCTGTTATTGATGATTATTTTTAGAT
TAAACTTTATTCATTCAACTTTAAATTTACTTTCATAGTTTTAGTGAACATGGAGAATAG
ACTAAATAATACTCTCTTTTGGGGGACACATACAACCCAGGAATAGGATGCCTGACTAAA
ATTTGAAGTAACTAAAAATTAGGCTCCTCTTACTACAGAGCAGTAATAAACAGACAAAAT
GCTCATTATTAAAAAAATGAAAGTACCTTATGAGAACTCATTAGGAATTGTTGCTTAATA
GTTAAATACAGATAATAAAAATTGACTTGTCTTTTTTAATTGAAAAAAACATTAGTTTCC
TTTGGTTCCTTTTTCCTAAAGGTGTAGCTAGTTTGAACCAGAGTGCACTGAGCCGTCCAA
TGCAAAGGAAACTGGTGACACTTGTAAACTGTCAACTGGTGGAGGAAGAAGGTCGTGTGA
GAGCCATGCGAGCAGCCCGCTCACTTGGAGAAAGAACTGTAACGGAACTAATATTACAGC
ACCAGAACCCTCAGCAATTGTCTGCCAACCTATGGGCTGCTGTCAGGGCTCGAGGATGCC
AGTTTCTAGGGCCAGGTAAGATAAAACACTATCTTGCCTTTCTTACTGGCTGTCAGGGCT
AGAGGATGCCATTTCCTAAAGGAAGGTGAGACTCCCCAGACTCAACTTAGCATAATTAAA
AATAAACCAGTTTTTGTTGATCATAATTGATGTGATAGTGTGGTAATGTTTTACAATAAA
TTTCTTATTTAATCCTCAGTGACCTTGAAGAGAGGTGACACAGATCCAATTTTACAAATT
ATAAAACTGAGTTAGAGAGAGGCCTAAGATTACACAGGTAGTAAGTAAAGGTAAAGTAAA
CTTTTTTTATGAAAAAAATCAAAAATTCTTGATCGGCACGCTCCACTTCAGTGGCCTGGC
TTCAGTTCCCCGGTGTGGAGCCGCACCACTCGTCTGTCAGTAGCCGTGCTCTGGCAGTGG
CTCACGTGGAAGAACAAGAACTTAAAACTGTACTCAACTGGTTCAACTATGTACTTTGCA
GGGGGAAAAGGAGGAAAAAGGAAGGAGGAAGATTGGCAACAGATGTTAGCTTAGGGCGAA
TTTTCCCCTGGAAAAAAAGAAGATAGTGTTTCTCATATTAAGAGACATATACATTAAAAT
TATACTGAAATAACCATTTCTCACCTATCAGATTGGCAGACTCCGAAAGTTTGACAGTGT
ATTCTGTTGTCAAGGCCGTGGGAAAACATGTACTTTCATCTAGTAATGATGGGAATGCAA
AGTAGTATAAACTCTAAAGAGGAATTTGGCAATAGCTAGCAAAATCATCTGTGTATTTAC
CCTTTGGCTCAACAGTCCCATTTCTAGGAATCTATCCCAAAGATGTAGCAAATAGTACAA
AATGCATAAAGTTATAAAGCACTATTTGTAACAGTAAACATCTGGAAGCAACTTGGGTGT
CTATGAATAAGAGACTGGTTTAATAAACTGGTATATCCTTCCAATGGAGTTACTACGCAG
CTGTTGAAAGGAATGAGGAAGATGTATATATTCTGGTAAAGTGTGATCTCTAGATACATT
AAGTTAGAAAATAAAAGAGAGGTGCAGAATACTGTGTTTATTATAGTATCTTTTATCTAA
GAAAGGGAGAGAGATACAACCATTATCTACTTATTTCTTCATATTTTCCAAAAGAAACAA
TCGTAGGAAAAATAAGCAATAAACTTATGTAGAGGAGGGAGGAACCCAGAGAAAGCAGAC
AGGGACAAAAGCTAGACCTGGCTGAATGCACCTTGTTTTGGACCCATGTAAATGCCTTAT
TTAATTATAAAACAATTTTTAGTAAAAATAAATAATTAAAAATTTAAATAAAATGGATAA
AACAAAACATTAGCAAGTTGGTAGCATGTTCATTGAAATGAATTACTTAAGGTGACTTTA
GAACACAGTATTTTGATTTTTATATCCCTAGTGGGATGTATAATCCTAAATTGTATTTGC
TATTCATATTGTTCAATATTTCATTGGTATTGTTATTTTGAAACTATTACACAGACACAT
AGTAGGATAAAGCAAGTAAGCAATTATGTTAATGCCGTTAGGAACCAAGATTTTCAGCAT
TTAATAAAAAAGATACAAGTATGAAATAATTTATGTGAAAACCCTGCAGTCTTAATTTTG
AATTGCCAATATCAGTATAGACTCATTTACTTTTCTTTTTCTAAAAGAAAGCCTGTTTCC
TAGATCTCTCCACTGAAGAGGCTAAGAAGCAGTGAATAGCCTTAGCACCCAGATTGTGGC
CTTTAATAAAGGGTGTTGAAGGTATCCTCTTTTAGCAGAACTCCAGCTAATAAATTTAGG
AAAAAAAATTAAAATTAGAAAAATCACAAATTGCAACCTCAAATGAATTAATGGGTCAAG
GCAGCAATTATTGTGAGTATTAAAACCATTAGATGAAAGGTTGCTGGGAGAATTTATAAT
AGATGAGTAAGGCCTGAACTTATCCCCTAATCAACCATAACATTATAATAGTGAGACAAC
TAGGCCTTATATTTCTCTTGATTTTGATACATGGAATAAGTATGCTTGGCAAACACAAAA
CAAAACCTCATTCTGAATCTACCCAAGCCCTCTAGTTTACATGAAATAGGGAGATAAAGG
AACACATTTAAAAACACTGCAAGCACAAAATTAGCCAAATCAAGAATGTGGGAAATTGGA
AAATGATTGTTTCTTCAACAGATAACTGGATTTCCTTTTAAATGGGAGGGGGTTGATAAA
GGGGAGCTAGTGTAGATTTTTTTTTAAATCCTGAAGACATATCAACCAATAGCAGTGTAT
GGACTTTTTTGGATATTTACTCAAAGAAACCAACTATATAAAGAAATCTTCTGAGACAAT
GGAAGAAAATTCAACATGGACTGGATGTTAGATGATATTAAGGAAATATATTACTTTTTA
TAGATGTGATAATGGTGTTGGGGGAAAAAAAGGCCTTACATGTTAGAAGTTCATGATGAA
TTATTTAAGGGTGACGTGCTGTGTTGTCTGGGATTTACTTCAAAAACACTCCAGCCAAAG
CAAACTAGGGAATTGGGTAAAGAATAGGTGAAATCCTACTGGCAAAAGCTGTGTTATGGG
TACATGTTATCTCTATTTTTGTGTATGTTTAAATTTTTTATAATACAAAGTTAAATTGAA
AAATAATTTTAAAAATTCACATTTATATATAAGTTAAGAATGCTACTTTTCAATATTTCC
TCATGTTTATTTATCTTACCTAAGAAGCACTAGGCTAGGTGTCAAATGTCGTTTGTTCTA
CAACTCAACGATGAAAAGATAAATGACCCAATTGAAAAATGGGCCAAGGGCTTAAATAGA
CGTTTCTCCAAAGAAGATAAACAGATGGCCAAAAACCACACGAAAAGATACTCAGCATCA
TTAGTCATTAAGGAAATGCAAATCAAAATCATAACGAGATACCACTTCACACCCACTGGG
TTTGCCGTAATTTTAAAAATGGAAAATAAAAAGTGTTGACAAAGTTTTAGAGAACTTGGG
AATGTTAAATGGTGCAGCCTCTGTGGAAAAGAATTTGACAGTTCCTCAAAAAGTTAAACA
TAGAATTACCATATGACCCAGCAGTTCCACTCTTAGGTATGTACCCAAAAGAGTAGAAAA
CAGGTATTCAAACTAATACTTAGACACAAATGTTTATAGCAGCATTATTCACAATAGGTC
AGAAGGTGGAAACAATCCAGATGTCCATCAACTGATGATAAACAAAATGTGGTCTATCCA
TAAATAAAATATGGTTCATCCATAAAAAGGAGTGAAATACTGATACATGCTACAATGTGG
ATGAACCTTGAAAACACTATATTAAATGAAAGAAGCCAGACAAAAGGTCACATATTCTAT
GATTCCATTTATGTGAAGCATCCACAAAGGTAAATCCATAGAGCTAGACATCAGACTAGT
GATTGCCAGAGTCTGGGGGTAGAGGGTATGGAGAGTGACTGCTTAATGGCTATAGGGTTC
CTTTGAGGTGATGAAAATGTCTTAGAACTAGATGGAGTTGATGATTGTACAACATTATGA
ATTGTATAATTTAAAATGGTTAATTTTACGTTATGTGAATTTTACCTCAATTGAAAAATA
AAAAGTCCTTGGTTCTAGTTACAGTTTTGCTGCTAACCAGTTGTGAACCTTGGCCTTGTC
GCTTAGCTTCTCTGGGCCTCAGTGCCTCACTTGGACAAAAAGGGGTTTGATTTTTAATGT
AGGTTGTGGATGATCTCTCAGCTCTATAGTTTCATTATTTTAATTGAGAGCCAATGTATT
TTTAACTTTTAATTTTGAAATAATTTCAAATTTATCAGAGTTGCAATAATAAGGCAGAGA
ATTTCCTATATACTCTTTATCTATGTTTATTAATATTTAATATTTTGCTATATTATATTA
CTCTTTCTCTTTTTTCAACCATTTGAGCATAGGTTGCATATTTCATCCCCTTAATACTTC
AGTGTGTTTCCTAACAACAAGGATACTATCTTACATAACACTACACTACATTCATCAAAT
TCAGAAAATATTGATAAAATACTAGAATCTATACTTTGTATACCAATTTTGACAATTATT
CCAAAAAAGTCTTTTATGGCATTTATTTTCTTCCAATATGTGATCCAGTCCAAGATCACT
TATTGAATTTATTTGTCACATCTCTATTTAAGTCTTGTGAATCTGGAACCGTCCCTCAGC
CTTTCTTTGTCTGACGTTGGTATACTTGAAGAATACGGGCCAGTTATTTTATAAAATATT
CTTTAATTTGGTTTTGTCTGAGGTTCCCTCATGATTAGATTCAGATTATATTATACATCT
CTGACTGGAAAACAACATAAATGAATACCTTCTTTAGGTATTGCATCCAGAGGCTAACTC
ATATCACTTTAAAATTATATACAAAATAGTTCTGACAGGCAAAGTAACAGTCTCGTGCAT
AAAAAAATTACCATTTTTCATAACACTCCTGTGTGTCTTTTACATATTATTTAATTGTTG
GGGTAGCTCTGTGTGTTTTATAAATGAGGACTTTTCATTTTAACATCATGATACAGTTGA
TTATTAAATATCTGCAGAAGATATTTTAAGTTCTGTTAACTTGTGTTCCCATCATTTGTT
TAGTAGGAATATGTTTTGTTTGATTACTTTTTAAGTGAAGTGTATTTGTGTATGTGTGAT
GTCCTTTTTTTGTGCCAGCTGAATACAAACTGGATAATGGACCACCATAAGCTAATACCC
AAAAACGTCTGTGACAGACATGATCTGCGGGTTCCTCATTTATTATAAACTCATGTTCCT
TACTTCTAGCTATGCAAGAAGAGGCCTTGAAGCTGGTGTTGCTGGCATTAGAAGATGGTT
CTGCTCTCTCAAGGAAAGTTCTGGTACTTTTTGTTGTGCAAAGACTAGAACCAAGATTTC
CTCAGGCATCAAAAACAAGTATTGGTCATGTTGTGCAACTACTGTATCGAGCTTCTTGTT
TTAAGGTAAGTAGCTAGCAACCATGTAAACATTACATGTGTGTGTGAGACCGCGGCTTCC
TAGAAGGGGTGTTACCCGGTCTAGAGGCCTAGAGATGCAGGATGCTTATGAGAGTTGGAA
GGAGACTTTTTTCCTTCTGCATTGATTGCTTCTGTGATACTACGTACTGGGAATAGGAAC
ACGTATGTGAAGGTGTCAGTAACACAAAGCAGAATATAGGGACATAATTTGGTAAACTTG
ACTCTTGGGATAGTAAAAGTAAAAAGAAGCCTAATTCAGTTCTATTTACCATCTTAAAAG
GGAATCAGGAACTATACTGAAAACTTCATACGAGTAAACAAATGTTTTAACTTCCCCATT
ATTATTTTTATCTCATTCTCTGTGGTGATTAGATTGAAGCCTTTAATCTGAAGGTGGCCT
ATATGTTGTTTTAGGGACAAAAAGGGAGTCAAAAGTTGAGGAGATTGCCCCATTCTGCAG
TCTGCAAAGCACCCTGGGTTTTTTTTTGTTTTGGGGGGTTTTTTTTGGTAGAGAGGTCAG
GGAAGAACCCCAAGATATTTAGAAATGTGGTTTCATTGTCTAATAACCTTGTGAATGGCA
ACAAGTACTGAGAGAAGAGGAAGGTAGGCTGAATACATGAAGTTTCTGCATGTTACAAGA
GTATAGGTTGCTGGCTGCATCTTAAGAAAGGCTTATCGACTTCTGTGAAAGTAGAGCATC
TAATTTGAAATCAAAGCTTATTTAGGTTATTTTGCTGGTTTTATAGACCCAAGAGTGAAA
ATAGTTCAGATAGAAAAAGGTTTTTCTGGTCAGACTGCTCACTTTGAGATAACAGGTAAT
TGATGATGGAAATATGTTCAAATGAGTTCACTTATCTCCACTAATGAGGCTTGGACACTA
TCTGCCTGATGTTATAGTGCTTGATTTTGTGTCTTTAGGGCAGCAATTGAAATGAATCTC
TGGGGGCTGGCCCAGTGACGTAGTGGTTAAGTTTGCACACTCCGCTTTGGCAGCCCAGGG
TTGACTGGTTTAGATCCCGGATGCAGGCCTACGCACCACTTACCGAGCCACACTGTGGCA
GGCATCCCACATATAAAATAGAGGAAGATGGGCACAGACATTAGCTCAGGGCTAATCTTC
CTCAACAACAACAAAAAGAAAAAAGAAAGAAAAAGAAATGCATCTCTGGTTCCTCAAACA
TTATGTTTTTGGCTAAGTAGCCAAATTACAGAGATCATTTATCATCCTGAAGTGACCAGC
TAGGTTCTCACACTGTATTACTGATTTAATGGGGTTTTTTCCTCAGAAGTATCATACTGA
TTTGTGGTTTATGATTGTCTTATATCTATAACTGCTACTAATATCTGACATTTGAGTAAC
ACTCATTTAGAAAGTGACTTTAATTTCGTGCTTTCATTTCATCCCCACTGCCCTGTCATT
TAACATGTTAAAGCAGTGTTTAGATTAATAAAAGGATATTATGCTGACTTAACTGCAAAA
TGGCCTCTCTTGGGTGGCATTTACTCTAGTAAACTCACCATTGTTAAAGGTCTTTTCCTT
TGACTTTATAAGCTTAGAGACCTGAATTTTGTGGGTGCCTTCAGTAGATTCTTTCCTCAG
GAACAGAATCACCCTAACCAAGGTCACATAAAACAGATTATCAGTTTTAGTAATTTGTAA
TGAGAAGTACAACTCTTAAATGACATGAATTCTCATGTTGTAGATACTTTCGTGTAAAAG
AGTATCCAGGGGCTGACCCTGCAGGGTAGTGGTTAAGTTTAGTGCTCTCCACTTCGGCAG
CCCGGGTTTGTGTGTTCAGATCCTGGGCACAGATCTGTGCCATTTGTCAGCCATGCTGTG
GCCGCAACACACATAAAAGTGGAGGAAGATTGGCACAGATGTTAGCTCAGGGCTAATCTT
CCTCGACAACAACAACAAAAGTATCAAACTTTTGCTTGCTTAGCATGGAATCAGACAAAG
GAGAGTTAATAATGTTTAATGAAGTGGTTCTCAATTAAAGGTACACATTAGAATCAGCTA
TGGAGTTTTTAAAAGTATACATTCCTTCATCCCATCTCCAGTTAGTCTGATTTGGTGTAT
CTGATGTGGAACTTGAGCATTCGTGTTGTTATTGTGTTGTTAATGTACAGTCAAGTCAGT
TCTGACTTGCAACTGAATGAGTGAGTGATGTCCACAATGTCCTATCCTCGCCAGTCCTAC
TCATCTCCTGTAGACTCATGCCTATAGCTTCCTTTTTGGAATCAATCCATCTCATATTTG
CTCTTCCTCTTTTCCTGCTGCCTTCTACTTTTCCCAGCATTATTGTCTTTTCCAAATAAT
CCTGCCTTCTCATGATGTGCCCAAGTAAGACAGCCTCAGTTTTACCATTTTTGCCTCCAG
CAATAGTTCAGGCTTAATTTGCTCTAGGACCTAATCATTCGTCTTTCTGGCAGTCCAGGG
TATCCATAGAGCTCTCCTCCAATACCGTATTTCAAATGAATAAATGTTTTTCCTGTCAGC
CTTCTTCACTGTTCAGCTTTCATACCTGTACACAGTAATTGGGGAATCCAAGGGCGTGGA
TAATCTAGGCCTTTAGTCTCTAATGACTCTTCCTTACACTTAATGATCTTTCCTAATTCT
TTTGTTGCTGCCTTTCCAAGTTTCAGTCTTCTCTTGATTTCATGGCTGCAGTCTCAATTT
AAATAGATCACTGAACCAAGGTAAACAAAATCTTTAACAATTTCAGTGTCTTCATTGTCT
TTATTAAAGTTGTGTAGTCTTCTATAGTCATGATTTTTGTCCTCTTGATGTTCAGATGCA
TGCCTGCTTTGCCACTTTCTTTTTTTAAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGC
CCCTCTGGTACATAGTTGTATATTCTTCATTGTGGGTCCTTCTAGTTGTGGTATGTGGGA
CACTGCCTCAGCGTGGTCTGATGAGCAGTGCCATGTCTGCGCCCAGGATTCAAACGAACG
AAACACTGGGCCGCCTGCAGCAGAGCGCGCAAACTTAACCACTCGGCCACGGGGCCAGCC
CCTGCCACTTTCTTTTTTCGCGTTTGTCAGAAGTCGTTTCTAGTCATTGCTGCTTTCTGC
CAGTAAGATAGTGTCATCTGCATATCTTAGACTGGTAATATTTCTTCCACCAATTTTCAC
TCCTCCGTCTGTCTAGCTCCATCTTTTTATATGATATGTTTTGTGTACAGATTAAACAGA
TAGGAAGGTGAAATGTACCCTTGTCTGACACCTTTGCCTATAGGCAACCGTTCTGTCTCT
CCATGTTCTCTCCTGACGGTGGGTTTCTTGTCGCCAAAGTAGGTTACGCATCAGGATAAT
CAAACGCGCTGAGGCATGACCGTTTCTATCAGAGCAGCCCATAGTCTTTCATGATCCATG
CAGTCAAATGCTTTACTGTAGTCTAAAACAGAAACTAACCTGAAATTCTTTGAAGCACTA
CGGTAGCCAACGAATAATCGCAGTTAGATCTTTTGTGCCTCTCCCTTTTGAAATACAGCT
TGGATGTCAGGTGTTTCTTGCTCCATATAAGGTAACATGCCTTCATTGTGGCACCTTGAA
CATCACTCTACTTGATGGGAAGTTAGAGCAATGGTCCTATAGTTACTGCAGTTCTTGGCC
TTTCCCTTTTTTGGGGATTGGGATCTATATTGAGTATTTCTAGTCTGTAGGCCATTCCTT
TGTTTTGCATATTTGTTGACATATTCTTGTTAGAATTTTGACAGATTTAGTCTGTGACTT
GAAATAATTCTGTTGATATCTCATCTACCCCTGGTGACTTGTATCTTCCCAGTACTTTGA
GGGCAGCTTTCACTTCACTTTCTAAAATTACAGGTTCTTCGTAGGAATCTTCAAAGAACG
TGTCATCCTTTTGTCTCTTCTGTATAGATCTTCAGTATTCTGTTTCTGCTTTCCCTTTAT
TTTCTCCTGATCAGATAGTGTGCTTCCCTGTTGGTCATTCAGCATTTCTAATCCAGGTTT
AAATTTCTTGTTGATTTCTTGAATCTTCTGGAAGAGACCTCTTGTTCTTCCTCTTTTGTT
TTCTTCTGTCTCTGTGTTGGCCATTAAAGGAGTTCTCTTTATCTCTATATAATAGTTGCT
GGAAAGCTGCGTTCAGGATTCTAATCCTGCTGTTGTCACCTTTTACTTTTGCTTCTCACT
TGTCCTTAACAATTTTTAGCCTTTCTTCTGTTATCCATCTCGATTTTTCTTTTCTTTTTA
TTTCAGACGTTGTCTTTTTGCATTCTTCCTTAAAAATAATTCTGGTTTCGGTCCCTAGTT
CTTCTGGTTCTTGGTCAATTAAACTTAACAGTGCAAATCTGTTTTTTATGTGGACTTTAA
ATTCATCAGGAATGTTATTTACATTATATTTTGGCACTACAATTCCTTCAGTGCTCTTCT
TCAGCTTTACTCTGATATTTGATATTAACAGTGCATGATCAGTACTGTAGTCTGCTAGTC
TTGTTTTGGCAGAGAATACAGCTTCTCTGTCTCCTGCTTCCAATTACATAGTCTGTTTGA
TTTCTATATTGGCCATCTGGTGATGTCCGTGTGTACAGTTGTCTGTTCAGCTGCTTAAAG
CATCTGTTTGGGTTGGACAGATTGATGGATGGGTTGTTGAGCATTCATATATACCTTTTA
ATTATGTGCTTCTCAAAGCCAGATTTTGATTACCTAAAATTATCGCTTTTAAAGCTTCTG
ATGCACAGGAGATTTGATGCACATTAAAAGAATTTTAGGGGGCCGGCTCCGTGGCCGAGT
GGTTAAAGTTCGCGTGCTCCGCTGCGGCAGCCCAAGGTTCGGATCCTGGGCGCGGACATG
GCACCGCTCGTCAGGCCACATTGAGGCGGCGTCCTGTATCCCACAACTAGAGGGACCTGC
AACTAAGATATACAACTATGTACAGGGGGGGTTTGGGAAAAGATTGGCAACAGTTGTTAG
GCCAGGTGCCAATCTTAAAAAAAAAAAAAAAAAGAATTTTAATAGGACCAGGCTCTGTTA
GCCACCTCTGTCATCTTTACTGCTCAGATGGGTAGATGCTTATGCTGCTCAAGAGGCACC
CTGTAGCCTACATAGTGGTTGGATGAGTACTACCATCCTCTGGTTCTTTGGGTTTCTTTT
TTTTTCTTTTTTTTGAAGAAGATGGCCCTGAGCTAACTGCTGCCAATTCTCCTCTTTTTG
CTGAGGAAGACTGACCCTAAGCTAACATCTGTGCCCACCTTCCTCTACTTTATATGTGGG
ATGCCTACCACAGCATGGCGTGCCAAGTGGTGCCATGTCCGCACCCGGGATCCGAGCTGG
CGAACCCCGGGCCGCTGAAGCGGAACATGTGCTTTTAACTGCTGTGCCACCAGGCCAGCC
CCTGGGTTTCTTGTTTCTGTTTTTTAGGTCAATAATTCCTCCTTTTGTTTCCTTGGAGTT
TCTTTAAATAGGTTATGGTAGAATATAGATTTTTGTGAGTTCTAAGTTATACTCTACTTT
TTCTTAAATTATACTTAAGATCATGTTTATTAGAATTTTGGGTGTCCCATGCTTTTCTCT
AATGTATTTATATATTCCCAAAGAGAATTGTGAACCGATACTATTAAGTTAACTCTCGGA
TGGTAACTCCGTTTCCCCATCTTCTTGTTCTTGGGGCCATAATACTGTTGTCTCATGTGC
CAACAACAGCAATAGAAACAACCAGTGGAGGTGGTCTGGGGATATTTTCATTTTACTGAT
GAGAAAATCATCATTTTGAATAGTTTGAATGGTTTGTTCAGTCTAAGTTTCAGAACCTAG
ACTGGTCCTGGGTATTTCACTGTGGCCATTAGCATGTTTTAGTGGTTTAGGAATAAGTTT
GTCTCATTTATTGTGGAAGTTGTCTAGCCATATACCTGCATGTTTAGACATGCAGGATGA
TAATTAGACAATTTCACTAGGACATGTGAAACTCTGTAACTTGAATTTTTTTTTTATCAC
TTAAGTATAAATTAAAGCTGTATAAATACCCTAATGATTATTTTTGTGGTGGCAGAAAAC
TTCTTAATCATCATTTGATAGTACTAATATATATGCCTAACCATTGGTTGGACTGATCAT
GTCACTCCTCTGCTTAAAAGTCCTTAGTGGCTTCCCATTCCCTTCAGGATAATATCCAAA
TTTCTCACCATAGTATACAAGGCCCTCTGTGATTCTTCTCTGGCCTACATCTTAGCCTTT
AATTCTGTGTGCTCCGCTCTTTCCGTCTCTCTTTCACCACTTGACACTCTTTAGAATTCT
ATTCCTCACCCTTCTTTGCCTTCAAGACTCAGTTCATGTAGCCTTCAGCTGGGAAAAGCC
TCCTCTGATACCCCTTCCCTCCTCCAGCAGTCAAATTTAATTACCTTTCCTTTATGTTGC
CATAGAGCCTTATAATAGCACTTATACTATAATTTTCTGTTTACAAATCTCTTCCCTACC
AACTGCTGAGCTCATAGAGGGAAGGCAGGACTATATATTGGGTTATGTAAGTTCTGCTTT
GTTCCGAAAAGAATTTGTGGTAAGGACGTTATCTTCTTTGCACCTTCTTTGTGTGGTATC
TGATATGTAATAGGTGCCTCACCCCCCAAAAAGAATTGCTTAGGGGAGGGGGAGAAAGCA
TACTAATTCTAGTGTGGTTTTTTCCCTGCTTTCTCTTTTAGGTTACTAAAAGGGATGAAG
ACTCTTCCCTGATGCAGCTAAAGGAGGAATTTCGGAGTTATGAGGCATTACGCAGAGAAC
ATGATGCCCAAATTGTTCATATTGCTATGGAGGCAGGACTCCGTATTTCACCTGAGCAGT
GGTCCTCTCTTCTATATGGTGATTTGGCACATAAATCACACATGCAGTCTATCATTGATA
AGGTTTGTGAAATTAGAAATGCTGATTTTATATCATTGCTGTTAAGATTGAAGAGTATTG
AAATCTTCTGATACAACAAAGAGACAACCAGTTGGAGATTCCTACATTTTAAAATATCAG
ACTCTTTATAAACTATCTTTTTTTTTTTTTTAATTTAATTCTCAAAATAAACTAAGGGAC
GCAAATGCAGGATATTAGCATAAAAGCAGCCTTGCTTACGAAATCTGTTGTTTGTCTACA
TTCAGACCCAGAGAGCTAATACAGTTTATAAATAAGTTTTCTAAGTGTCTGATGATGAAT
TTCATAGGGCAGATTCTGAGGTGAAAATTTAATTCATCACTGATAGTCCTACTATGGAAT
CTGAAGACGCTTGAAAATCTGTTTAGTATGTTGACTTAATGAAAGTATTTGAATATAGCC
ATGTCATAAGAACCAGAGTAAAAACCATTCTGTTTTCTGTTTGTTAGCTGCAGTCTCCAG
AATCATTTGCAAAGAGTGTCCAGGAATTGACAATTGTTTTGCAGCGAACAGGTGACCCAG
CTAACTTAAATAGACTGAGACCTCATTTAGAGCTTCTTGCAAACATAGACCCTAATCCAG
GTATATGGGAAAATATTCAATTGCTTATGCTTTTTCTACCTTTAAGGTAAATAACACAAG
AGAATTACTGCTAAGAAATTCTTCCCCACCCCCCATCCCATCCCCTTGGCCTCTTATTAT
AGATGCTGTTTCACCAACTTGGGAGCAGCTAGAAAATGCAATGGTAGCCGTTAAAACAGT
GGTTCATGGCCTTGTGGACTTCATACAGAATTATAGCAGAAAAGGCCATGAGACGCCTCA
GGTAAGCACACTTATTGCACTTCCGACTGCTGTTACCTCTAACACAGGTTCATCCTGAAC
CTCTTCACAAGCTGGTGGTTAATGGACTGCTTATGTGACTCTTCATCTCTCGTACGTTTT
TATTGTCTCTGTTTTTTTGGGAGAAGCTCATGTTTTAGCGTACCTGATCAATAATTCATA
GCACAGCAATAGTTGGGAGAATGTGTTGAATATGAGTCCACTGCAAATGTTTTTGATCAA
GTATAGATCATTGATTCCTTCCAAACATTTTGTCTAATTCTTTTCTAATGTAGGGAAATT
GTCACTTTTTCTCCATTGCGGTCACACAAATGTGAATTTCTATTTGTAAATGTGTGGGAT
TTGGATTTTTAAAATATTTTTCATCTACTTTAGAAGGAATTATTTAAGGTATAATCCTTT
ATTCTAATAATAACATCCATTTATTAAGTTACTATGAGCCAGTCCCTACGTTCAGTATTT
TATGTGTATTATTTCTAATCCTTACAGCCACCTGCAAAATAATTGTTGTTCCCAAGCTGA
AGTTTAAAGAGGTTAAATAACATATCTAAGGTCATGGTGGCAGTAAGTGACAGAGTTGGG
ATCAAATCTACTCCAAAGTGATCTTTCCACTCTTCTCTCCTTATTCTATTAGAAGGCAGT
ATAATATTCAAATATTAACTGAAAGATAAATGTTTAATCTTTATTAAATTCACAAAAATG
ACATCTTAGATTTTGATGCAAATTATGGTGGTTATGATGAGGTTTTTTATTTTGCTGCAT
TGTTTGTGTGAACTTAATCAGAGCTCCAAGGCTAAGAAGAGAGTTGTACTCTCAAGTTGA
CAAGTAAATTCATATTTCTTAATTTTTCACTTTCAGGGGAAATTGTATTCTACCTTCCTT
GGGAAAGTTTGAGTAGACAAAGCTTATGGCTTTTTTAATGCTTTTTAAAATTGTTTATTG
GTATTGTTGTTTTAAGACAGCAATGACTTGATGAGAAATCTTTTATTTTCATGGGCGTTA
TGTTGCCTGACAAATGAATGGACATAACATTTGAACTAGTTTCAGATAATCCTCAGAAGG
AATGTCTACAATACGAACTCAGGGTTAAGCATAACTCATAACTAGAAATAATAGAATGGT
AGTAGTTTCAGCACAAGAATTACTTGTGTAATGTGAAAAAGAGTTAAAGGTGTAATGATA
AAATTCTGAAGTCCCAAGAGTGAATAAAAATTGAATCTTCACTTTTCCACGCATTGATTT
TCTTTTTGTAGCCTCAGCCAAACAGCAAATATAAGACTAGCATGTGCCGAGATCTGCGAC
AACAAGGGGGGTGTCCACGAGGAACAAATTGTACTTTTGCCCATTCTCAGGAAGAGCTTG
AAAAGTAAGTTATGAGAATTCACTTACATATGGGTTTACTTTTTGGTCATTAAGAAAGTG
TTAGATACAAAGGCACAATTAAGTTCACATTGTAGAGTTCTTTAGATTGCAAAATAACGT
TTTCTTTTGCAACTATACCTTATTGCTTCTGGGAGCAAGATTAACATAAGTGAAGGGCCG
GCCTGTAGCCCAGTGATTTTGTTAGCAAGCTCTGCTTCCATGGCCCAGGGGTTTCGCTGG
TTTGGATCCTGGGCGCAGACCTAGCACTGCTCATCAGGCCATGCTGAGGCAGATCCCACA
TAGCAGAACTAGAGAGACCTGCAACCAGAGTATACAACTATGTACTGGGGGACTTTGGGG
AGAAGAAGAAAAAAAAGGAAGATTGGCAACAGATGTTAGCACAGGGCCAATCCTTAAAAA
GCAGACATAATAAGTAATTTATAACCTTATTCAAAGGTCATATCTTAGACCATTGAGTAG
CTGGAATCCATGTTTCTGCTGAGCACCTGTGCAGAGTGAAAATATCCCTATGTGCTATCT
TATTTGCTCAGGTTCCATTGAAGATAAAGTCCCCAGGTAGAATGGTAAAGCAGATAGATT
TTCTTTTTTAAGGCTTTTGATCTTTTTAACATTCATTTTTCTGTGTCTTCTTTTGTCTTT
CTCCTCTCCTGTAAGTCATCCCTTTCTCTATATTCATTTGCCCGAGACATAAAAGTAAAT
GGGTATAAGCTATATTATGTATTCTCTAAATTTTTGTTGTGTTTTTTAACCAAATTATTC
ATCATTGAAATCTCACCAAAAAATCTATCCCAGCCTTTCTACTAGAACAACTAGCCTGTA
TATCAACTCTTAATGGACATCTCCCTTTTGTTTTTAGACATTTTAAACTCAGCTTGGGCT
AATTTTCTCCTCCCCTGCATCCTCCTCTTCTACCTTCCATTCTGCTCTCTTCCAGTGTAC
CCTGTTGAGCCAGTTATACATGCCATATTATAGGAATCATCTTTGTCAGCTTTCTTTCGC
CTGCTTGTCTTAGTCACCAGGTTCTGTCAGTTAAGTTTCCTATATGTTTCTCAACTCTTT
CTCCTTCTTTCCATCCTTAGAGTCCAAGCTATCATCCCTTTTCTTGATCCACAGTTGCCT
CCTAACTAGTCTTCTAATAGCTGCTGTTGCCCACTCCCAATCCCATTATTCCTCATTAAA
ACAGGGAGAACGTTGCACAAAAGGCTTATTGCAGATAATGAGAAGCTTAGTTATTAGTTT
CACATTACCCTGTAGATAAAGATATAGCATCTAGATTTGTGGTCTATAAGACCCTGCATT
ATCTAGTCTGTGCCTGTCTTTCTGATCTCATGTCACAGCACTCCCTAATTGTGTTCTATG
CTCAAGCCACACTGACCTTCTGTCAGTGCCCAGAATGCACCAAGCATCTTCCCACTTCAG
GTCTTTTATGTAATCCTCTTCCTTTTAGCCTTACCTGTGGAGCTTTTCTTTTGTCTAGCT
CATTCTTCACTTTTTCAGGGGGATCCTCCCAATATTTCATATTAAACCAGGTTCTTCTTT
ATCATGCTTATCAAAGTTATCATTAATTTATGGTCTGTTTTAAGGGTTGACAGACTTTTC
TGTAAAGGTCCAGATATTTTTTAAGCTTGGTAGACCATACAGTGATCTCTGTTGCAACTA
CTCAATTCTGCCATTGTAGCAAAAAAGCTACCATAGACAATGCATAAAATAGGCATGGCT
GTAAACTTTATTTACAAAAGAAGGCAACTTTTGCCCAAGGGCAGTAGTTTCCTGACCCAA
TCTATTGAATGTTTGTCCACCTTAATGAAGTGTAAGCTCCATGGACTCTATCTGTCTTGT
CTATTGTTGTCTCCTGTTTTCAGTGGCTAGCAGTGGGGCATGCACATGATCAGCTCTACA
GCAGCACCAGTGTGATGGAGTGAAGATACATTTGTGTGCATTAAAAAGAAGAGCAGAAAC
ATGCTTCTCTTCTCAGTTTTTCCACCTGCTGGAAGCCTAGAGAGGCTGCAGGAGTCCTAA
GAAAAAATTATATTGTTTGTACCCAGTCAAGGCAGCTCTGTCTACAGAGTTTTACATCAA
GATGATTTCTGAGACTCTAGGAGATGTATTGAGCTTGTCTATACCTGAAATAGAGCTTTT
TAGCTAAAATAAAGCTTTTTTGGGGACCTTGCTTGGGAGCACTTAGACTTTAAAAAGTCA
GGGAAGAAACTGTGTGATTTCATTACTATTCCACCCACAACTAGTGCCCCAAATTAAAAT
CCATTTATCTTCTTATATCTTCAAGTTACCTTCCTGTTCTCCATTCCCCACTACCTACTT
CAGAACTTCATTATCTCTTGCCTGAACTTTTAAGAGAAAGAAGGGGAGGAGGAGGAAGAG
GAATAATAAAAATAGACAAATTAATTGGTCACATTTTGTGCAGGTACCATTTTTAGTGTT
TCACATTTGTTTACCCAATTTATCCATTTTGATGCTACAGTGGCTGTTAACCTTGCATTT
CCCTGTGTCTCAAGCTATGCTACCAAGATTTTCTTTTGCAAATAAGTGTCTAATCACGTC
CATTTTCTGCTTTAAATTCTTAATTCCTCAGTACATCAAAGGATCTGGTCCCAATCTAGC
TTTCCAGCCTTACTCCACCTTTTGCATTCTTTATATATATTTTTTTTAAGGTACATTCAG
TTAATCACTGGTTACTACTATACGAATTCTTTCATTCTTATTTCCCTTGCACATGTTGTT
CACTCTGTGTCATATATATTTCTCTGTCTTCTCTGTTTGGAGAGCTCTTATTCCTAATCA
TAATCAGATATTATCTTCCTTCTAAGGACTTCCCCAGGTAGTGTTAGTTGCTTCCTTCAC
TATACTGCCATTGTACTCTTCACAGGGCAAATTTATAACTACCACTTCTCTTACTGTATT
GCCATTATTTATTTATTATGAGTGTATTTTCACTGGACTTATTTATTCTATAGGTTATTC
GTATTTATATTTCCTGCACCTAGCAAGTATGTGATATATAAACTCAGTATATCTTTGTTG
AAAGAGTAAATAATCTACAGTTCATATTTCTTATTTCCAGCCAGCTTCACACACTCTATT
GCTGTTAAAAAAAAGAAGAAGAAGAAGAAAAAACAGGGTAATACAAAAGATTAGGGACCT
GAGAGATGTCACTATCCTATTGGTTAAAAAAATACGTGTTGCTACCCAACTCTGAGCTTT
TGAGGGTAGAGCCATTGTCTTAGTTCACATAATACACCAGGACCTCAGCAAACGTTTAAC
TTAAGTAACTTAATTTTACCCCGTCTGCTTTCTCTGCTCTATATCTCCCTAACTAAACAA
AATGTAAATGCCCAGAAAGCATCCCTAAGAAATAAATATTTATGTGAATATATTTTAGGA
TGTAGGATATTGGAATATTGTTCCCAGGAGTTGTTAGGTTCTGGAGAGTGCCAAAAGCCT
GGGATCAACCAATTCAACAAATATTTATAAGAATGATTGTTAAGTGCTTGGTACTATTTG
AGGTGTTTCTAGTGGGGAAAGAGGAACAGTAAACATGTAAACAGACAATTTCAGTTACTG
ATAAAATGCTATAAAGAAACCTTGCCATGTTCAGGAATTAGGAAGAAGACCAGTATGTCT
GGAAGATGGAGAATGAGAAGAATGACAAAAGACAAGGTTGGATAGGTAGATAAGGGCTAG
GTCATACTGGGTTGGTGGACCATGGCAAGGAGTTTGAATTTTACTCTGGAAGACTTTGTA
GGGTTTTATTCAAATGGAATGATGAGATTTTAATTTTGTCTTAGAAATGTCACTCTAGTG
TTTGCATGAATCGAGACCAGTTAAACTGCTGCAGTGGTCTAGGCATGAGATTGGTAGCTT
GGTCCCAGGATTATAGTAATGGAAATGATGAAAAGCAGTCAGATTTAGGATATATTTGGA
AGTAGAGCTGATGGGACTAATAGATTGAATGTGGGGTGTAAAGAAAAGAGAAAGAATCAA
AGGATGACTCTGAAGTGTGGGGCCTGCCTAACTGAGGTATTATCTTTTACTGAGATGGGA
AATGCTTTGGGGTGGAAAATCAGTAGTTCTCTTGGCCGTATGAAGTTTGGGGCTTACTCC
ATATTCATGCGACAGATATTTTGGGGACACCAGTATGCACCAAGCACTATATTATGTGTT
AAAAATAGACAGGTGAGTAAGAAAGGCAAAATCCTTGGTCTTGTGGGGCTTACAGTGAAG
TAGAGAAGATCAACATAAAGCAGGTAAATAGAAAACATAGTATCTGGTACTGATTGATGC
TATGAAGAAAAATAACACAAGGTAAGGATAAAGAATGATTGAGAAACGGGAGATATTTTA
GGATAAGATTGCCTGGGAAGCAATCTCAGAGGATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCACA
TGATCAGCTATGATGGCGCTGAGGAGTGGAGGGGCAAGGATGTTAGAGATGGGAAGTGAG
TTTAGTAGAGAAGTGTATTGATGTATTGTTTGACCATTTTAATAATTGATTTTAATTTTG
AAGGAAGTCTAGACAGCATGATTGTATGATTTTTCTCCAGCAACATTTAGCTACTTGGGA
GCAGGCACAGAATAAGAGAATAAGCGAAGAATTGGATTGGAGTTTTACCAGATGACTTCA
ACGGGGGGAGTGGGCCAAAGGAGTTAAAGGTATTTACAAGGGAGGAATTAATGGTAGAGG
GTGGATTCTAAGCTGGGTAAGGCAGAGAGTGAATACTTGAGGGAGCTCGTGGACGATTTT
AAAAGAATAGGAAGTAATTGGCTTTTTCAAGTGTGAGGTCCAGGTTCTAAGTCCAGTTCT
TTAGCTGCCTAGATGCTGGCAGTCCAATATGTATCCTTACTTTTCACTTACTTTACCTCC
CTTGGTTAAGGTTTTACTTCTCATAACTCCTCCCTTTTAAGAAACTCAGAATTAAAACTT
TATTTTTTGCCTGCCAGAGCAGTCTTAAGGATATCTGAGATTTGTCTTTGAGGATGAAAG
CAAGGAGCATGCCACAGAATTGCCTTTCTGAAATATAGGTCTGTTCATGTCCCTCCTTCT
TAAAGATGTAATCGTTGGTTCCCCAGAATCTGTAAGATGACATATCTAAATTGGCCGTAA
GCTCTGTTTTGCTTTTTTTTTTTAAACTTGGTGTTCTATCACTCCACCTTCAGTCAGACT
GATCTGGGAACACTTGTCTTTTATTGAACTTCACTTGCCTCTGTCACTGTGTGTATACAT
GAGTGTATGAGAGAGAGAGGGAGAAGAGAAAGATTGAATCATGAAGCTGTTTATAGATAC
TGAAGGGCTAAAAGGAAAACTGTTGTGAAGGCATTGCTCATCCCTACACTATTTATGTTT
AATTACCATATGTTTGATTATGTATAACATTAATATCAGATTGATTTAGGCAAATGTAAT
TATGACTCCAAATGTCTGTAGTCGTCTTTCTATTCATGTTACATAATTGTTCACCACTTT
AAAATAATGGCGGGAACATTGACTAGGACTACATTATAATAAATTTTTGTTATACAGGTG
GAAACTAATTTTCTTAAATGGAGTCCAAGATCAAATTGCCTCACATATTAGAGTATTTTC
TCTGACCATAAATAAAACCCAGAATTTAATATCGGAAAAATCTTTAATCCAAATACTTTT
TACTTTAGGCATAAACTAATCTGAAAAATAGAATACTAAATTCTGTATTTTGGTGTAATA
TTTTTTTAAGAATTAGGATTGGTTTCTTTTTTATTTCTTTAAAATTATATACTGCCTTAG
CAATTTGGTAACCACAGAGAGTTCTTCCAACTCTTGCGTATCTTTTCTCTTCATCCTACA
TTCTCAACTACATTTGGTATGGTTCCTTTCATTTTTACACAGTGTCCTTTATATTTTAAT
TATGCAAATTTTTAATGGGTCTCTTCCTACTCCCTCAAAAGGCTTCTTTGAATACATGTG
TACCTCGCTTGCTGTATTAATTATGTACCTACATACACAGGTGTGTGTGTGTGTGTATGG
GATATATGATCTTTTCCCATTGCATTTTTTTCCTTCAGAGTAAGATTTTGTGAAATATTC
ACCAATATGTTGATTGTTTTTGAAACAGGTATCGATTAAGGAACAAAAAGATCAATGCAA
CTGTAAGAACATTTCCTCTTCTAAATAAAGTTGGTGTAAACAACACTGTCACAACCACAG
CCGGAAATGTCATTTCTGTCATAGGAAGTACTGAAACAACGGGGAAAATTGTTCCAAGTA
CAAACGGAATTTCAAATGCAGAAAACAGTGTTTCCCAGCTAATCCCACGTAGTACTGACA
GTACATTAAGAGCTCTGGAGACTGTGAAGAAAGTGGGGAAGGTTGGCACTAATGGTCAGA
ATGCTGCTGGGCCTTCTGCAGAGTCTGTAACTGAAAGGTAAGTATTAGGTAAAAATGGTT
AATACAGGTTATATTTAGCCTTTTTAGAAACACCTGAGTATTTTTATTTATCCTGAGGAA
AAGCAGTTAATCAGAATTTTTATGCAGAACATTTCATATAGTAGAAAAAGCACTCAGTAC
CCAAAAATTTGAGTCCTAGTCCTGGCTCTGTAATTGAATAGCTCTGTGACCTTGGAAAGT
CACTTTAACTCTGGGTTTTGTTTTCCTCAACTGTAAACTGAAGAGGTTGGACCAGAATTG
GGGTTTTTCACACCTTATTTCCTTGAACTTTAGGATTGAGTTCATAGAGGTGCCGGAAAA
GAACTAAGTAGAAACCTAAGCAGGTGAGATGCTTGAGCCTCCAGCTCCTGTTTCATTCAG
AGCAGTTCCACATCTATTCTGTAACTATGTGTAGTAGTTAAGGGGGCATCTTTGGAGCCA
GACTCTTCAGGGTTCAAATTCTGGCTGTTTCCTAGCTGTTTGATCTTAGGCCAGTTACTT
AATCTGTCTAGCTCAGTTTACTTATCCATAAAATTAGTATAATAATAGCATCAACTTCAT
ATGTTGGTCGTAAAGATTAAAAGATTTAATACTGCAATGTGTTTTGGACGATGCCTGTCA
CATAGCGCGCAGTAAATATCTACTGTTGTTGTTATTACTATTACCGTTGTTGTTGGGTTT
TAGCGTAAGATTTAATTTGGCAAAAGGGTTTTGGTGCTTTAAGAAAAAAGTTTTAAAACT
TTCGGATGATCTGAAAAGTTACTTCCACCTCAGAAATCTCATTCTTTGGTATTCTTTTAA
GGTCTTAAAATCTGAGTTAAAGCATGTTCAGATTTTGTCACCCATAGTCTGTCAGTATCC
TGTGCCTTCTAGAAAAAAAAGCCTTATGCTAGGCACACAGTAAACTAGTGATTTCATATA
ATAAATATTGGATAGATAAGCGTTTATATTCTTTATTTCTGCAGTTAGCATGTGATAGGG
GAATTTGTTTACTAACAAATCCCTACCATCTTCCCTGGGAAAGATTTTAGAAATGATATG
ACAGAGAACAATGTCTAGTTAGCAAATGTTATTTGAGCGCTCATTCTGAGTTCTGTTCTT
GGCACTCTTGGAAATAATTTGAGATGTGTAAGATATCTCTACCTTTAAGAAACTTATGAT
AATATGGTTGTGTAGACAGCATTTACATAAATGAAGCAATATTGGAGTTGTATTAAAGAA
CAGGAAAATTTTATATTGCTGGGAGAAATATGGGAAGAAATTTCAGAAAAAGAAAGTGTA
ACATGGATCAAGTTTGTTGATAACTGTATGGAACATTGAGGAGATCAGCCTTCTAGAACT
GAAGGTTTATGTTAGGAACTGGTTTAAATGAGATTAGATAGATAGGTTGGCACCAGATTG
TGGAGAGCTTGTGCTATGTGTGTTTAAGAAATGAGCTTTTGAAGGGTTTTGGAAAAGTGA
TGTTGTAAAACTGTATTATATCCAGAGAATGGAATATTTTTCAGCCATAAAAAAGGAGTG
GAGTACTCTTACATATAACGTATGGATGAATCTTGAAAACATGCTAAGTGGAAGAAGGTA
GATAAAACAGGCCACATATTGTATAATTTCATTTATGTGAATGCCCAGAGTAGGCAAATC
CATAGAGACAGAAAGATTAGTGTTTGCTAGGGGCTGGGGCTAGGGGGAGAGAGGGATGAG
GAGTGAGTACTAATGAGTACAGATTTCTCTCAGATGATGAAAACTTTTCAGTATTAGATA
GTGGTGATGGTTGCACAACCTTGTGAATATACCAAAAATTATTGAATTGTACACCTTAAA
AGGTAAATTATATCATTCAAAAAAATGATGAACTAGGGAAAAAAAACTTATAAAAATGAA
TAGATCTAAATAAATAAATCATTTATTTATTTATTAAAAAATTATGTATATTCTGTGTGC
CGAACACCAGGCCAATTAATGTAGCTAATGAAAATAAACTAGATATACTCCTTGCCTCTA
AGGAAGGGTCTTCCAGTGTAGTTTGGGAGACAGATGTCAAAAGATATCATATAATACATT
CTGAAAAGTACTGTAATAGAGTTGTGTTCCAGGTGTTATTGGAACACACAAAAAAAGAAT
AATTCTATAGGGACTTATTTTGGATTTCTTCTTAGAGGTAAGGTGATAATACCTGAACTA
GTTTCAAGAGTATGGATAGTTAGGAAGGAAGGGCCTTGGTAGAGGAAGCAGCACAGGCAA
AAGCCTGTAGGTATGAGAAGGGCTGCTGCAAAGGAGAGCCTAGAATCCTGAAAGTCACCT
AGGACGTAGCTATAATAATCTAGCTGTCTGACTAGAATGTGACTGAAAATTAGTTTTTTC
CTTAAGTGTGAGTTTTGGGGATAGCTTGTGTGATTTCATGAGGCTATGAACCTTTTCATG
GATTTTGATGTCATTTTCCTGGTAAGTCTAAGAATTTGCCATTTCAAAGTACTTATCCAG
ATTTTACAGTATATAGCATTTTGACATGGAAGGACCAGATAATCTACGTAAAGCACTTAG
CATAGTGCCTGGAAGGTGGTCGATAAATGTTAGTTATTATTGTTGTAAGGAAATCCTAAT
CATTTTCCTTGTTGCCTTTATTTAACTTTAGAGAATAAACAAAGCCCTAAAATATCTTTA
AACTCTAAACCAGTGCGTTTGTACCTACTATTATTACCCACTCTTCCTTAGTTAATTTCT
CATTTTGACACACAAACATAGAAGTAAATAAGTATCTGCTAGACTTAAAGGCAACCCATA
CTCCTTGTTGTTTATACTCTAGCTTTAAAAGGGCTTCTCTAGTTTGAGAAAAACCCTCTA
ATCTAGTTGGGATGCAACATATTGAATTCTGGCATCATTAACAAGATCATTTTCTTGAAT
CACCACATACCTAAGCTCTGCCAAAGTTTGACTTCCTAAAAGGGCATGCGAAAGCCATGA
TGAGATCATCTGGAGCTGATTGCTTGGTGACTCAACAAAGAAAATCCTTTGTGTATAAAA
AAAAAAAGATAAGTTTGTGTATTTTGTATCAGTTTAGTGAGTAACCATTTCATTAGTGTT
TCGTTCATCCAACAGATATTCACTGAGTGCCTCCTGTGTGCCAGGAACCGTTTTAGGTCC
TGGATGTATAGCAGTTAACAAAATGGACAAAAATGGCCTTTCCTCAAGGAGTTTACATTT
CTGCTAATCTAACTCTTAATAGAACAACTCTTCCTTTACATATCTGTCTTCTTTGTCCCA
AAGAATTCTACTGGTAGACTATATTGTTTCTGTTGAGAACTTAACTGCACAGGATTTTTT
TTTAGCTCCCAGTAGGAAAAATCTTTATTTAAAGAATGAGTGTAAAGGGACTGATGGGTC
ACATTAGAGCCTGGAATTTGTTTGCATTTCTTTTTGCCCTCACCGGAATATGAGACCTGT
TACTATGATCCTGTGAATTAGCAGACTAAGATGGCAATGAAATTCATTGCCTTGTTGTCA
CTGTGGAAATGCCTGAAGTGTTTTCTATTAGTGGTTTCACTTATTAATTTTATGAAAAAT
TCCAAATGAGGAAAACTTATCAGTCAAAGACAGTGATTTATCATTTGCCCTTCGTTAAAT
TTTCTCTCCAGTAAAATTGGTTCTCCACCCAAGACTCCTGTAAGTAATGTAGCGGCTACC
TCAGCTGGGCCCTCTAATGTTGGAACAGAGCTGAATTCTGTGCCTCCAAAATCCAGCCCG
TTTATAACTAGAGTACCGGTATATCCTCAGCATTCTGAAAACATTCAGTATTTTCAAGAT
CCAAGGACTCAGATACCCTTTGAAGTCCCACAGTACCCACAGACAGGTAAGTAATTTTAG
ACAATTCTAAGAAAAAAAGAAATTGTAATGTTAAACATTTGTTGCCATTAGATAAGTAAG
TGAATCATTTATATCTATCTATAGATAGAAGTAGATTTATATCTATTAATTAAAAAATTA
ATCCTTTGGACTACATGACCCCTAAGCTTTCTTCCTGACCTAAGAATCTATAATTCTACG
CACCAATGGTTTTAAGGTTCTCATTCCTGTGAATCAAATACAGAGTCCATGGATGAGCTT
CAGGGAGTTCTGTGAATCCCCTGAAATAGTATGCAAAATGTTTGGTTTATATATACTTAC
GTATAATTTTGAAAAGACAACACACAACTTACGTAGATTTTGAAAGAGGTCTTTAATCTC
TGCTCCCAAAAAGGTTAAGAATCAATGGTGCAACTAATTTCTTAATCCAAAACCTATGGC
AATAGATTCCCTAGAAGGAGATTGACTAGCCATCTGTTAATAGCTCTGTCATTTGTTTTT
AAGGAGCAGTCTAACATTAGCAATGAACGTTAATGATTTTCGTATAGTGGTGTCTTGAAA
GTATATAGATTCTTTCTAAAGAGGGGGTAACTGGGGTTCAAAGTTTATTTTTCCACATTA
AAGCCTGCTTTAAACTTAAATCATTGTAAAATGTTGGATTTTACTAAGATTATGTTACAT
ATTCCTCTTTCCAATTTTCAAGGATACTACCCACCACCTCCAACGGTACCAGCTGGCGTG
GCTCCCTGTGTTCCTCGCTTTGTGAGGTCCAATAATGTTCCAGAGTCCTCTCTCCCACCT
GCTTCCATGCCATATGCCGATCATTACAGTACATTTTCCCCTCGAGATCGAATGAATTCT
TCTCCTTACCAACCTCCTCCTCCGCAGCCGTATGGACCAGTTCCTCCAGTACCTTCTGGA
ATGTATGCTCCTGTGTACGACAGCAGGCGCATCTGGCGCCCCCCTATGTACCAACGAGAT
GACATTATTAGAAGCAATTCTTTACCTCCAATGGATGTGATGCACTCGTCTGTCTATCAG
ACATCTTTGCGAGAAAGATATAACTCATTAGATGGGTATTATTCAGTGGCTTGTCAGCCA
CCAAGTGAACCAAGGACAACCGTGCCTTTACCAAGGGTAAGTAATAATGGAAATAGGAAT
GCTCCCGTACTGTAGTGGTTAGGAGCCCAGTGTCTGGTATCAGACCACCTGGGTATCTAT
ACTGGCTCCTCCACTTACTGATTGTGTGACTTATGGAAGTTACTTGACTTCTCTATATTA
GTTTTTTCATCTGTTTGATGGAAATAATAGTTGAACCTACCTCATAAGGCTGTTGTGAGG
ATTAAATCAGAAAAGAACAAAGCTCTTAGAACTGGACCTGATGCATATTAATGCTCAATA
AATGTTATGTTTGGATAGGAAATTGATGGGAAGGTAAAAAGAAATCTTCAAAATACAAGG
ACAGGGCCTGTTTTCAGTATTCCCACATATATACAAGTGACTTTCCTAAACCAGAAAAGT
GAGAGCTCAGATTTTACTTTTAGCATCACTTGACTAAATATTAACCCTTTCATTTAAGTG
TGTGGAGAATAGGCTAGGGTGACTTCTCTCCTGTATTTTTTTTTTTGGTCCCAACAGTAT
AATAAACTGTTTACATTATTTCCACAGAGCATAGTTAATTTTATTTACTGCTCCCTACAT
GATTAAGATTGTTTCTTTTATCCCCCCTTAGGAACCTTGTGGTCATTTGAAGACCAGTTG
CGAGGAGCAGATAAGAAGAAAGCCAGAGCAGTGGGCACAGTACCACACTCAGAAAGCACC
TCTTGTCTCTTCAACTCTTCCTGTGGCAACACAGTCACCAACACCACCTTCTCCTCTATT
CAGTGTAGACTTTCGCGCTGATGTAAGAAAGGTTTTAATCACTTAATGTTGCAGGAATAG
TTCACACAGCTGACTTCAGAGCACTCATTCAAATCAGGGTTAGCTATTTTGGATATTTTG
CAGTGGTTTGGTGTGTAGTTGAGTTTAGTTCAATAAACATCAAGTATGTAAGCACTATGG
CTAGGTATTTGAGACTCTGAAGACCATTGTCATGGTCCTTTTTCCACTAAGAATTCAAAA
TTTTTCCAGCAATATAGTTCTCATCATTTTTATGGCTTTTATTAACAATGAATTTTATAT
CTACCATTTATTGAGCACTTACTTGTGCCAGGCACTGTACTAGCCATTTACATAATGTTA
TTTTATTTAATTCTCACAAAAACCCTAGGGGGCAGGTATTACCTGTATTTTGCAGGTTAG
GAATCCTACTCAGAGAAGTTAAGTAATTTGCCCAAATAGTAAATTCAGCCTGGAAGTAGC
TGGGATTTGAATCCTGGTCTGTCTGAGGCATTTCCTCCCTACTTCACAAGAGGTGCAGAA
ATGCCTACTGTATTATTACTCATGGTGTTTATATCACTGTTGATTATTGTTCTTTTTATT
ACTAAACAAGTTTTTGTACCAGGATCGTTTCACTGTACCCTGGTGTTTTCAGTATTCTTA
TATTTAGAGCAAACCATTGTTTTTTTGGGTTTATTCCTCATTCCTAGAGGTTGTAATATA
AAAATAATTTTTTTAATTGTTTTATTATGAAAAGTTTTAAACATATATAATAGTGGAGAG
AATAGTATAAAAAACCCCATTATCCATCACCCAGCTTCCACAAATGTCAACTCAGTCGAT
CTCCTTTCATGGGTTCCCCTTCTTCTTACTGGATTATTTTTAGTTAATCCTAGACATCGT
ATTTTTTCATCCATAAATATTTCAACAAACTAATAAATTTTTAAACTAGATCCAAATTTG
TCTCATCAAACTTAGACTTCTTCAGAGCAGCTAAACATTTTGACAACAGAGTGATAGACT
TGCCACTTAGTTAATAGAAAAATATATTTACCTTTTTTTATACTATGTCTTAGGAAATAA
GTATTTCGCTGAGACTCGGATCTGCTACTAGCTAGTAATATGACTTGAGATAAGTAATTT
AACCTTTTTGTCCTTGAGTTTCCCTATCTGTATAATTAGTAAACAAGATTTATTGATTCT
TACAAGTTTAATATTCTGGCCCTATAGTAATCCTTACTCACCATCCCTTTAAAATTTATT
CACTTCCCCTTCTAGTTCCAGAGCCTTCTTTGAATTCTTTTTGTTCTTTATTTAATACTG
TATGGTTTATCAGTTATTTTCCCTTATTTACACATGTTGTTCTTTTCTCAAGAAATTATA
AATTTCTTTAGGACATGGACTGTGATCTCTCTGTATGTGTTTGTGTGTGTCTGCTTTCTT
TTACTTTTTTTTTTTTTGAGCACCTCATACCATGTCGGAGGCATGTTGTAAATACTTGTT
GAATGGTTTTGATGATATCAGTCAGGGCTTTCTTATGCACACTTAAAGGACAATGCAAAA
AAAGAAGGCATTCTATTTTTATTAATAAATAATATAAATACAAATAGTATAAGTACTATT
TGTTACTTATGACAGTGTTTTATATTATCAAAGGTTTAATTGTTCACTATGAAGTCTTGT
ATATTCTAGAATAGTCACTTTATATTAGTTACAAGTTTGTAAATTTAAGTTTCTTACTAA
TTTGGCTATGCCTTTTTTTTTTTTTTAATCAGTTCTCTGAGAGTGTGAGTGGTACAAAAT
TTGAAGAAGATCATCTTTCCCATTATTCTCCCTGGTCTTGTGGCACCATAGGCTCCTGTA
TAAATGCCATCGATTCAGAGCCCAGAGATGTAATTGCTAATTCAAATGCTGTGTTAATGG
TATGATTTGGGGGGTGGAGGAATATCATGCATGTTGACTCAAGTTTTAGAATGATTGAAT
GCTTTTATCTTCATATTGTTGCTATTTAACTCATCTGTAAGCAGCAGAGTCATATTTAGG
TAAGTCTGAAATAAATTGCATTTAATGTTTAAATTATTTGAGCATAGTTTGGTGATTTTA
AAAATAGATGTTGGATTATCATTGAGATCTACAGCTAGTGTTATATTTACCAGAAACTTA
ATGTCTTTTGAAAGCATGTACTTGTATTACTAGCTGAAGTAATTGCCAATAGTTCTTTTA
TTGATCTTTGGTTTATGCAGGACCTGGACAGTGGAGATGTTAAGAGAAGAGTACATTTAT
TTGAAACTCAGAGAAGGACAAAAGAAGAAGACCCGATAATTCCTTTTAGTGATGGACCTA
TCATCTCAAAATGGGGTGCAATTTCCAGATCTTCCCGTACAGGTTACCATACCACGGATC
CTGTCCAGGCCACTGCTTCCCAAGGAAGTGCAACTAAGCCCATCAGTGTATCAGGTAATT
CATTTAGCTAATACCTCACCTTATATGTTCTAGCACTGTGCTTTATAATCCTCACTTTGT
GAGTATGGAACATATCCCTCCATTTAATAAGCACAGTAAACTCAGAATTAAATGGTTTAG
CCAAGAGAACATGGCTAGTTAGATAAAATATGGGTCTTTTTTAAAAGTATACATTTATAT
CTATATACTGACTTCACTTCTATGATCATTGTTTGTTTCTTTTTACATTTCTATAGATTA
TGTCCCTTACGTCAATGCTGTTGATTCAAGGTGGAGTTCATATGGTAACGAGGCCACATC
ATCAGCGCACTATATTGAACGGTAATGTTACTCTTCATGCTTTAGGATTCTCTATTCTCA
GACTTACAGTATCCTCAGAGTACAGATTCTACTCCCAATTATTCATGAAATGTGCTTTAC
TAATTTTAGCTATAAAATAAATTTCTCCCCTCTCCCCCAGAGCCCCAGTACATAGTTCTA
TATTCTAGTTATAAGTTCTTCTAGTTCTTCTATGTGAGCCACCACCACATGACTACTGAC
AGATGAGTGGTATGGTTCCACGCCCAGGAACCAAACGTGGGCCGCTGAAGTGGAGCACAC
CAAACTTTAACTGCTAGGCCATCAAGGCTGGCTCTAAAATAAATTTCTGAAAAAAATTTT
ACTTTTACATTTGGAATGATGACTAAAACTTCCAGAGTTGATCTGTTACATAGAACATAT
GTAGTATGTAGTCATTACTGCTTTAGTTGCTTAATTTATTTCACCTTTATTACAGTAAAT
GTATTTCTCTTTAAAGGGACAGATTCATCGTTACTGATTTATCTGGTCATAGAAAGCATT
CCAGTACTGGAGACCTTTTGAGCATTGAACTTCAGCAGGTAGGCTCTGTGTCACTTAGCT
CTGAATTTTTAAAAAATAGAATTGCAGTTGAAAGCTATGGTTGGAAGCTAACTTAAATTG
TTTTTTTTTCCTATAGGCTAAGAGTAACTCCTTGCTTCTTCAGAGGGAGGCCAATGCTCT
GGCCATGCAACAGAAATGGAATTCCCTGGATGAAGGCCGTCACCTTACCTTAAATCTTCT
GAGCAAGGAAATTGAACTGAGAAATGGAGAGGTAAAGAGACTGGACCGCTCAGCTTCATG
CTTAATGTATTTGTTGTTTGCTGCTGCTGTGCGTTGATTCATGCCATTATTTAATGCGTT
TTAGTGTGCCTTTTTCTGATGGATGATTGCTTTTAAAACTTGAAGTAGAAATAAAATTGT
GGTCCCAGATTTCTTGAATAATTCTTTACATCAATCATTGGGATTCCCAGTTTAATTAAA
AGGGAAGCCCAAGTTTCCACAGGTATGAAAGCAGTATTTTTCTTAATTTCAGAGTGATTA
TACAGAAGATGCAACTGATACTAAGCCTGATAGGGATATTGAGTTAGAGCTTTCAGCCCT
TGATACTGATGAACCTGATGGACAAGGTGAACAAATTGAAGTAAGTACCACAATTAGATA
TTTAGGAGGCTTTATTCCATTGGAAATTAAAGTATAAAATACTTTCATACTGAAGGATTA
ACATTTTATTTTCATAGGAGATCCTGGACATACAGCTTGGTATCAGTTCTCAAAATGATC
AGTTGCTAAATGGAACAGCAGTGGAAAATGGGCATACAGTCCAACAGCACCAAAAGGAGC
CACTGGAGCAGAAGAGGCAGAGTTTAGGTGAAGACCATGTGATTCTGTGAGTGTTAGACA
GAAAATTCCTAACCAGTGGGCCTAGGGCGTGAATACTTAAAGAGAAATAGATGCAGTGTT
AAATTCATTTTGGGCTTTATCCTGTTAAGGGAAGACCTTATGTAATAGGACAATGATTTG
GTCAGTCTGGATTTTTAGGAGAGAAGAGGTAAATTTGAACTAACAAAGTAATCCCTTTTA
GTAGCCTGAAACTTGCTTTTTGTTGGGATAAAAGTTAGTCTTTTTGCTTCAACATCAGCT
TATACTTCTTCAATCTGGTAGCCAAACTTCTAGACTACAAAATGGAGACTTAAAACATAG
ATGAAGGGTCTCCCTTTTTAAAAATCATGTTAAGGTTTTCTTGGCTTTAATATTGTTATT
TTGTATAATTACTCCCAAACATATTGTCTAATCTTGAACTTGATATTATTGGCCTTAAAT
TACTAGTATTTTAAATTTTTATTATAATTTTTGGAAAATGGGACTTTTTTAATGACCTTT
GATACTTTTTAGTGATAAAGACATGCCTTTGCTAGGCGCTCTTAAAGTTTGTTACAACTT
TACAACTTTTATGAAGCATGTATGGTTACTCTTAAAAAGTTTTCACTTAAAGCTAATTTG
TCTTCAATGTCATTTATTTTCTCTCTCAGGGAGGAGCAGAAAACAATTCTGCCGGTAACT
TCTTGCTTTAGCCAGCCACTCCCAGTGTCCATTAGCAATGCAAGTTGCCTCCCCATCACC
ACATCTGTCAGTGTTGGCAACCTCATTCTGAAAACTCATGTTATGTCTGAAGATAAAAAC
GACTTTTTAAAACCTGTTGCAAATGGGAAGATGGTTAACAGCTGAAAGGAGGTTCATCTT
TCAAATTTGTGACCATACCATGGAAGCATTTACACTAGCTTTTTATATATATAATATATA
TTATATAATGTATATTTTTTTTAAAAAAAAGATATTACTGGGGGCATCCATTTCCTGTGG
ACTCTTTGATACTTCAAGCCCTCTTGCATTAGCATTATGAAAAAAAAAGAAAATTTACTT
TACTAGGGTAACACGTTCACTTTCCAGAAGTGATTGGAATTTGGACATTTAACTTAAGCT
TCAAGCAGCTTTTTATGAGTTTGTAGCAATCCGGTGCAGTAACTGAGCCATTTCCTATTT
TAAATGGCTTCTATAGAAAATTAACAACTCAGTTATTAAACTAGCAGGATCCTACAATGA
TACATCTAGTGAAAGTAGACTTAATTAACTTATTTATTTCTATTTTTTTGTTTCACTGAG
AGAAATTTCCATCTCATTCCAGCTGCTTTATTTATCTTTTTCATGGAACTTTGCATGGAT
TTTTTTTCTTTCTTTTTTTTTTTTTTTACTTTGAAGAGTGGAGTTAGACGTTCTTATCAT
AGAATTTTACAGGGTTATATACTAGCTTTCTTTACTGCATTATATGTAGGAGTGTGGTGC
AGTGCTTTTATCTGTAGCATTTAAATTTTTTTTAATTTTCCATTTTTTCAAGAGTAGTTT
CTGCTTTGTTAATATTTATACACAGGCTACTTGTTGAAGTAAGTAATTAAATATATAACC
AAGTGCCTAAGTCTTTCAGCTGATGTACTAGATATTAAATTCTCCTAAGTTATGCAGAAT
CGTTTTTACAATTTTGATAAATTATGCACTAATGTAATGGCAGTTTTTTAAAATGCAGAT
TTAAGCCTGTACATTATTGAATCTGATGACTTGGCAAAAGAATCAGGTGCTTTCAGCTTT
CTTGAGAAAACCCTGTATGTAGCGTTTGCACTGACTAACAAGATGGTATTGCTGGGTTTT
TAATTTAAACTAATTAATTTGGATGTTCATTGCATTATCTTGGTTAAATATTGTTTATTG
TTACTTCATGTTGGGGTTTAATTTTCCTTGTTTTCTGACTGTTAGGTTGATAAGACTGAA
CCATGTAATAATAGAACAGTGGCTAACCTGTATTCATACTTAAAAACACGAATAGTTTCT
GCCCTGCTAAAATGTGACTGAAAAGTGTTTTGACTTGGCATCTGAAAGTTTGCAGTATGT
TCAACCAGCTGTGCCCCAGATTTGTGGGAGGTATTTTATAGAAACCTAAATTTCAGTCAA
CATTTGAAAACAAAAGCTGGGCATTCCTTCCTGATAATCTTACGTATAGTTTGTCTCTTT
GTTTTTCCCCCATTTCTTTAAGATTAGTTTGACTTTTATTATTATTTTTTTAATTAACTT
CTGTGAAGTTGTTTACTCTGAAAATTGTACTGGAATATTTTAAGCCAAGCTGATCTTTCA
CCAGGTGTACTGTATGTAAGGGCTTTTCCTGCTAGCAAGATGCTTAAACAGGATCATGTT
ATTGGTCGTCTGAGCTATTTAGTTGTTTTACAAAACCACAGCATTGTATCAGATAAGATT
TTGATAAAAAGTTTTGTGCACATTTCCAGGGGCGGGAGGGTTGACATTTCCCTGAAATTT
CTTGATCAGAATGAGTAAATACTGGTGTTTGATACCTGTCTTAATGAACATGCTCATAAG
GTGACTGATAAGTTGTAAATATACCTGAGAAACAAAAGGGTAGTTTTGATATTCTGGTGT
CAGTATGGAAGATCTTACACATTTATTTAATACTCAGATGTATAAAGATGTTTGTTTTAG
CATAACAGCACAGTAGCCTTGACTTAGTTTCCTTCGGTTGGTACTGTACCTTTTTGCCAT
GGCCAGTGCTCCCTATCCCTACAAAGACATTTTATTTATTTCACTCTGTAACCTGAAATG
AATAGGAACAAGAATTTTAAACCATGTTACATTAACTTATTTCTGACATTATAAATTAGC
CTAGGATATTACAGGAACATGATTGTTATATAATTTATATCAGAACCTTTCTATAAATAT
GCGCTTATTACATTTGAAATGCTTCCAATGTACTTTATTTGCTGTTTGTATTTCCAAAAA
GGATATGCAAACCAGTATGTCTATTTCATGGATATTTAAATAGTGAGATCTTCCATGTTG
AAGGTAATGTATTTTTTTTTAAGATTTTAAAATTGCTATTTTGTTACAAAATAGAGACCT
ATTAACAGTTTGAGAGCTCCTTATGTGCCCTCAGGGAAAGAACCCTCTGTGCAACAGAAC
TACGCAAAACATCTTCAGCACGTTCTGAGGGTGAATATATACTACATAAATTGATCTTGT
GTATTTAACCTTATCTTTTTAATTTTAAAATTGAAATTTTGAAACTTGGTTGTGCTCTGC
TGGAGGGGGTTGGGATAAACTGCTTAGGTGTTTGCCTACTTGTCCAGTGAAATTACATTT
GCATCAGTGTATGTATATACCTGCCAACCTTATTGATATGTCTCAGAACATTTATATTAA
AATAATGCTTGTCTTGCAGCAGGTGATCCCATAAAACAATAATTCCCTGTTCTTAAAAAC
TTACTCTTTTTCTCACTAATAACATAGGAATTGTTTCTGTATTGGGATTATTCTGTATTG
CATCCTTTATGTAGTGTCCATCTTCTGTTTCTCATGGTGGATTTAATGTGAAGTAAAGAC
ATTGGTTTTCTGCCACTTTAGAAGAAAGAGCAGTTTGTCTGTTCCTTCTTCAAAATGGTA
CCTACTGATGTCGTACAGGAAAAAATTACAAATCAGACCTAAGATGTGACTTATTAAAAT
TGGGAGCATTCCATGTCATTTGACCCTTTTACCAACATGTTGTGATGTACTTACGTTTGA
AACCAAAGGATATAAAGCAGTAAGAGAGGAAGTTTGTAATATTGGTAATAACTAAACTGC
ATATGTTGCCTATGGTCTAATTAGGAAAAAGTAGTCAGAGGTCTGGAAAGTGGGAAAATG
GTGAGTTTTCGTTTCTTTGTGTGATTTTTTTTCACTTTTTGTGGGTTTGTTTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1113, 7847..8144, 10679..10796, 14301..14534, 19329..19504, 26201..26401, 26867..26999, 27122..27240, 28511..28623, 35008..35316, 38951..39165, 39862..40295, 40891..41061, 42812..42958, 43280..43493, 43736..43820, 44296..44377, 44476..44610, 44872..44979, 45077..45225, 45869..48135
7914..8144, 10679..10796, 14301..14534, 19329..19504, 26201..26401, 26867..26999, 27122..27240, 28511..28623, 35008..35316, 38951..39165, 39862..40295, 40891..41061, 42812..42958, 43280..43493, 43736..43820, 44296..44377, 44476..44610, 44872..44979, 45077..45225, 45869..46061
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved