Equus_caballus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Equus_caballus NOL5A
Equus_caballus
NOL5A
22
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2069..2136, 2951..3082, 3975..4060, 4493..4563, 4821..4891
7397
GCTGGCTAACTGGGCGCTAACATCTAGGGCCATTCAACAGGGCGAGCAACACGTGGCCC
AGCAAAAGGAGCCCCGTTCTGCTGAAGCAGGGGAACGAGAAACCGACCTGGGAGGAGGTG
GGATCGTCTTCCTTTTCGACTTTATCTCCGGCCACCCTCATTTTTGGAAATAATAAATAA
AATACAATTTAAAATTGTATTTTAAGGCCAGCTACGAGGAGTCACGATTCCTCAGGGTCT
ACGCCAGTTTGCCCCAGGCTCCCTTCCGTTCTAGAGAGGAGGAAAGGGCGCGCGGCCCCG
AGGCTCCTGGGAAGGTCTTCCCCGAGTGGGAAGCCGGGACGAAGGGGTCCTGGGGACCTG
AGGCGCAGGGAGAGGTCTGGGGCCCCAGGTACGGTGCCACGGAAAGCCGAGGGGGCAAGT
TTCTGCCCGGGGAGGGTCGCCGCGGCCCGAGCTCTGCCTCCCGTAATTATCTGATGAAAA
CAGAGGGAATGGACCATTATCCAAAAAGCGCCTTTCCCGACCGTCCTGCGGCCCGCATGC
CGCCCAGATACGGCGCGTCCCCAGCAACAGCGCACGCGCCCGCCGCAGCGGCAGCCGGAA
AAGGCCAGCCAGCCCGCGCTCGCCCCCCGCACCCCTCCCCCGGGCCGTACCACCGAGGCG
GACCACAGACCAAAAGGCCCCTGTAATGTATTCTTCTTCTCCCTTTGATTGGCCCGACGG
TACCAGGGAGCTTGGGCCTCTGAAGCCGCGTTCCGCGCGCCAAAACCGGCTCGTTGGAAT
GAGAAGCGGGCGCAGAGTCGGTTGCCTTAGTAGAGAGTGTGTCTCTCGCTGTGCCCTTTA
AATTCTAATCCCGGCGCTCGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNACGGGCCTGGTGAACGCGGGGGGCGCGCTGACGCTCGCGCCCCCGGCTCCCGTTCC
CAAGTGCTGCTGCACGTGCTGTTCGAGCATGCGGTCGGCTACGCGCTGCTGGCGCTGAAG
GAGGTGGAGGAGATCAGCCTGCTGCTGCCGCAGGTGGGTGCCGCGGGGGGCTCGCCTTCC
GCGCCGTGGCCCAGCCGGCGCGCGGCCCCCAGCATGCACCGCGCGCTCCCACGTGGCCGG
CCGCGCCGTGGGGGGGGCCCCAGAGCCAGGGCGTCCTTAGTGCGTTCGGACTTAGAGACT
CGTTAGGACCACTCAGAAGTAAGCCTCCCTGACTCCGCCCCGTACCGACGAAGCAGATCT
GGGATTTAGGGCCCATGATCGGTTCCTTTTTTAAAGCGTCCGGTTGGTTCTTAGGTGCGT
GCAAGGCCGAGAACCGCTGCTTTACTGCGCCCTAGAGGCAAGAGCGAGGGAAAGAAACCA
TTCATCCTTTCTCCCTCAGGTGGAGGAGTGCGTGCTCAACCTGGGCAAGTTCCACAATAT
CGTTCGTCTCGTGGCCTTTTGTCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAA
CGCTGTGTCTGAAGGTGAGTCGGCCACCACCATGTATCTTACGGAGGTAAGGCAGACAGA
GTTCTGCTGCTGTTCTCCTAGGGGAGCTTGTGATAATTTGCTTTCCTCAGCTAAATTGTT
CTCTCTGGTATGGGCTAAGCTGTATTTAATGTGTAGAGGATGTAGTTTTAAAATCTTCAT
AGAGTTCAAGATCTGGAATATATGGTAGGTTAAATGTAATACCTTAAGTGCACAATCCAG
GATGTAGGCTTTATTTTCTTGTGGGCATTGGAATGATAAATGATACTTAAATCTGGTAGG
GCAGGCGAGTTTAATGCTAAACCCAATCAAATGTCATTCTCTGCTACTTTGTTCACTTGA
TTGAAAAGGGCAATTCCGATACTTAAAAGCCAAGAAAAAGAGGTTGGTCCCAGAAGGCAA
ATCAAGTATTTCATCATGCTCCGGGGTGTTTTAAGCTTTCGGTTATGTATTTCACTGTTT
TCTTGGACCTCCCATGGTTGATGCAGGCTTTGCAGTGATGACTTGAGTCTGTCAATCCCC
TGAGTGCAGTCACTGATGTCTCCATGTCTCTGAGCAAAGCCTGAAGGGGAGGGGTCTAGG
CATGCCATCCCAGCATGTTCTGCTGGACCATCGGAAGATAGATCTGTCACTTAAATCAGT
TGAGGGCCCAGGGTCCCTTTTATGATTTTCAGCATCCTTCAGCTTGTTAGTGGGAGCTCT
GTTCTTTGCTCTGAGGTGTTGTTCACGAGGACCTCCGCCTGCTCTTGGAGACTCACTTGC
CGTCCAAAAAAAAGAAAGTACTCCTGGGTGTTGGGGACCCCAAGATTGGTGCTGCTATAC
AAGAGGAGTTAGGATACAACTGCCAGACTGGAGGCGTGATAGCTGAGATCCTGCGAGGTG
AGACCATCGTCTGTTAGCATTCATGCCATTCTTCACATCTTCGAAGGAGATTCTGGAAAC
TTAATGGGGTGCTTAAGGTTGCTTCTGGGAAGCCTTCCTGCTTGGCTGGTGCCCATGGTG
CAGGAGCCAGCTGAGAGCCCTTCCTTGCTCACAGTCTTGCCCTCCTCCAGGAGTTCGTCT
GCACTTCCACAACCTGGTGAAGGGTCTGACAGATCTGTCTGCTTGTAAAGCCCAACTGGG
GCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATAT
GATTATCCAGTCCATTAGCCTTCTGGACCAGTTGGATAAGGACATCAATACCTTCTCCAT
GCGTGTCAGGTAAAGTGCAGGGGCAACCCCTGAGAACGGGGTCTTTGGCTCGTGGTTGAG
CTAGTTTTGAATACTGAGATCAAGACTAGCTTCTGTGGGTAGAACCATGTGGGGTGGGGT
GGGCTGGGCTGGGCCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGA
AAGAGGAGGCAGAGCAAACCCACCCCATATACACCTCAGCCCAGGCCCTTTGCCTGGTCT
GTATTGTGAATGGGGGGACAAGGAGTTGAGGAGGTTTTGAATGTGACTTCTTCCCCGGCC
CTTCAGGCAGAGAGTCAGTGTGGAGAGGGCTGAGGCTGTAGCTTTATTTGAGAGGACAGC
TGAGCCAGGGAGTGATTGTGGTTCTTTGCAGGGAGTGGTACGGGTATCACTTTCCTGAGC
TGGTGAAGATCATCAATGACAATGCCACATACTGCCGCCTTGCTCAGTTCATTGGAAACC
GAAGGGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCA
AAGCCAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTCAGTACAGAGCCTGGCAGC
CAAAATAAGGTATGGGGCTCTGGAGGTCTGACTTGCACATTTACACTTGGTGTCGCTTAG
GCATGGACATATCAGCCATCGATTTGATAAACATCGAGAGCTTCTCCAGCCGTGTGGTGT
CTTTGTCAGAGTACCGCCAGAGCCTACACACTTACCTGCGATCCAAGATGAGCCAAGTAG
CCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTGCGTCATGGGGAGCACAGAAATGGGG
ATTGAGGAACATTGCCATGTATATCCACACTGCTTTATTTCCTGACCCACCATATCTTCC
CTAATTGCACTTCAAGGGGAGAGGCGAAGCAGGGTTACGCAGTTGGTATGTTGGCAATTG
TAGCTTCCCTAATTCTTTGAATCCTTCTCCAGGTAGGTGCACGTCTCATTGCTCATGCTG
GCAGCCTCACCAACCTGGCCAAGTATCCAGCGTCCACAGTGCAGATCCTTGGGGCTGAAA
AGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACACTCAGGTACCACTTCTGGTGCC
CACTGCTTGTTTGGGGATCACAGTGATGGCTAACCAGGGCTCCCTGACCTATACAGGCCT
CTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGG
ACCAAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGTCTCTGGGAGCTGTGGGTT
GGCACAAGGTGGGGTGAAGACCCAGCCCAGCCTGAGGCTCGATCTGGAAACTGGGGGAAG
TAGGGAGGGGAGGAGCTGCCTTGGCTAATAGGGTTGAAATTTCTGATCTTGAAATCTCCA
CTGCATATTCTTCTCCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCA
TTTTCCACTCTACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGAT
ATCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTCTCTGGTATGGGGCGGG
GTTGGCAGTTGTGAGGAAAAGGGAGGGAGGGAGGCTGACGACCTTAGCAGCTTCTACAAT
GATGCCAGTATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGATACTTTGGGTCTGA
GTGGAGCTGACAGTAGAGGGAATACTGGGGTGGGGAGTAGTTTGCCCTTTAAGGGGCTGA
CAGGCTTTGTTTACCCACACACACACACATCCAGAGGTCCCCACAAGTGTATTTGGGGAG
AAGCTTCGAGAACAAGTCGAGGAGCGGCTGTCCTTTTATGAGACTGGAGAGATTCCACGA
AAGAATCTGGATGTCATGAAGGAGGCAATGGTTCAGGTCAGTTTGGGCTTCACTAGGTGG
GGGAGGACCATAGCTGGCTGTTGGAGGTGATGAGCTGTCTTAGCCTGACCTGGTAGAGTG
GAGGCAAAAAACTGATTTAATGAGCCTGATCCAGTAAAGCCAGAAGGGAGACCTGGAGAG
CCGCAGGTCTGGAGAACTTTTTTAGCACTTTTCTTTGGCCAGGCAGAGGAAGCGGCTGCT
GAGATTACCAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAGGAAAAGAAACGC
CTGGCTGCAATTGCTGCCCTTGCATCTTCAGAAAACAGCAGCAGTACCCCGGAGGAGTGT
GAGGTCAGTAGGCAGGTTAGCCCTCAGGCCTAGGTGTGAAGATCTTAGGTTGTAAGATTT
TCAACAGCAGGACACAGGTTGTGCTACCTTAAGCCATAGTCTTGAGTCCAGGCTTTTGGA
CTGAAATAAGGACCTGAAATATCTAAAACTACCTCTTGAGAGAACTTGCACAAGAGTACA
GAGAGCTGGTTGCAGTACACACGCATTTCCTGGCCAAGTGTTTTCTGTCCTTGGCTGCCT
CCCAGGAGTCTTCAACTGGGGGTAGTGTAAATTCCTGCTCTGCTTGTTCTCAGACGTGTG
TCTGGAGGTACCATTTTCTAGCGGGGATTGGGGAAGGGAGGTTTCAAATGTGCTAGGTTA
GAATCACTTCTCCTGGGATCTTCACATAGTGCCCAATTTGTCAAATAGTGTTTCAGGGTC
CCTTCTGGAACTTGGCATGATGATTCTATAGTGACCAGGATGGTGAGTTTTTCTATAAAT
TATTTAATGGGCTTAGATAATCACATTTTCTCCCCACCTTCTAAGTGGGAGTCACCCTTG
GGGTAGATATCCAGAATTATATCCATATAGTTAAAACTATCCCAGTGGGTTTTTTTTTTC
AAGATTTTATTTTTTTCATTTTTCTCCCCAAAGCCCCCCAGTACATAGTTGTGTATTCTT
TGTTGTGGCATGTGGGATGCTGCCTCAGCGTGGTTTGATGAGCAGTCCCTTGTCCGCGCC
CAGGATTCGAACCAATGAAACACTGGGCCGCCTGCAGCGGAGCGTGCCAACTTAACCACT
CGGCCACAGGGCCAGCCCCAAAACTATCCCAGTTTTAACAGCATTTCCACCAGTCTTTCT
GCCCTACTACTTGCCAGAATTTTAATGGAGTGTGTTCATACAATGATGAGTGACACTGCT
CCATGTCCACTTCCCTTTTTTAGGAGACAAGTGAGAGACCCAAAAAGAAGAAAAAGCAAA
AGCTCCAGGAGGCTCCTCAGGAGAATGGAATGGAAGACCCATCTGTCTCTTTCTCCAAAC
CCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGCTGGTAACTAGTGATCTTGAAGAGACAG
CTGGCAGTGGGAGTCTTCCCAAGAGGAAGAAATCTTCCCCCAAAGTGGAAACAGTTACTG
ACCCTGAAGAGGCAGGAAACAGGAGTGTCCCCAAGAAAAAGAGGAAATTCTCTTCCAGAG
AGGAGCCGCTCAGCAGTGGACCTGAAGAGGCTGCTGGCAGCAAGAGCAACAGCTCTAAAA
AAAAGAAAAAGCTCCAAAAGCTATCCCAGGAAGATTAGAATGGACATTTCCTGCTGGGGC
CTAACCCACAGGACATTTTCCAACAACCTAACCCATCCCTTAAACCCCAATAAAAACAAA
TTCATAAAGAGTCGATATACATGTTTTATTGAGGCACCTTAAACAGGTGTGGGTGGGACC
TATGGGCGGGACAGGGCATCAATGACAGCCTCAGTGAAGTCTTGGCAGGTAGCATAGCCA
CCCATGTCAGAAGTTCGAACCTGTGGGGGAGAATTGTCATCATCCCTGTGGCCTAGGCCC
CATCCCTAACCCCCCCTCCAACCACCACCTAATAGTTCCCTAAGGAAGCCAGCCCCAGGA
CAACCTAGGCTCTGCCCAGGTGGTGGTTATGGTCAGGTTAAGGGCTCTTCTCTGGTCCAC
TGTACTGAAGGGAGATGTAGGTAGTATGGTCCTTGTGAGGTTGGAGGGACTAAAGGGCTC
TAGCCCCCATAAGGGTGCAGGTGGCCGATGACAGACTTGATGAAGTCGGTTGTGGTGCTG
TAGCCGCCCATGTCTCGAGTCCGCACCTACAGCCACCACCGGCAACAGCCGTGGGGGAGA
AGAGAAGAGAGCCCATGAAGGGGGGGTAGGGCAATGTGATGGCAATGGGATCCAAGAAGG
GGTGACAAGGCTAAAAAGAAGATGCAATGCAGCAGAGATGCAAGGCCAAAAGAAGATGCG
ATGCGGCAGAGATGCAAGGTGGCCAGGTTTGGAAGAGCATAGGGGCCCATCCACTCCTGA
GAGCCAGAGCCACTCTTAGAGCCTATGCTGCAGCCTGGGCAGGATGGAAGGCTGAGCATG
AAGTGAGATGGGGAACACTGACTGGAGACAGCATGAGGATGCCTTGGAGGAAATAAGGAG
AGAGACCAGGCGGAGGAAAGATGAGGGCAGGGGAATGCAGATGAGGATGGGCTTCCAGAT
GTGAAGGTGCCCCCAGGGCCTCATCCTGCCTGCTATCTCCCTCTGCTCCTCCATCCCCCA
TACTCCCCCCAGAGAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1459..1573, 2295..2456, 2630..2828, 3211..3398, 3480..3631, 3812..3912, 4279..4427, 4654..4775, 4962..5102, 6023..6397
1023..1112, 1459..1573, 2295..2456, 2630..2828, 3211..3398, 3480..3631, 3812..3912, 4279..4427, 4654..4775, 4962..5102, 6023..6394
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved