Equus_caballus Locus RPL13
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL13
Equus_caballus
RPL13
3
snoMBII-202
1606..1677
4443
GCGGCTCAACGCCGGCCTCCCCGACCACACCCTAGCCTTCCTCGCCGAGCCCCAGCCCG
GCCTCCAACGCCCAAGGGTGTCTCAACCCGTCTACTCAGCGAGGACGCCGGCCTCCGAGG
GTCCCACTCGTGTCGTGACGTCCTGAAACCGCTGACCGGGTCCACCGAGGGAACCTGGCG
AAAGGAGGGCGGGCAGGAGGGTCACTGGGGGCAAGGCTCACGGGCGGCGGCGACTCCCGG
GCCCGTCGCGGAGAGCGTCAGGAGGACGCGCGGCGGGCAGAGCGGCCCCTGCAGCCGGCC
GCCGGGACTCTCGGTCCCAGCTGCCCGGCCGCGGCGGAGCTACCGACCCGCCGAGGGGGG
CTTCCGCGTGGAAACACCCGAGAGGAGCCGGGCGCCCGCTCACGGCCCGCTCGGCACAGT
TACGGGCCTGAAGTAGCACGGAAGCCCCGACGGGAGGTGGAACGAAACCGGAAGCCTCGG
TGAGAGGTCACACCGAGTCCGGCGTCGTGCAGAGCAGGAAAGGCCGGGCACCTACTGGAG
CCCGCTGAGCCCAAGCCGCGGCCGCCCTGTGGGTCGGGGCGTCCTCTTCCGGGGCCGCGA
AGAGCCCGCGGGCGGCGCCATGTCCACCAGGGACCGCGGGAGCGGCCGGGAGCGCACGGG
CGTCACTTCCGGGATACCCGTCTCTGATTGGTCAGAAAGCTCCGGCGCCTCTGGTTGGCT
GGGCCCACAACCATCCCAGGGGGCTTTGCGGCGCCACTTCCTTTTCGCCGGCCGTACCCG
GGAGGAGGAGGTGGGTAGGCTGGAGCTCGGCGCCATGGGAAGCCGGCGATTGCCATCGGG
TTCCATCCGCCGCCATCCGCGTAGGGCAGCTGCCCGCGCGGCCGAGGAAGGGACTCTGCA
GATGGCGTCGGGCCGTGACCCGGGCTCTGTGGGCAGGCGGGCGGATGGGACCCCGCGTCC
GCCGGAGCCCAGGTGCTGACTCGCTGCCTACCCCGCAGGCCCCTAGGCAGCAGCCATGGC
GCCCAGCCGGAATGGCATGATCCTGAAGCCGCACTTCCACAAGGACTGGCAGCGGCGCGT
GGCCACGTGGTTCAACCAGCCGGCGCGTAAGATCCGCAGGTGAGCGGGCGGGCGCGGCCT
CCTGTGTTCCCTCTGTTCTCTCCGTGTCTCCTCCCCGTCCCTCCGTGTTCCCGTGTCCTC
TCCGTGTGTCTCCTCTCCGTTCCTTCGTGCTCCTGTGTCTCCTCCGTGTGTCTCCTCTCT
GTTGCTCCGTGTTCCTTGTGTCTGCTTCGTGCATTTTCTTTCTCCCTCCATGTTCCCTGT
GTCCCCTCCGTGCCTCCTCCGTGTGTTTCCTCCGTCCCGCCGTGTCCCCGAGCGGGGGCC
CGGGGTAACCGGCGCTCGGCCTTTCTCCGTCCAGGCGCAAGGCCCGGCAGGCCAAGGCGC
GGCGCATCGCCCCGCGGCCGGCGTGCGGCCCGGTCCGGCCCGTCGTGCGCTGCCCCACCG
TCAGGTACCACACCCGCGTGCGCGCCGGCAGGGGCTTCAGCCTGGAGGAGCTGCGGGTGA
GTAGCGCGGCGGGCGCCGTCAGCCGTCCCTGCCGGTCGCATGATGACAGTCTCCGGAATC
TCTGCACGGCCTTGATGAAAGTGCACTGAACCCTTGTCCGTCTGACGGCCGGGCGCGCGC
TGGGGGCGCGGGGCGATCATCCCTCGGGGCTGCATCTGTGTGTCTCTGGACAGGTGGCCG
GCATCCACAAGAAGGTGGCCCGGACCATCGGGATCTCGGTGGACCCCAGGAGGCGGAACA
AGTCCACCGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAGCTCA
TCCTCTTCCCCAGGAGGCCCTCGGCCCCCAAGAAGGGGGACAGCTCGGTGAGTCAGTGCT
CGGCCCGAGAGGGGCCTGGAGGCCTGCCCGTGGGTCAGGTGGTGTGAGAAGAGGAGGCAT
TTACTTAGCATTTCTTTGTTTCCTAAGGTTGGGTGGCCTTGTATGGGTGGGTGATAGAGA
ACTGATGAATGAGAAAAAAAGCTGTTGGGAGATTGTACGTTAATTGTGAGAACTGCCACA
GTTCACGCTTGTGCTCAAAAGCGATCTGGCTTATGGTGATGGTGAGAGCTGTTTGTGTTA
GAGCTAGCTTTCTTACATTGGAAGTGTCTTGCTGTTTAAGATGCTTCATACGCAATGCAG
ACATTTCTAGAAGAACCTGCAGGACGCGGTTGACAGCGTCCATGCCTATGGACTTTCAGG
AGTAGGGTTTGGGGGGTGACTTTATAGTCCAGACCATAGTTTGTTCTGCCTGCATCCCTG
GTCACACTTGGGTGGTTGTCTTGTGTCTGCCCGTGTCTGCTGTTAGCTAGATGCACCAGG
ACCCCAGTGACACACTGAGGATGTGTGCAGAACACACGCACCTGTGGGGGCAGGCGCCGT
TCCACTTCCAAGCATGGGGATGGACGTCTAGCGAGAGGCGTGGGGCTGTCTCAGAAGGTT
AGACAGTTGGACCTCTTGGGGAAATGAGCTGAGTCCACTTGACTCTCCTTTCTCGTTAAC
AGGCGGAAGAACTCAAATTGGCCACCCAGCTGACAGGACCGGTTATGCCTATACGGAACG
TAAGTGGAGGAGTTGAGCGCGTGCGCATGTGAGGGCTTACTGGGGCGGGGAAGGGGTTGC
AGGGAGTCAAGGGCGGCACCTGGGGCCTGCGTTAAGATGTATAGGTTCACGAAAAGGGAC
TTTTTTCTTTAGTCCTGGGAAGAGCATCCTGCATTCTTAACAGGTGCACTCCTTGGGAGG
GCTTTGTCCTCCCTTTGAGGAAGCTTTGGGGACCCTCGCTTGCACTTCCTCATCTTTGGG
TTCTTTTTTCTCTGGGCATGTTTTGATGATCCTCTAACCTGCCCAGCAAGCGACCAGGCC
ATTGAGGTTCCTCTGGGACGGGTGGCGGGTCTGAGCACAGTGCCCCACCATCCTTCATAA
CTGAGGCAGTTGCTTCTGCCTCTGCTTTGAGTTTGGGGAGGTTGCTGAATCCTGGGGAGG
GTTATTACACCTCTGGCCTGGCGGCCTCTAGCCCCAGCAGTGGCCTGGCCAGGCGGCGTT
CCTTGATCTCCAAGGCGCCTCGGGTTCCGGCCTTTGGTTCTCGGCCTCGTCACAGGCGTC
CGCAGTGAGGCCTGAGCCCACGCTCTCTTCCAGGTCTACAAGAAGGAGAAGGCCAGAGCC
ATCACGGACGAGGAGAAGAACTTCAAGGCCTTCGCCAGCCTCCGCATGGCCCGCGCCAAC
GCCCGGCTCTTTGGCATCCGGGCAAAAAGGGCCAAGGAGGCCGCAGAGCAGGATGTGGAA
AAGAAAAAATAAAGCCTTGTGGGCAACTTGCGATAAATCTGCGGTCTCCACGTGACATCC
GTCTGAGGAACGGGCTGTGGCCTGGGGAGATGTTTTGTTGTAAGGGGAGCCTGCAGGCCT
GGCAGGGGACGAAGGTGTTGCTGCAGGGGAGCCCGGAGACTGGATTGCATCTTGCTTTTT
GTATTTCCGAACCGTTTGATTAGTTGCTGGTTGAATAATTTAATAGCTTTTTTTCTGGGA
AGGTTCCAATGCCTAATGTTAAGTAAAGTTGTCTATTTTAATCAGAGTAGTTTCTAGTTA
CTTTAGCATCCCCAGATTTGGGTAGTCAGCCTTGCCTTGACTCACAGCCAGACTCTCCCT
GGGCCCGTCTGCCCGTCTGCTGTGCCGAGGAGGGGCCCGTCACCCAAACGGGGGCCATGT
GTGCTCTGCAGAAGGCTGGCCTCTCCTACCCCTAAGACACCTGCAAATCCCTGCACCTAC
TTTGCTGCCAAGCGGCAGCCAGGACAGCCCCACTGCCCACCCCAGAGGAGGGCTGGAGGC
CAGCTGTGCGGTGCCCACATGGACAAGCACTGCGTTGCCTGTACCCCTGATGATAGCATG
GTGTGTGGCGGTTTTTGTTTTGTTTTTGAGGAAGATTAGCCTTGAGCTAACATTTGCTGC
CAATCCTCTTTTCACTGAGGAAGACTGGCCCTGAGCTAACATCCGTGCCCACCTTCCTCT
ACTTTCTATGTGGGACGCCTGCCACAGCATGGCTTGCCAAGCGGTGCCATATCGGCACCT
GGGATCCAAACTGGCGAACCCTGGGCTGCCGAAGCAGAAGGTGCGCACTTAACCGCTGCC
CACCGGGCCAGCCTCGGTGCCTGAGTGTTTTTGAAATTGGAGTCTGGTTTCCCTACAAGT
GAGATGCTCAGATACAGCTCCATCCTGGTCCCTGGTCCCTGGTCCCTGTTTGTCACAGCA
GGGCTTGCTGTGAGAGAAGCAGCTTTGGAGACTGACTTCTTAGTATGTTTTAGTGTTGAC
CCTGCAGCCCTGCAGATGCAGCTTTTTATGCACTCGGGTCACGGGCAATCCTGTGCCCAG
CAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1118, 1414..1555, 1733..1906, 2582..2638, 3213..3443
1015..1118, 1414..1555, 1733..1906, 2582..2638, 3213..3368
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved