Equus_caballus Locus SF3B3
snOPY snoRNA Orthological Gene Database
Equus_caballus SF3B3
Equus_caballus
SF3B3
3
SNORD111, SNORD111
2762..2840, 8053..8142
50911
TTTGTTTATTGCTATATTGAAGACAGATAAAATAATAAATAGTAATTTTTGGGGCTAGT
CGGTGGCACAGCGATTAAGTTCGCACGTTCTGCTTTGGTGGCCCAGGGTTTGCCAGTTTG
GATCCCTGGTGCGAACCTACACACCGCTTGTCAGGCCATGCTGTGGCAGGTGTCCCACGT
GTAAAGTAGAGGAAGATTGGTACGGATGTTAGCTCAGGGCGAGTCTTCCTCAGCAAAAAG
AGGAGGATTGGTGGCAGATGTTAGCTCAGGGCTGATCTTCCTTAAAAAAATAAATTAAAT
AAATAAATAGTAATTTGTAGTGTGTTGTGAGTGTACAATATATAGTCCCCAACCTTCAAT
TAAAAAGAGGGAATAAAATACAGTGTTAATGTATATTATTGCTTGTACATACAGAAAATA
TCTAGAAGGACACAATATAACTTGGTGAAATTGATTCCCTCAGAGGGGAGAACTGGATGG
CTCAGAATGGGTGGAGGAAGCTTTTTGCTGTGCTTTTGAATTCTGAACCACATGAATGTG
TACCCTATTCAGATACAAGTAAATGTAGACCTACTTGGTTTCTGTGACAGTAAAGGCAAA
TAGATAGTGTTGCGTTAATGGTTCAGATCCCAGCTCCCAACATTTTTACAGCTTGTTATG
TGACCTCAGGCAGGTGATTTAATTTTTTAGCCTCAATTTCCTCATCTATGAAGTTAGTAT
AATATTGAGTACTCTTATAGATTTCTTGCGAGATTAGAGGCGAAGTATGTAGTATAGTGC
TTGGCATATAGAAGGCACTCTAATTAAAAATAGGTTTTTCTTCAGTAGGCCTTTACTGGT
TCTGCTGTCTCCAGCCAGAAGTTCCCATATGGAAATGTCTGTTAAATTAATAATTTCCCA
GCTGATATTTTTTTTAATTTTATGTGCTCTTAGCTTTCTTTGACTTGGTATAACCAAGGC
CTGGATTGTGGAGTTGTGGGTGGCTCAGTGTTGCTGCCACCATGTTCCTGTACAACTTGA
CCTTGCAACGAGCCACTGGCATCAGCTTTGCCATTCATGGCAACTTCTCTGGTAAGTTCT
CAATTAACTATCTTTCTGAATTTAACATTTTTAATATTACTAGTTTTATGCTTCAAATTC
CTTTTTCAAATTCAAACTTTTTTCCTAAAGAAAATTACAGAAAGGAATTTTTTTTAAACA
TAGAGAACATTGTAATTTATATAATGCTTTACAGTTTCCAAAACTCTTTGAAGTACTTGA
TCTTAGCTGATCCCCAAAGGACCTTTGGAAAGTAAGGTGGCCTGATAAATGGTGGCATTG
AACAAATGATAATGGATAGAGATGGGTAGGAGTGGGATATCAGATAGGATAGGAAGCCAT
GTAAGCATTAGATAGTGTAGACCTGTACTAGGGCAGTGGGGATAGAAAGAAAGAGAAGGA
TATGAGTTTCTAGTCTGGGTGGCAGAGAAAATGACAGTAACATTGATAGCAGGTTAGTTG
GGACCAGAGAGGAAGTTTGGGGAAGGAGGAACTTAGTTATTTTAAACATTTAGTTGGAAG
TTGATGACAACTCATCCAGGTGGAATTATGTAGCACGCAGGGAGAGATGGGGACAAGTTG
GCTGCTATGCATTTGGAGGTGTTGATTGCAGTTCTGAAAGGTGAACTTTTTAGGAGTGAG
TTTAGAAAGATAAAGTATGTATTAGATGGCAGCTTTAAAAGTTCTTTGAGACACTACATC
AAACTGCACAAAAACAATATAATTTTTTAGAACAATAGCCTTAAAGATGGGCTAGAAAGA
GCCTTTGGAAATTTTTAATCTTATGAAGCTAAACATTATATGTTAAAACTATTTGTAGAC
AGCTCCCAATTATGCAGATTGATGGAAATCTTAGAATAATAAAAAGTTTTTAAAAATAAC
TGTGTAACCATTCTTTGAACACTTTGATACCGCTTTAGTTAGGTTATTTCAATCCTAGGT
AAATTACCTTTTAAGTAAATTTATAGAATAAATTAAAATATTGAGCTCCAAACATTTAGT
TATATTTATCTTTAGGGGCATTTTGATTCATTCAGGTCACTTTTTGGACTCTTTCTGATT
GTTAATGATCTTTATTTTTTGGCCATGTAGGAACCAAACAGCAGGAAATTGTTGTTTCCC
GTGGGAAGATCTTGGAGCTACTTCGCCCTGACCCCAACACGGGCAAAGTACACACTCTAC
TAACTGTGGAAGTATTTGGTGTTATCCGGTCGCTCATGGCCTTTAGGCTGACAGGTGGCA
CCAAAGACTACATTGTGGTTGGCAGTGACTCAGGTCGGATTGTTATCCTGGAATACCAGC
CGTCTAAGAATATGTTTGAGAAAATTCACCAAGAAACCTTTGGCAAGAGTGGATGCCGCC
GCATCGTTCCTGGCCAGTTCTTAGCTGTGGATCCCAAAGGGCGAGCTGTTATGATTAGTG
AGTGACTTGCTCTAAGAAGTGCATATCTGAGTCTTGGAGATGCTTAGTTTAGGAGAACAA
TGCTGTGATCTTGGCAGGGTGCCAATAAGTCACTTAACTGGGTAAAGTTTAGATCATATT
TGGGTTGACTCCATGGTTTAAAGTTGCTTTTCCTTTTAAAACGCTGGGAAAAGTCTTGGC
ACACCTTTTCTACTGCCTGTCTAGTTGAAAATAGATGTTTTTCCATTTCTTATTTATCTA
TAGCAAAAAGACTACAATGAATTGATTTTACATTATTAGACAGTGGCTATGATTGTTTTC
ACTGGCCTGAAGTGATGATTCAGGTTCATGTCTCTTCTCTGATAAACCTCTTGAAGAAAA
TCTGTGTATCTGATCAGGCCTCCAGAGAGCAAACCTTGCTGAGCAATCACAAAATTCTTA
AGTCTAATTCAGAGAATAAAGCTACCAATTTTATGAATTAGTTAGTTTTCCAATATCATT
AAATCTAAGGCACCTTAAAGAATTTTGAAGAGTTAGTGGGATGTTAAGATCCCTATTAGG
AAGGAGGTGGATATTTGATGCTGTTGTCTATGTTAGTGATAGCAAAATCCTAAGTTAATA
CACTTGTAGAGTTAGTGCTGGCTGTTAATGACTTTTTAAAAATAATCATGATGTGAATCT
AGCTAGTTGTTCTGTAAGCCCCTCTTTTCACTATCTGGAAATGTTGTATGTTTTGTCTCC
TTCAACTACAGGTGCCATTGAGAAACAGAAATTGGTGTATATCTTGAACAGGGATGCTGC
AGCCCGACTTACCATTTCATCTCCCCTGGAGGCTCACAAAGCGAACACTTTAGTATATCA
TGTGGTTGGTGTAGATGTGGGATTTGAAAATCCAATGTTTGCTTGTCTGGAAATGGATTA
TGAGGTAATGGCACCATGTGTCTGTCTGTCACTCTCCCTCCCCACCCGCTATTCCCTTTC
TCTCCTCCTCTCCCCTCTGAGTTTCTTCCACTGTCCTCACTGCTTTCCTGAGATTGTATC
TTCATCACACGTCTTATATCTCTTATGCTAACAAATCTTTTCCGTATTCCAAATGCCTTA
CTAAAACACTTTGGAATGTTTCAGAGCTTACCTGACTATATAATAGCACTTTGCTCTGAT
TTGAACAATCTCCCTATGGAAACAGGGTATTTATTGGGAAAAGCTGCCTGAAAAGGGGGG
TGAAACTGTCTGTTTTCACAGGGAAGTTTTGAAAGGTGGGGCTTACCATTCTTTCCCTTG
AATGAAAGGCAGTATCCACTAGAGGGAATCCTGGTCCTAGAAATAGGAGACCCAGGTTAT
TGTTCCAGCTCTGCTTTTACCTAGTAGTGTGAACTCTGGCAAACCATTTGGCATCTGTGG
GCCTCTTCTGTGTTTGTAAAATGGAGGAACCCTGATGCCCTTTCCAGCTCCAAAAATTTT
ATTTTATGGTACTGACTAGTTCTTGTGCCACTGTACTCCTCTGTAGGAAGCAGACAATGA
TCCAACAGGGGAAGCAGCGGCTAATACCCAGCAGACACTTACTTTCTATGAGTTAGACCT
TGGTTTAAATCATGTGGTCCGAAAATACAGTGAACCTTTGGAGGAACATGGCAACTTCCT
TATTACAGGTACTTTTCTCTCAGAGCTGCTCTGTACCCTTTTGCTTGGTCCATTTTATGC
TTAGCTTTATGAGGATTTATTTAATAGAATTTGGAAACTATAATCTGTTTGTAGTAAACC
TGAATACCTTGTCCATGTTTTGCTAAGGTTACAAGTTCATGCAGTGGTTAACTCTTATCC
TCTAGTGGGGACAGGGAAGAAAGGACAAGGAGAGCAGTCAGCTTGGAATATTGATTATTC
TTGATGGCTGTGATGTTTTGACTGTAGTCAGTCTTTCACTCTCATTAAGAAAATCAAAAC
CTAGTCCTTTGAAAAGACAAATGAAATGGACAAACACAACGAGATAAAATTGTATGTCCG
TGGATTTATAAACTTAGTGAAATAGAAACATTTTTGAAAATGTTTATAATACTGATAAAA
TTTTGATATTTTGTCAATACCAAAGTTGATCCAAGAAGAAATTAAGAACCTGAATAGATC
AGCATCCACTAAAGAAATTGGAGAAGTAGTCAAAAATCTCTTTCCTCCAAAAGATTTAAG
GTCTAGAATTTTCAGGAACCTTACATTTCTCCAGAGATTAGAAAAAGAATAAAAGCTATT
ATGCTACTTTATGAGCCTAATGTAACTTCAGTAACAAAACTGTAAGGACAGTAACAGGAA
ATATTTACAGGCTAGTTATACTTATGATCATAGATAAAAAAATCTAAACTTTTAGCAAAT
CAAATTCAACAGCATTTTAAGTGCATCATAATTAAGTAAGATTTCTGTAGGAGCTCAAAG
ATAGTCACTGTTAGAAAATCAGTATCTGTTTATCTAGTTTAGACTAGAGGAGGACAGGTC
TATTTGTGGTCATCTAAATTTCAGCAGGCCTGTGAAAGACTGATCCATTCTTTTCTGTTT
TGAGTCATTTGCACTTGGATTGATGTTTAAAATGAAATATGTCTGTTGTTGGGGTAGGAT
TTTGGAGAAGAATAATATAAGACAGCACTTGCCTTTGAGCATTAAATCTAAGGAAGAGAC
TATTTGTGTATTAAGAAGAAGAACCTTGGAAAATAGATTACACATTACTTACTGTAACAT
ACTACTACACCTTTCATTTATGAGGGCTTCATTTGTTCAAATTTTTATTGAGCCTCTACA
ATCAGTATGTGCAAAGTCAGTCCACTGGATCCTGGTCCTGCAGTGAAAAATTAAAAATGG
TGTCTCCCTTTTATGCAGGGTTGAGTCTAGTGGTGATTGTGTGCAAGTAACAAAAAAATT
GCCAGTGTGTGCCATATGCCATGACAGTGCACAAGAGGGGTCCGTAATCCAGGGAAAGGA
AGGAAATGTGTTAGAGAAAGCTTTCTGGAGAATTGCTCTCTAGGCTGAGACCTGAGGACT
AGTTAGGAGTTAGCTAGGTACAGCGGGGGTGGAGGAAGGAGTTTCTGTTGTGAGCAAAGG
GAACAGGATGCACAAAGGCCCAAATGCCAGAAAGAACGTGGTTCATTGAAAGAACTGGAA
GCTCATTGTGATTGGATCGTTAGAGCAGAAGGGCTAGGGTAAAGGTAGTGGTGAGGAGGT
AGCTACTGAAGGATTTTAAGCGGGGGAATAATAACCTGTGGAAGATTAACATTTTAGAAA
GATTACTTGCTTACATTTTGGCTAGTGGAATGGAGGATAAAAAGACTATAAGCCAGGACA
TTGGTCAGGAAGCTGTTTCACTAAACCAAGAGAGATTGGCAGCATCATGAGAGTTTAGCA
CCAAGAGAGCTGCTAAGGAAGTAGAATTAATAGAGCTTTGGGAGAGGAGAGAATTGAAGG
GTGACACCCAGGTTTCGATGTTGTCTATTAGTTGATGGTGGTGTTCTCTAAGGTGGAGAA
CCCAGGATGTGGAACAGGTTTGGGAGGGAACTTGAAGTTGTTTGTGAACACATTGTATTT
TTAAGCTGCTGTGGAATATTCATGTGAGAGTGTCTAATAGGCAGTTTTGGATTATAGGTG
TGAAGCTGAGAACTGAGTTTTGGGCTCGAAGCTAAAAATTTAGATGCGGTATCGGATATC
TGGACAGGCTGAGATCACCCAAACTGTGCTCCATCCTTGTCTAATATAATTGTTAGGGAA
AAGAAACACTTTGAATGTTTCTCAGCTTCAGGCACACCGTGGTGCTGAAGGAGAGAAGGA
ATTGAAAGCTAAATCGTAATTCATGGTTATGTCAAATTATTGGTAAGTTTTATTTCCTCT
GACAGTTCCAGGAGGGTCAGATGGTCCAAGTGGAGTGCTCATCTGTTCTGAAAACTATAT
CACCTACAAGAACTTTGGTGACCAACCAGATATCCGCTGTCCAATTCCCAGGAGACGGGT
AAGATCTTTGCCGTAAGAGAAGATATATTCGTGTTTGTGAAATGAACTTAATTTTTGTAA
TTACAGTGTAGTCTCTTAGTTTGTCTAAGTTTTAGTTTCTCTGCAAATGTTTTTAATAAA
GCTGGTAAAATATTTTAGTAAAAGCCAAACAGATTCTTTGAGAAGGGAAATTAAAACCCA
ACACAATTTCCATTTCATTCAAGAACCTATGGACATTATCAATTTGAAATTCCTGAAAGT
TTCTAGTTTGAAGGAGCCAGCCATATTTATGGAGATAAGTTGTCTTTCATTCTTTTTGTC
TCCCCTACCGCCATTCCAACATATAGAAAATTTTAAAAGAATAGAACAATTAATTTCTAT
ATGCCTGTACTTAGATTCACTAATTATTAATGTTTTGCTACATTTGCCTTTTCTTTCTTA
TGAAATATCTATATACTTTTTTAGACAAAACCGTTAGAACATAAGTTGCGGGCATTTTGA
CACTTCAAGAATCTCCTAAGATGTAACTCCTAAGAATAAGGAAATTTTCCTACATAACCA
CACTACCAATATCATGCCCAAGAAACTTACCCTTTTGTGTAATAGAATTATCTTATGTAC
AGTTCATATACCAATTTCTCTCATCGTCCAGAAAAGATCCTTATATCTACCTGTAGTCTC
CTTTAATTTAGAATATTTCCTCTCTCCTTTGTTTTTGGTCTTTAGAGTCTGGGGCTAATT
TTCTTGTAGTTTGTCCCATAATCTTTTTCCTCATGAGTGTATCCATATTAGTATTTTTTT
GATAGAATTATTACATAGGTGGTGATACATATTTCCCACTATATCACATTAGGGGCTCAT
AATGTTGCTTTGACTCTGTTGGTGATCTAAATTGATCACTGCGTTAAGGTGGTATCTTCC
TGCTACTCTTCATTGTAAAGATACTTTTCTGTTTTTGTACTTGGTGTGGAATCTGCTGGT
GAACTTTAAGACTAAATATTCTTTTCCCCAACATCTTTTCACACACTGGTTTTCTCCTCA
GTCAGTTACTACATTGGTAGTTGAAAATGGTGTTTTATTGTTTTTAATTTTAGCAGTTTA
TTATGGAAATTATTAGGCATATACAAAAGTAGAGTATAATGAACTTCTGTGTACCCAGCT
TCAGCAGTTATCAACATGTGGCTAATCTTATTTCACCTCTGCTTCCTTAGTTTCTCCTCT
CAACCCTGGATTATTTATCATCTTTTTGGTATTAATGTATAGGTCCTGGGTAGGACCTTT
TAGGACTTATTTAGTTTATCCAATACATGGCATCTGAGTAAGATTCCATCAATTTTAGAA
AACCTGAGAAGAAATTTATCAAGTTAAATTCTCAGTAAGGGATGGAAAGTAATTCGATTT
GGTTGATCAGAAATTTATTGAGCATGTAACTGTCAGGCACTTTACTTGGCTTCGGAGCTA
CAGAGAAGTATAAAACATGTTTGCCGTTGAAGACCTTACTTAGAGAAATACAAAATGTTG
GAAACTTTAAAAGAAAAAATGCAAAATCATAGCCAAGGGGATGCCTTTTAGGAACCAAGG
AAGTTGATGTAGAACAAGGCTGATGATGGATGGTTTGGATGGTAGTGTTGTGGACATGTA
ACAGTTTTATTCACAGCCTGAAATGATGATTCTTTACTTTTCATGTCTCTTCTCTGACGT
TTTTCTCTGGAGATAGTTCTTGCCTTACAATCTGATCAGGCTGTAGAGTGGAATTGTGGC
TATTTTTCAGTACATAGGCTTTATTCTGTATTTATAGTAGACAAGAATTTTTAGCTATGT
GTTTTACTCTTGTGGCTGGCAGGCTGCTCTTGGTCAAAGCTATCTTGTAAGAGAGGCTCC
AGATGCCTCTAGGCCTTGGGTGGCCTGCATGATCCCTGTTGGAGTTCCAGAAATGAGTAG
TGCTCATTTTCTAAGATGTTGGTTGTGTATTTCACTTTGCTAGAATGACCTGGATGACCC
TGAAAGAGGAATGATTTTTGTCTGCTCTGCCACCCATAAGACCAAATCGATGTTCTTCTT
TTTGGCCCAAACTGAGCAGGGAGATATCTTCAAGATCACTTTGGAGACAGATGAAGATAT
GGTAAGCAGAGCATGTGTGGAGGGGAAAAAATGAAAAAAACCATTGGTTACGGTTAGTCT
AGTTGATAAAACTTTCTACTTTTTCATTCTAAGTTAATATAATTAAATAACCTTATTTTA
AAAACTGATATTTGTGTGTATGTTTAAGGTTTACAAAGTGGTTTTATAAAACGTGTACAT
TACAACTAGTCTGAGATAGACAGGACAGTTAATACTTTACAACTTAAAAAGCTGGAAGCC
AAAAGCCTTAAAAAGTGGTTGCCTAAGGTGTTAAAGCTTTTAAAGTTTGGAACTGCTATA
TGATCATAGGTTTTCTCCCTCTGGTTAACAGACTTCTGGTCTGGTAGTCTCATGTACAAT
AATATGAGAGTGGGTAATGCCACTTCTAGTGAATAAGAGAAAGCTCTCCCTGTCTACTGA
AAACTGGTAATACCTCATACACATGGTCTGTTACTTCTTTCATCCTGTGGAGGAGCTCTG
AACACCTGGGCAATTTCTTAGATACCTCTTTAGCTCAAGAGTTAGCTGACTTTTTTTTGT
AATGGCCAGGTAGTATTTTCAGCTTTTGTGGGCTGTTAGGTCTGTTTGAACTACTCAACT
GCCATTGTGGAACAAAAGCAGCCATAGATCTGGCTGGCCCTGTGACTGAGTAGTTGGGTT
TGCACGCTTCGCTTCACTGGCCTGGGGTTTGCTTGTTTGGATCCTGGGCGCAGACCTACG
CACTGTTCATCAAGCCATGCTGTGGCAGCATCCCACCTAGAAGAACTAGAATGACGTACC
ACTATTATATACAACTATGTGCTGGGGCTTTGGGGAGAAAAGAAAAAAAAAAAAGGAAGA
TTGGCAACAGATGTTAGCTCAGGGCCAATCTTCCTCATCAAAAAGCATACCTTTAAAAAC
CCAAAAAACAAAAGCAGCCATAGGTAGTATGTAAACAAATAGCCATGGCTGGTCTGTGGG
CTGTGGTTTGCTGACCCCTGGTTTAGATATTAAGGACAGTATTTATTTGCTACTCTGTTT
ACAGTATCTTATAGTACTGGGCTACCTTCCATAAGAAAACTCAGAGAGACAGTTTAATGA
TCTCAGGAATAAAATCAATGAACAGAAGGAATTCTTCACAAAAGAGATTGAAACTAAAAA
AAAAAAAAAACCAATCAGAAATGTTGGAGGTGAAAAACACAGTGAATGAGATAAAGAAAA
ATCTACAGTCCTTAAATAACAGCTGATATTATGGAGGACGTAAACACTGTCTAGCTTCAC
TTGCCCACACACTGACTAAAATCTTTTTTCTTTTCACTCCAGGTTACTGAGATCCGGCTC
AAGTATTTTGATACTGTGCCTGTTGCCGCTGCCATGTGTGTGCTTAAAACAGGCTTCCTT
TTTGTAGCATCAGAATTTGGAAACCAGTGAGTAATCCTTTTAATATCCTAGTTCACCCTG
GTTACTGTAAAAGTTCGCAGGAGGGAGATGTAGCTGCAAGACCATGGAGCTTTTCATGAG
AATTTTTTAGTTTCTTCAAAACAAAGTTTTGCTCTTTCCCTTTTACGTTACTTGTGGGTA
GCTGCAAAAAGAGTTTGACAAGTGATCTCTCATTATTTCATTGAATAAATATTTATTGGA
CTACTTAGTATTAAACAGATGTTTCACAAACGTTTCACTTGTACAACTGTAAAGTTGAAA
CTTATCAGTACCCACGACTGCCCAGTCACATCACCAATCCTCCCAACCTCAGTATTTTTT
TTTTTTTTAAGATTTTATTTTTCCTTTTTCTCCCCAAAGCCCCCCGGTACACAGTTGTAT
ATTCTTCGTTGTGGGTTCTTCTAGTTGTGGCACGTGGGATGCTGCCTCAGCGTGGTCTGA
TGAGCAGTGCCATGTCCGTGTCCAGGATTCGAACCAACGAAACACTGGGCCGGCTGCAGC
GGAGCATGTGAACTTAACCACTCGGCCACGGGGCCAGCCCCCCCCAACCTCAGTATTTTT
TAAGTACGAATAAGTCATTTCTAGCAACTCGGTTATAAAATCTCAATTTTTGTTGTCCTC
CACCACTTTCAGCTGAGTGCTAAGTTCTGTTTTTAATTCTGTATCCCTTTTCTGTGGCAT
TAGTCTGAACTAGTTCACTGGTTTCCATATGGCATTTCATTGACTTTCCTATAAAATTCA
ACCTTTATAGTCATATCATTAATTGGACAAGATACAACCCAGGTGAAATAATTTCCCCGT
CCCTGTTTTACCATCTTTGATGGCTTTTCATTGCCAAATGGATGAAGTCTGAACTCTAGC
CTTGAATTTAAGACCAGTATCTAAGACTCCAATTTACTTATATGAGATAAGATGCCATAG
TCTTGCTTTCTAATTTAGGTTTTTCCAGTATCTGCTAACGTCTGTGCAAACCACTTATCT
AATGCTCAGTTTCCTCATAATTAAAATGAAGGTGTTGTCTAGGATTCTGTGCCATTCCTG
CCTTGTCTCCAACTGTTCTCCCTGTCTTAAACATGCCTTTTACTCATCCTCATAGACTTT
ATTTATTTATTTATTGTGAGGAAGAGTGGCCCTGAGCTAACATCTGTTGCCAGTCCTCTT
TTTGCTTGAGGAAGATTGTCACTGAGCTAACATCTGTGTCAATCTTTTGTCTATTTTCTG
TGTGGGACACTGCCACAGCATGGCTTGCTGAGTGGTGTGTAGGTCCACACCTGGGATCTG
AACTCTCAAACCCTGGGCTGCTGCGGTGGAGCGTGTGAATTTAACCACTATGCCACTGGG
CCGGGCCCCTTCATAGACTTTATTCCAACTGCTCCTTTATTACTCCTTTTCCTGGCTTAG
ATGTCTTCCGTTGCGCTTTTCACATATAGCCTGTTGTCTATCTTCATCCATTTCTAATTT
TTTAGTTTTTTCTTAACAAGGGATTTTCATTGTAGAAAAGTTAGAAAGTGCATGCAAGCA
AAAGTGTCACTTGCAGTCCTTCCACCCAAAGATAACATTTTTGTGTAGGCTTCCTGTGTG
TGTATATTTAAATGTTTTACAAAAATACAACTGTGCATATTTACTGTTCTGTAATTTGCT
TTTTTTAACAGTAATATGTCATAAATATCTTTCTATACTAATAAATACAGATCTGTAACA
TCATTCACTTTTTTGGTTGCATCTTTTTTTCCTCCACTTTTTCATGGTAAAATATATATA
ACAAAATTTGCCACTTTAACTATTTTTAAATGTTCAATTCATTGGCATTAATTACATTTA
CGGTCTTGTGCAACCATTACTACTATTATTCCGAATTTTTTTGTCACCCCAAACAGAAAC
TTTGTAACCGTTAATGCAATAACTTCCTATTTGCCTCTCCCCCAACCCCTGGTAACCTAA
GTGGAATCATACAATATTAGCCCTTTTCTTTTTTTTTTTATTTCTTTTTTTTTAATTGAG
TTAACGATAGGTTACAATCTTGTGAAACCTCAGTTGTACATTATTGTCTGTCAGTCGTGT
TGTAGGTTCACCCCTTCCCCTTTTTGCCCACCCCCCACCCCACCTTTCCCCTGGTAGCCA
CTAATCTGTTCTTTTTGTCCACATGTTTAAATTCCTCATATGAGTGGAGTCATAGAGATT
GTCCTTCTCTATCTGTCTTATTTCACTTAATAATATTTGCCCTTTTCTGTCTGGCTTGTT
TCACTTAGCATAATGTTTTCAGGGTTCATGTGTAGCGTGTATCAGCACTTCATTCCTTTT
TATCCCCGAATAATAATCCATTGTATGCATATATTCCATTTTGTTTATTTAACTGTTGAT
GGAACATGGGTTGTTTCCACCGTTTGGCTCTCATGAATAGTGCTGCATTGGATATTGGTG
TTCAAATAATCTGTTTGAGTTTTTAATTCTTTTGGATATGTACCTGAGAGTGGAATTGCT
GAGTCATATGCTAAGTCTGTTTAACTTTTTGAGGAACCACTAAGTTTTCTCTATCAGCTG
CACTATTTTACACTTCTACCAGTAGTGTATGAGGGTTTCAATATCTCCATATCTTCACCG
ACAATTATTTCCTGCTTTTCTGATTATAGCCAGTAGGTGTGAAGTAGTATCTCTTTGTGG
TTTTGATTTGCATTTCCCTTATGATTAGTGATGTTGAGCACCATTTCATGTGCTTTTAAC
CCATTTGTATATCTTTGGAGAAATACAGAGTTTTTTGCCCATTTTTTAGTTGGGTGGTTT
GTCTTTTTGTTTTTGAATTGTTAGAGTTTTTTGTATATTCTGGATATTAATCCCTTAACA
TGTACATAGTTTGCAAATATTCTTTTCCATTCTGTAGGTTGTCTTTTCATTTTGTTGATA
ATGCCCTTTGATGCACAAAAGTTTTTAATTTTGATGAAGTTCTTTATCCATTTTTTCTTT
TGTTACTTGTGCTTTTATATCATATTCTTAGAGAATCTGTTGCCAAATCCAAGGTCATGA
AGGTTAACCTGTATGTTTTCTTCTGGGAGTTTTATGGTTTTAGTTTGTACCTTTAGGTTG
TTGGTCCATTTTTTTGTTTTTTAAAGATTTTATTTTTCCTTTTTCTCCCCAAAGCCCCCC
AGTACATAGTTGTGTATTTTTAGTTGTGGGTCCTTCTAGTTGTGCCATGTGGGACACTGC
CTCAGTGTGGCCTGATGAGCCATGCCATGTCTGTGCCCAGGATTCGAACTGGCGAAACCG
TGGGCCACTGAAGCAAAGCAAGCGAACTTAACCACTCGGTCACGGGGCCAGCCACAGGTT
GTTGATCCATTTAGAGTTAATTTTTTAAAAAATCTTATTGAGGTCCTAATAGTTTATAAC
ATTGTGAGGTTTCAGTTGTACAGTATTATTTGTGAGTCACCATGTAAATGTGCCCTTTTA
TCCTTAATGTCCACTCCCCCCCACCCCCTTCCCTTCTGGTAACCACTAATCTGTTCTCTT
TGTCCATGTGTTAATTTATCTTCTACATATGAGTGAGATCATACGGTATTTGTCTTTCTC
TGTCTGGCTTATTTTGCTTAACATAATACCCTCAGGGTCCATCCATGTTGTTATGAATGG
GGTAATTTTGTCTTATTTTATGACTGAATCATATTCCATTGTGTGTGTGTGTGTATATAT
GCACACACACACCATATCTTTATTCAATCATCAGTCGATGGGCACTTGGGTTGCTTCCAC
TTCTTGGCTGTTGTGAATAATGCTGCAGTGAACATAGGAGTGCATAAGTCTCTTTCAATT
GTTGATTTCAAGTTCTTTGGATAAATAGCGAGTAGTGGGATAGCTGGGTTGTATGGTATT
TCTATTTTTAATTTATTTTTTTTTTTGTGAGGAAGATTGGCCCTGAGCAAACATCTGTGC
CAATCTTCCTCTATTTTATTTGGGATGCTTTCACAGCATGGCTTGACGAGTTATTTTCTT
CTGCCTTGCTGTCCTTAATACTTTTTCTTTGTCATTGACTTTTGCCATTTTTACTACTAT
ATGCCTTGGAGAAGGTCTTTTTCACATTGATATAATTAGGAGTTCAGTTAGCTTCTTTAC
TGGTATTTCTAACTGCTTCCCGAGGGTTGGGAAGTTCTCAGCTACTGTTTCTTTGAACAA
GCTTTCTGCTCCATTCCTCCTCTGGTCTCCCTGTGGAATGCCCATAATCCTTATCTTACA
TTTCCTAATTGAGTTGGATATTTCTCTGATAATTTCTTCATTTCTTTTTAGTCTTAGTTC
TCTCTCCTCCTCCATCAGAAGCATTTCTATATTTGTGCGCTCCAGATTGCTAATTCTGTC
TTACATAATATTGGCTCTGTTATTCAAGGAGTCCAGATTTTTCTTTATCTCATCTATTGT
GTTTTTCATCTCTAGCATCTCTGATTGGTTTTTCTTTATAGTTTCAGTCTCTTATGTGAA
GAATTCCCTCTGTTCATGAATTTTATTCCTGATTTCATTGAACTATGTGAATTTTCCTGT
AATGCATTGGGTTTTTTTATGATAGCTATTTTGAATTCTCTGTCACTTAGATTGTAAATT
TCTGCGCCTTCAAGATTGATTTCTGCGTGTTTGTCATTTTTCTTCTGATCTGGAGTGTTA
ATATATTTCTTCATACTGTTTGATGGCATGGATTTGTGCCTTGGAATACTGATAGTATTG
ATAGTATCTGGTCGCAGATTCCACTTGCCGCTACTTGGGGGGATACTCAAGGGATGTATA
TCCTGAGCCTGCTGTGATCCCTGGTGTCTGTCCCTGTCCTTCAGAGTCTATGCTGATAGG
GCCTGTCTGTGATTGCAGGCTTGCTCACTTACAGCTGCTGCTCTTCTAATATATGCACGG
TCACTCTTGCCAGCCAGCTGAGCTGGAGTACCTGGTGAGTTTCTTTCCTGTGCGTGATCT
GGGGGTGTTCTCACTGTCTGCTCTCCAGGAGTGCTGGCTTGATGAAGACACTCCCACAAG
AGCTTAGCCTCCTCTGTTTGGAACTTTCCCAGAGGCTGTGAGGGAACTTGAAGAGAGAAG
GTGTTCCTGTGGAGAGCTGCCCCTTCCCCCTGTTTTCTCATAGCCACGCATGGTCTCACG
CCCTGGGTTGCAGCTGGGGATGGAGAGGAGCTCCACTTACCTCCTTCTACTTCCTCCTGG
GTGGTCCAGCATCTCCATCTCCAGACATATGGCTGTGTGAGTCTCTCACACATGTTTTGT
GTTGTGTGACTGTCCTCTGTTAGTTTATGAATGTCCTTTTCATTGTATCTTAGAGGGGAA
AGTCTAAGGGAAGAGCTCATTCCACCATGACGTTGACTTCACTCTCTCCTTGAGCTAATT
TTTTATGTTGTGTGAGGTAGGTTCAAGTTCATTCTTTCACATTTGGAAATCCACTTGTCC
CAGCGTCATTTGTTCAGCGTAGCATTACTCTTTTTTTTTCTTCCTCAGAGCCCCAGTGTG
TAGTTGTGTATCCTAGTTGTAAGTCATTCTAGTTCTTCTATGTGCGATGCTGCCACAGCA
TGGCTTGATGAGTGAGCAGTGTGTAGGTCTGCGCCCAGGATCCAAACCAGTGAATCCCAG
GCTGCCAAAGTGGAGTGCCTGAACTTAACCACTCAGCCCTGGAGCCGGCCCCTTGTAGCA
TTACGTTTAATGCCCATACAATATGGCATTATGTGGGCACAAGTTAATTTACTTAAATAA
ACTTTTATATGTTGTTGGATAGACTTTCTTAAGGATATGGTTGCTGGATTAAAGAATATA
CACCTTGTCAAAGTTTTTGACACATTGCTGAATTACTGAAGGTTTGTGCTGATTTATACG
TTAGCAACAGTCTGTATTGTCTGTTTTCCCACATGTTGTCAAGACTGTGTGCTCATGGTC
CCTGACTTATGATGGTTCACCTTAATGATTTTTTGACTTTACAATGGTGGGAAAGCCATA
CACATTGTTTAGAAAGTGTACTTCGAGTTTTAATCTTTTCCTAGACTAGCAATAATGCAG
TATGATACTCTTGTGATGCTGTGCAGTGGGAGCAAGCCACAGTTCCAGTCAGCCACGCAG
TCGTGATGGTGAACATCCGATACACTTATAACCATTCTGTACTCATACACTCATTCTTTG
AGTACGGTATTTAGTACATTATGTGAGATAGTCAGCACTTAATATAAAATAGGCTTTGTG
TTAGATGATTTTACCCCACTGTAGGCTTATGTAAGTGTTCTGAGCATGTTCAAGGAAAGC
TAAGATAAGCTATGATGTTCAATTAGGTTTTTTGGTTTTTCTTTTTGAGGAAGAGTAGCC
TTGAGCTAACATCTGCCACCAATCCTCCTCTTTTTCCTGAGGAAGACTGATCCTGAGCTA
GCATCTGTGCCCATCTTCCTCTGCCACTGCTTGGCTTGACAAGCGGTGCCATGTCCATAC
CTGGGATCCGAACTGGCTGCCAAAGTGGATCGTGTGAACTTAACTACTGCGCCACTGGGC
TGGCCCTCAGTTAGCTTTATTAAATGGATTTTTGATTTAATGATATTTTCAATGATGGGT
TTATTGAGATGTAACTCCATCATAAGTCAAGGAAACTCTCTCCATATATCTTTTATGCTT
TGCTAATTTATTGGGCAAACATTTTATTAAAGAGATTGGACTTTTTTCCTTTGCTTGCCT
AGCAGTATATCTTCTGTTCATTGCTTAGTCACATCTCTGCCTAGTTTTCTATAGTATCCT
TTAGTAATGGTTAGGGACATTTTTGGGGAGACAGTAGAGCATAGTGAAAACTCTGGAGAC
ACAGTGTCTGAATTATAATCTTGGCTTTATGTTTTCTGGCTCTATATTTTCTGCCTCAGT
TTTCTTATTTATCAAGTGGGGATAATAATAGTGTATACGTTTTTGGATTTTGTGCGTATT
TAATAATACAGATGCCAAGCACCAGTAAGTACTTTGTGTTGTAAGTGTTTAGTAAACGTT
GATTACTATCTTTCCTGTTATTTTCCTCTGGTAATGTAGAAAGTTATGGAAAATGAATAA
AAGAGCAAATAAATAATAAAAATCACCCATTATCCGAGTATCCCAGAATAGTCGCTTTAA
CATTTTGTTGCATCTACTTCCAGTATTTTTACTTTCTAGTATTTATATGTAATTTTATTT
TAGAGAACTACATCATTCTCTAAAAAATTATTGATCTACTTTTGCACATAAGCATTATAT
CATAATTTTTTTCCATATCAATAAGTCTTTATTTTTCACTTAAAATTTTTATTTTTTATC
ATGAAAATGTTCTGACAGGTACATGAGAAGACAGAATAGTATAATTAATGAACCTACGTG
TGCCCACCACCTAGCGTCAACAAAGGTCAACCCATGGCCAGTCTTGTTTTATTTATACCC
CACCTCCCCAGAATAATAGTAATTCCTTAATATAATCTAATAGCCAGTTAGTATTCAAAT
TTTCTATTGTCTCGATAGTTTTTAAGTTGATTTGTTCAGATCAGGATCCCAGCATGACCC
ATATATTGCATTTGGTGTATGGGAAACATTTTTAATGGCTGATACTATTTTATGGCCATG
CTCCCTTTTGGTGGCTATTTTAAGTTGTTTGTTCTTTTGCTATTAGAAACAGTACCATGG
GGAACATTGTAGGTACATCTTTGCATGTTAGCTGAGTAAAGCAATGGTTTAAATTCCTAA
ATGTGGGACAAAATTTTGATAGGGAATCCCAAATTGTCCTCCAAAAAGATGACATCAGTT
TACATTCCCACCAGCTGTGTATGACCTTTTTCCTCTCAGTACATGACAAAGGGCAAGTTA
ATAAGCTCTTGAAAATCATTATGAAAAAGACAAGCAGTTCAGTCAGTAGGAAAATGGGCA
CAGGGTTCGAGTATGCCTTTGACAGTAAAAGAAATACCAGTGGTCTAAAGGTGTAATACA
TAGAAAGCTTTCAAGCTTATTTATAATTGAAGGAATGCCAATCAAAATAAGGTGTCATGT
TTTCACCAGCGTATTGGCAGACATTAAAAACTTAGATATAACCTATCTTAACAAGGCTGT
GGGTGGAAGCGATAGCCGCAGACATAGAAGGCTTTATCTTCTTGCTCATTAACCTGTACA
GATTGTGTGTTTGTTAAGATTTTGCATCCTGGTTGTCTATTAAGTCTTCTAAAAGGACTT
AGGAATATTATGTTGATTCCTTTTGTTCCGAAGATTAATAATGAACATTTATTGAGTACT
TGTCTCTATGTATCAGGCACTGTTCTAAATGTTTTTCTTACATTGTCTTAGTTTGAGTTC
CCCTGCAAAACAGAGCCTGTGACAAGGACTTGGGTGGAGGTAGATTATTGGGAGGTAATT
GCAGGAAGCAGGAGTGAAGGACCAGTGGGGAGAGATAGGGAAAGAGGAAAAGCCAATATA
ATGGCTTGTTATTGAGGTTCCTGCTGTGGACAGTGGGAACTTGCTTCCGTCAAGACCTGG
CAGAAGCATGCAGAATGGCTTACACCACCAACTCCTCTCTCCTGAGTTGCATGTTACCCC
TAGGAGCATAATCTCTCCTGCACATCTTCTCGCTCTGGCAGCTTCCCACAAGATAGAAGT
TTTTGGGGCAGAGAGTAGTGGAAAGACTACAGTATACAGGTGGGATGCTTGTTAGAGAGT
TTGAACTTGTGAGAAATTACCCATTGCTGCTGCAGCTGAAATTTGGAAGACTTAAGAATG
GTGATTTTGAGGCATCAGAAACATGTGCTATGGGTGTTAACTCATTTAATCCTAAAGAAA
CCTATTTATTTATCAATCAGACACTTAATTTAGCATTTACTATGTTCCAAGCACTGTTCT
AAGCGCTTTACAAATATTAACGTGTAACATTCCCTATGAGACAGAGCCATTATCTCATGT
ACAGTTTAGGGAACTGGGTCACAGAGAATTTAAGAAATTCAATCACACAACTAAATCTAA
CTCAAACCCAGACCACCTGGTTCCAGCATCCCTCCTCTGAAGCAGAACTCTATAGTCACA
GAAATTGTTTTACTAAGATTCAGCCAAAGCAACCTTTCCTGTGATGGTGATAGTGAGCCC
AGCATCTTTTTGGTTACTGGCAGTTACTAGACACTGAAGGTGTCTTTGACAGCTAGTCTT
TATCATCTGTATATAGACATCTTGCCTAAATAAGGGGTTCGTATTAGTTAACTTTTTGTA
TGTGTATCCTATCTTCTCACTGCTTTTTAAAATCATTCAAGGATAATAACCCTATTTGTT
TTTGTTTTTACATTTTTTAATATATTTTTTTAAGGAAGATTAGCCCTTAGCTATCATGCA
CTGCCAATCCTCCTCTTTTTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCTGTGCC
CATCTCCCTCTACTTTATATGTGGGACGTCTGCCACAGTATGGCTTGATAAGCAGTGCGT
AGGTCCGCACCTGGGATCTGAACTGGTGAACCCCAGGCCGCCAAAGAAGAGTGTGCGAAT
TTAACCTCTGTGCCACTGGGCCGGCCCCTAACCCTATTTGTTTTTTTCATAATTTAGCAT
AGAATCTGATGTGTTTACCAAGTGTTAAATGCTGAGGTTTATTTGTCTAACGTTTATTGA
GTAACTTATGTATTTTAGACCCTGATTTAGTCATTTTATTCTGCTTCTAAAAAGCTGCAC
TTGATATTGTTTAAAGTGCTCTGTATTGAAGGTCCAGTATATTACTTAAAGAATAAACAT
GACTGGTAGTTTGGTGTTTTATGTTAATTGAACTGCTTCCCAAAAGCTCAGTGCATGCTC
AGTTTATGATGGTATATTGTTACAGATTATCTACTCTCAAATTGCTTTCCCTCTTCCTTT
TGTGGTTTGCCTTTGAATCAGTTCACTAAGGATTATTAGCCAGAAGACTGACAGGAGAAG
GGCAAGATGACTTGCTTATTGTCTCTGGGTACATTTATGTTTGGTTTTGGGGAAGAATAC
TATAATATCTGCATACTTTTGCAAGATCACCACCAGTTCTTGCTTTTTGTTAGATTTGGC
CTGGTCATTGGTTAAAATAGGAAATGGTTATGGGTTTTCTTTGGACTTCATTCATCTGTA
TTTCATTTTATTTGACAAACACCGTGCTTACTAAGTGCTGTGCACTAAGTACTTATTGAA
TAGCACATTCCTGTAGAATTCAGTTTTATAAATGAGGCAAGTGAGGCACAGAGGGATTAA
GTAATAATATGTGGCTAGTTAAGGAGCGGAGCTGGGATTCAAACCCCGGCACTCTAAGGG
AAGCCCAGTGCTTTTAACTACTCTGATGCTAGGATCCTTCCAGTGTACCAGTTTAAATTC
AGTATTCTTAATTTCTTCATCCATGTTCCTTTCTTAAGAAAAAGAAAGAGAAGGGGCCAG
CCCCATGGCTGAGTGGTTAAGTGTGCACACTCAGCTTCAGTGGCCCAGGGTTTCACTGGT
TCGGATCCTGGGCATGAAACTAGCACCGCTCATCAAGCCATGCTGAGGCAGCATCCCACA
TAGCAGAGCCAGAAGGACCTACAACTAGAACATACAACTACGTACTGGGCGGCTTTGGGG
AGAAGAAGGGAAAAAAAAAAGATTGGTAACAGATGTCAGCTCAGCTGCCAATCTTTCCAA
AAAAAAAAAAAGAAAACGCTACTCGGATAAGCAGAGATTTCAAAGTATAGATGCTAACTC
AATCATGTGTGTTATAATTTTGATTGGATAATTGTGAATTGCTTTATGAACATTATATTG
ATGGCAGATGTTATCTTCAGGCAGAAAATGTTTTAACTAAAGTCTTGTTTGCTTCTCCCC
AGTTACTTATATCAGATTGCACATCTTGGAGATGATGATGAAGAACCTGAGTTTTCATCT
GCCATGCCTCTGGAAGAGGGAGACACGTTCTTCTTTCAGCCAAGACCACTCAAAAACCTT
GTGCTGGTTGATGAGTTGGACAGCCTCTCTCCCATTTTGTTTTGCCAGGTGTGAATCTTT
CTAGTCACCTCCACAATGAGCAGCGCCAGCCAACTGTTTTTGAATCTGAACGAGTTTAAA
GTTTTAACTCCAGTTCAGTTAAGGACTAGTCTGAGAGTCCAGTTTGTCAGTATATCTATG
GAATTGCCACATTGTAAAGGTGAAGCAGCCAAAGGTAGACGTTGGGGTACTAAAAATTAT
GTGAATCCTTGGACTTTTTTTTTTTCTTTTTTAATGTAAAACTCATGTTCAGTGGAGAAA
GTTAAACCATATGAAAGGTGAAAAGTAAAAGCCCTGGCCTTGATCTTTTCAACCTTCCAT
TCCACTGAGGCCGCTGCTAATAACAGTTTCTTGTGCTTGCTTCCAGGCGTTTTCTCTGCA
TCCATAAGCGTGTGTGTGTATGTTGTATTTTTCTTTTCTTTTTTACTATTTTATTTTATC
TAGGTCACATTGGTTTATAACATTATGTAAATTTCAGGTGTACATCATTATATTTCGGCT
TCTGTATAGACTGCATTATTTTCACCACCAAAAGTCTAGTTTCCATCTGTCACCATACAA
ATGTACCCCTTTACCCTTCTTGTCCTCTCCCTAACCCTTTCCTCTCTGGTAACCACCAAT
CTGTTCTCTGTATCTGTGTGTTTGTTTTTTTTATCTTTTGCATATGAGTGAAATCATGAG
ATATTTGTCTGCCATTTCAGTTTGGTGGTTTTCTGTGATGTTTTTCTCAGTGTCCTCTTT
CTTTATGATTTGTGATTCTGCTCTGATTTTTTGTTTTGTAGTTACCATGAGAATTGTCTA
AAAGATCTCATAAATGAGATAGTCCTTTTTCTGCTGATAGCATGTTATCTCCATTAGCCT
ATGCATGTTCTGTCCTTTTCTCTTCCCCTTCTGCGTTTTTGTTGTCACAAATTATCCTTT
TTTTATGTTGTGAGTTTATTACCAAATTGAAGTGGTTATAGTTATTTTTGATGCTTTCTT
TCCCTTTAGCTTTTTAAATTGTTTATCACTTAATTGTATCATATCAGAATAACCTATTCT
GATAGAGAGCTGCAATTTTCTGATTCTGTCCAGCATGTTGCTCGAAGCTTTGTAAACCTT
TGCTTTTTTGTTTCAGATGTGAGGGCTCCTTTCAACAGTTCTTGTAAGGCCAGTCTAGTG
GTGATGAACTTCCTCAGCTTTTGTTTGTCTGGGAAAGCCTTTATTTCTCTTTCATATCTG
GTTAACTTTGCTGGTGTCAACGAAAATAATCCATAATGAATCTATAAATCGAAATTGGTG
TGAGTTTATTATGAGCCAGAGCTGAGGACTAGGTTAGCCCAGGGCTTGCCTTCTCCGAGG
AAGGAAAGGCACCAAAGAAGTGGGGTGTACAGAGTGGTTATGTACCCTCTTGGCACAAAG
AGCATACATCACATATGATAGGAATGTCCTTTTTACAACAGTCATGAGATTGCCTAGCCA
GCACAGCACGGCTGTTCACACAGTAGGTAGTAGGTCTGCTGTCTCGAGCTGGGTGATCAC
AGGGTGAGCGCAGCAATCAATTCGTAGCCTAGGGAGGATGCTTATCCTTAAGGAAATGCC
AGCGTGGGGGAAGTTGCATCTTTACTTTAAGGCTGCTTGTTCCTGTCTTTGGAGCATAGC
AAATGCTTAAAGCAGATATACAGTGCATGCTCAACAATCATGTTAGGCCCTTTTGGAAAA
ACAAGGTCAGGCTGAATTAGTTTTACACCAAATGGCTTTCTCATGTACTCCAGTATATCC
TGTTGCTTCCCATTTATCACTGGATAGAGTATTCTTGGCTGATAGTATTTGGTTTTCAAT
AGTTTGTATATATCATCCCACTCTCTCCTAGTCAATAGAGTTTCTGCTGAGAAATCCACT
GATAGCCTGATGGGGATTCTTTTCTAAATTATTTTCTTCTCTCTAGCCACCCTTAATATT
GCTTGTCATTGATTTTCGACAATTTTAATATAGTATTCTTTGGAGAAAGTCTTTTTGTGT
TGAGATAATTAGGCGTTCTGTTAGCTTCATGTACTGTATATCCAGTTCCTCCCCCAGGTT
TGGGAAATTCTCAGCTATTATTTCTTTGAATAAGTTCTCTCCTCCTTTGTCCTCTGCTCC
TACTGGGATACCCATTATCCTTATGATGCTTTTCCTAATTGAGTTGGATATTTCTTGTAG
AATTCCTTAATTTTTAAAAAATCTTAGTTTTCTCACCTCTCCCTTCTGAATCATTTCTGG
ATTTCTATCTTTGAGCTTGCTAATTCTCTTTTCCATATAGTCTGCTCTACTTCCAATGCT
TTCTACTTTATTTTTCATTTCATTAAAGTGTCCTTTATCTCCAGAATTTCTGTTTGTTTG
GTTTTTTTTTTTAGAGTTTCAATCTCTTTGGTGAACTACTCTTTCTGTTCATTAATTTTA
TTTCTGAGCTCATTGAACTGTCTGAATTTTCTTGTAACTCACTGAGTTTCTTCATGACAA
CTGTTTTGAATTTTCTGTCAGATTGCTATCATCTGTGACTTCAAGTTTGGTTTCTGAAGA
GTTGTCATTTTCTTTCTGTTCTACCATTGACTTTTGATAATTTAATAGTTCTTCATAGTG
CTTCATTAGTTGATTCTCTCCTGGTGAACTTGTGGTAGTAAACACCTTTCTTATTTGGGT
ACAGCATTGGTTACTTTGGTTCTGAGCTGCTTCTGGTTGTATATGAGAGCCTGCACTTTC
CACCCTTCACTGCCTCTGTCAGAGGCATTGTCAGTGCCGTCCTTGTACTGCTTGTACCTC
CAAGGTTGCTGTGCCTCGCTATGTACAATGTCACTGCAGTCTCAGTTGTTGCCACCAGGG
TTGCCTGGGTACGAGCACTTCTGCTGCTTCTGGAGTTGGCCTGGTGCTCGTGTTCCCCCA
TCAGCTCTCTGTGGGCTCTCCATGGGCTCGGATGCTGCTGCCCTGTGCACCACCTGCACT
GCTGCTCCCAGGTTATCTGGGGATGCTGGCAGTACTGTGCCAGGGGCATGGGGTTCACAG
GTGTCACTCTTTCTTGCTAGAGGCCTGAGGTATTGTATGCAGCCCATGCTGCTGGTATAG
CTAGTGTCAGGGGTGCCACCACTGGGGGCTAGATCATGGATTCTCCTGTGGCTCCTGAAG
CCTTGGGTCTCAATTGTCACCTGCAACTGCTGTGGGAAGGGGAGAGGCTAAGCCTCAAGT
GCTGTTGCTGCTCCTGCAGTCCTGGTTGCTGCTCTGTGCCAGTGTGCTTTCTGAAACCTC
AGGTCAGGGTACTACTACCCCTGCCACTGATACCTGTGTTTTGGATGCAGCCCTTGCTGC
TGGAAAGACTGGTGTCTGAGTCACTGCTGTCTTCAGATGTATAGATGCATGGATCTCTCA
AGCATTCCCGTGTGCTGTGCAAGGAGTCCTTTGTTAGTAATGGCTGTCCCCCTGGTTGTA
ACTTAGAGGGGAGAGACAAAGGGAACAACTCACTCCACCGTGGTGCTGTATTTTTCTTTT
TAATGTAAATGGGTTCATGTACTTCACAGTATTCTGGAGTTGACCTTTTATTACTTAACA
GTCTATGAATATGTATATCTCATTTCCTTGTTAAAATACTCCAGAGACACTGGGATCAGT
CAGTAACAACCTTTTTAATTACATCCTCAGGGAGGAACCTGGGGTGGTCCATGATGGGGA
TTGTGTTCCTCACTACTAGAGCTCAATTACAGCAGGAATTTTACCATGTCATTGTGTCCT
GGATTGCTGGGGTTTGAGTGACCATTAGGTTCCACCCTGCCCTGTCTAATTGATCACACT
TTAGTGGGAAAGAGGTTTGCTCACTGTGTGCTGGGGAAACAAATCAGCATTCAGGCACTC
TTCCTGGTAAAATTAACCATTCTGAAATTAATTGCTTTTATTTTTTCTTTTTGAGAAAGG
GTTAGTCCTGAGGGCCGTAGAAAATAAGTATAAGCAATTTATAATTTATTAGTGATTCCC
CCCTTTCACTGGAATTTGAGAAAATAATTGTGTAAATAGTTTGTAGATCAAGAATAAAAT
TAACAGGAAGTTCATGTATCTGTAGCAGGGCTATAAGCATTTTTTTTGCCATCTATCTCT
ACTAGTCTGGTGAGGGATCTGAATCCCCACTCTGAATAATATATATGTTTTTTGGGTTTT
TTTTGGTGAGGAAGATTGGCCCTGAGCTAACATCTGTTGCCAATCTCCGTCTTTTTGCTT
GAGGAAGATTGTTGCTGAGCTAACATCCACGCCAGTCTTACTCTATTTTGTATGTGGGAT
GCTGCCGCAGTATGGTTTGATAAGAGGTGCGTAGGTCTGCACCTGGGATCTGAACCTGTG
AACACTGGACCAGTCACTGAATAATATTTGTGAATGCATATAGTGATAAACATGTGATAG
CCAAAATAGCAAAATATTTTTTAAATTGTGAGAAAGTAATATATATGCCTCTTTATTAAG
ACTTTAAAGATGGCGCATTTAAAATAGGTGAGTTAATTTTTTAAGAGGTTTGTGTAAAGG
TTGTATAGACTTAGAACCCACATGCTCACCCATGTTACAGTAGGCTACGCTCCCTTTCAG
ACGGTCAGGAATTTTTGTTTGAACTGACCAGTTGGACAGAATTACAGTATAAATACTGAC
CTCTTTTCATGTATTAGTCAACAAATAATTGTATTGGAAAGCAGCTAGATGTCTGGGATA
GCAGTATGAGAGTACATGGCGTCCCCATTTGGTGGCTGAATAACCAGGTGCAGTTACCCA
GCAGTTCGTCAGCTACACCATAGGAGCGTCTATCGATAGGGCCCTCTGATCATGTGCAGT
CCAACAGCAGATCAATAAGTGTAATTTTGAAGTAGTGATGAGGGAAATGATAATTAGAGG
TATCTATAAACTTTAATGGTACATGAATAAATGTGATGTTCATTGGTGACATAGTCACAG
ATACTGATAATATTACAGTTTATCTGTAATTTTAGTTGGAAGGAAATGCTAAATTTAGTT
TGAGATTTTATAACACTTTGTTTCAGTAACTGTAAAAAATCCTTTGTTAACTTAATAAGC
CTTTCTTGGTAAAATTTGGTGCTTCAAACTGGTTTGGTTTTTGGAACACTGGAGCATTTT
CCTCTTACGCCCCCAGGGCCAGTAGTCAATATATACGCTTAAATAAACTAAAAAGTAATT
TGTTCCCTGAGAATCATCAGGGTTGGTTGTCAAAATTTAGCAGAAGTAGACATTTTTTCC
CTTAACTTTTTCTCTGTACAGATAGCTGATCTGGCCAATGAAGATACTCCACAGCTGTAT
GTGGCCTGTGGTAGGGGACCCCGATCATCTCTGAGAGTCTTAAGGCATGGACTTGAGGTA
AGATTGGAATTTCTAGATCGTCAAAGAGTTTGGTGGAAATCATTGATAAAGCAGCCTCTG
GCTTTACTCTGATGAGATCCAAGATACATTTAAGGTTTCTGTGAAAGGACAGTCTTTACT
TCCTTCTCTATTTCCATAAAGTTTAGAGTTTAAATTTCCAATTCCGTAACGTGTTTGCAC
AATAGGCACATTTTTAAAAATTGGCAAATGGGGATAAAAGGGAAAAAATGACCTCTACTA
ATTCCAGGCTCACTAGTCAACACGGAGGTTAGGAAATCTATGGAACATTTTACTCCGTTA
CCTTCTACTCTTGGTCTTTATTCAGTGTTTTGATTCTTTTATTTAATTAATTAATTAATT
TAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCAGTACATAGTTGTATATTTTT
AGTTGTGGGTCCTTCTAGTTGTGGCATGTAGGATGCTGCCTCAGCATGGCTTGATAAGCG
GTGCCATGTCTGCACCCAGGATCCAAACCGGCGAAACCCTGGGCTGCCAAAGTGGAGCGT
GTGAACTTAACCACTTGGCCATGGGGCTGGCCCCAATACTTTCAGTTTTAGGTGTGTCAG
TACTGTGTGTATATTTTTGTCTTCCTAAATTTTTTCCTTATTACTGTGTGCTCTTAAATT
GCATCGTTTTTATTGTTTATGTAACATTCCACCATAGTGGAATCAGAATTTATTTAGTGA
ATCTTTTATTTTTAGACCTTTTAGGTGATATACACACTCAGAATTATTGTCTCAAATCCC
ACATCCTCTTTTCATCATGGTTCTTGTGATACCTTTTAGCAAGTGCCCTGTTCTTGATTT
TGTTAAGAGTAAAATAAAGCTTCTTGCAACAATTTGCTTTCAGAGGTTGGAGTTGGCAAA
CTACAGGCTCCCAGAGGCCCACTGCCTGTTTTTGTAAATTTTTATTGGAACACAGCCAAG
GTGACCTTGGGTGATTTGTTTTGTTTTGTTTTGTTTGAGGAAGATTAGTCCTGAGCTAAC
TACTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCATGCCCA
TCTTCTTCTACTTTATATGTGGGATACCTACCACAGCATGGCTTGCCGAGTGGTGCCATG
TCCACGTTTGGGATCCGAACCGGCGAACCCCGGGCCACAGAAGCAGAACGTGCAAACTTA
TCTGCTGTGCCACTGGGCCGGCCCCTGACCTTGGTTTTTAATTCTGGCTCTACCACTTAT
TATTACTAAGCTTTTGTTTCCTCTTCTGTAAAATGGGCTTGATAAATGAACTTGCCTTAA
AGAATTGTGTGAATTAAGTGAGATCATGCATATGAAGCAGTTAGCTCCAGGTCTGCCATA
TAGTAACTGTTCAATAAATGTTAGCTATTAATATTGCTATTTCAGAAAATTAAAAAAAAT
TTTGGCTCCCAAAGTATTCATCAGGTCACCAAATTTTCAATAACTTCAACCCAATTTAGT
CCAATAGGTCTTGATTAGATTCTTACTGCTCATTGGATCCCATCGAGCATCTGATGAAAG
CTAAGAAGCACTCTCCACCAAAAATGGATTATGCATTAACAGAAAATTTTATGTACAATG
TAAGAGTAAAGGACCCGATTAAGAATCATTGTTTTTGAGTTCCTTCCCTCCTCCCACTTT
TTTCCAATTCTACAAAAATCTTTATTGTATGTAAAATATTTTTAAATTGTTGAACATTGC
TTTGTGTGTGTATGTCTATTTGTTGACCCTTGTGTTCGAGCTAGATTATGGTGTCGGTTG
AGCAAGGTCACTGTCAGATGGTACATTCAGTACAGAGTATAGCATACCTGAAATTTACAT
TTTATTGATGATGAAGTTTTTCAGGATTCTCCTATACCATGATCAGGTATTCCTGCAATT
ATTATATCAGTAAACTAAAAAAAGGGTGATAACTTTCATGAATATATTGAGTTCTTCCTA
CAAAAACTAGTTACACAGTACAGTATATATTAAGCTGTCCATTGTCTCTAGGTCATTTAA
AAATACTTAATAAAATTTTTAGTTTAGAATGGTTTTAGATTTACAGAAAAACTGCAAAGA
TAGTACAGAGAGTTCATGTATAACCCATATCCAGTTTTCCCCTCTAGATCATTTTGAATT
CATCTTAGATATTTCATTTACTCTCATGTTTGAGAACCTATGGGACATTTCAGAGGATTC
TTGATTCTGACCCTAAGGAGCATAGAAATCTAGTAGGAAAAACAAAACAATTCCTTAAAT
CACTTTTTAGATAAGTGCCCTAAAGTTGGTGATTGTGATTTCTCTAAGAGCTTACAGGAG
GGAGAGATGACTGCCAGCCTAAAGGATAAGGGGAGATTTTTCCTAAAGGATGTGGCATTT
GAATTAGTCCATGAAGAGAGATGGGATTTGGTCTCATGGGAGCTAGGGAAAGAAATGGGA
CGCTAACTTAGATGGACTGTTACATTCCTACATACTCTCTTTTTAAGGAGGATGCAGGTA
TGCCATACCCAAAGGAAGCGAATGGTTTTGGTTGCAACAACCATCCTTTTTGATGTTCCG
TCACTTGCTGCTAAAGTCTGTTTATGGGGATTGCCAATACCTCCAGCTTTTTTGTTCTTA
CGTTCTTTTTTGACTAGATGGTTCCATTCTTTTAATCCAGCATACAGTGAGCACTGCCAT
ATTGAGTATAATTGTAGGCAAGGAGCCGAGTTCCCTGCTCACTGGATCTGTGGTTTGTCT
CCTCTCCTGTCAGGTATCAGAAATGGCTGTTTCTGAGCTACCTGGTAACCCCAATGCTGT
CTGGACAGTTCGTCGGCACATAGAAGGTAAACAGCCCTTTGCCAACAGTCAAAATGAGGG
TCTGGGTGCCATTGACAATAGAAGGCTTAAGAGTCTGCATTCACAGTCTTTCTATATCAC
TTCATCTAGCATCATATACTAGATAGCATATCATTTTCTGGCCTGACACCATGTCTTTTA
GGCTCTCCCAATCAGGATGCCTTCACCTGCTACTACTTTTTGTACACATGGGTAAGGGGT
GCATAGGGTGGCTGTTAATATTCAATACATATACACTTCAGTATCATAGAGCTGTCATGT
GTGATATTCTTTGACTGTATTTGTCTTTAAGACTGGTTCCATCTGTGTAAGAGGTATGGT
GTGAGGGAAAGTTTTTGCTTCTTCATTTGTCTTCAACCATATTCTCTTACTGTGCTGAAA
TGAAATGACAGTGAAGTTGAAGATGTTATTCTAAGTATTAAGAGATTTGGTAAAGCTTGT
TAATTAGTCCTGCTTAATTGGCGTAGTTATGCTTAAGGAAAGCGGAGATTAATTGAATGT
CATCAGAATTTTAGAGTGAGTGGAGAAGAAGGGATGGATGAAAGAGAGGGGAGTCAGCTC
CTGGGTGAAAATGGTTACCTCATCCTAAAATTTTCAAAATTATGTGAAAATGCATAGTAG
TCTAACAGCAGGAAGGTCTTGTGACAGTTGAATTTCACTTTCTTAGAAATAAAACTCAAT
TCTCATTTTCCCTTTCATTCTTTGGGGCTGTAGGTCACTTCTGTATTCCTAGACCTCATT
TTCCCCTTGTTCCCTCAGGAATGTGGGACTGCTCAGTAGGATCAGCTTGGCCAGCATACA
AAGCGTTTTCAGGAAAACAATGGGAAAACTTCCAGATGTTTAGATGTTCTTGTTGTAAAG
AACAAATTTAAGGGAGCTGGGAGATGTGTAGGAGGGAAACCTCTTTTTATTAGTGGAATA
CACATTTTGCTGCATTTTGTTTGCATGTAGGCATTAGAATCAGATCTGAGTTGAGTAGAA
AGAAAAAGTGATTAGGAAATTAGTAGGTTCATTTTAGCTGAGAAGATAATTATTACATGG
TTGGTTTTGAAAAATTTCCTCATTTGCGTAAGCAGAAAGAAACTTTTCAGTATTGATGTT
CACCTTTAGCTTGGAGGCTAGTTGATGTTATGGCTTTTGAAAACGTTGCCTAGACTGTTC
GAATTAGAAAGATCCTTTGAGATCAAATCTAGTGTGCTCCCTCTTTGTTTTTTTTTACTT
CTTAAACTTTATTTTAAAATAGATTTAGATTTACAAAAAAGTCACCCCTCATTTTTATGA
AGGCAGAAAATCACAGGGTTTATTGTTCCAAGATAGTGCGTCAAGGTAGTAGAGACTGAA
AGCCTTGTCTCCTGAATCCCAGCCCAATGCTCATTTGACTAATCCTGCAGGGAGAGTCTG
TGGGTCTGGATGGTTTTTTAGGATAAGTTTTAAACTCCTATCCTGCAATCTTTCGAGTGC
CCACCTTGCACTCAAGAGTATAGAATTCCTACTCTCAGAGCACTGGCCATCTAAAAAAGA
AGACAAGTATACAAAAGTATTGTGTGTTCTGATGTGATGAAAGGCAGAGGCATGTTGCCA
GGAGGAGTTAGAGGAGAGGGAATGGGCAATTGTTTGAGAATCAGGAAAAACTATTTGGAC
AACGTTTGATATTAGTGATAAGCTGTATGTTGCATGATGGAACTTAAATGTAGCCGAAAA
TTTTTCTTTTCTAAATACCAAAATCTAGGAAGAGACTACACCCAGTAAATTTTACTCTTT
AGAAACTATAATTTGGGTGATCACCCACAAAAACAGGTCAGGTTCCCTCTGTTCATTCTC
TTTCCAGATGCCCCAAGATACTGTTGAGTGAACATCTCACATGTCCACACATGCTGCAGT
CTTCCAGGCAATTACTAACCTTGGCTGGTACTTGGTGATGCACACTACCAATACCAAGCC
TTTTTTTCTCTTCCACAGGTGGCTGGTGAAGGTGCTGATTACCACAGGTGTGTACCTACT
GCTAGGGTCTACCATGGGGTCTTAGAGTTTACCCAGGGAGAGGGACCTGCACAAAATATT
GAGGCCACACTCGTGGCGTCTCTCAGAGGGTAACTTTGCAGTTAGCCGTCCATGTGCATT
ATACACGTACACACCCATCTGTCTGTATATTAAATGGTCTGAGGCAGGAATCAGCTTCAA
TTACTTTCTACCACAGAACGTGGAAGATAGGATTCATTTGTCTTTCACTAAGCTGAAAGA
ACCTGTAGCTAAAAAACCTTACTAGCTTCATACTCTTCCTTGGAGGTTTATACCTTCCAG
GTGTACTGACTGAGAGATCAGGTCCTGGAGAAAGCCCTCCTGGCTCCCTTTTTTTTTAGT
ATAATCAGAACTGTGCTGAGGCAAGATAAGTACCAAGTAGTCTGAATATTAAGTGAAAAT
GAGATATTGGAAGCTTAAATCATCTGGATGGTTGCTTACTTTACCCTTCGGAGTGAGCTG
TTTGTTGAGCTTCAGATAGTAAGGCAGGGGAGAGAGGACTAAAGCATTCCCTCTCCTTTG
GGCTGCTTCAGCAGCGCCCAGACAGATAGAAGTTCTATTTAACTGAGACAAAGATGCATT
CTCATACCCTAATAGATTCTTCACTGAAGTATGAACTAATGTTCTTTTATATGAAACTTG
AAACCCCTGGAAAAAGGCAATGTGGTTATTTATAGTTCATAGTCATTTACCTTGAGTGAA
GCTTCATTTTGTTGTCAACTCCAGCTTTTAACGTGTAACCTCCCTAAGACTTGAGCAGCT
GATCTGCTACAGGTTCTCCTGGCCTAGAATGAAAAGGGTAGAATTTACAGTGTGCTTAGT
ATACACAGGGAAATGGATATTTTGAGGAAATCTGTGAGGTAAAGCAGCTTTGAGATATCA
GTCATTGCTCTACTACTTGTTGGGTTGCCCAGCAAATGTAAGCCCCTATTTGAGTCCACT
GAGCATCTCTTTATTTTTATATCTGAACAGTCTGGTGCATTGGGTCAAAGGGAAGATAAG
GACCCAGGCAGCCCTCCTTCCACCCTCCCCGCATTCTTTGCATGTAGTTAGAAGTTGTAT
GATCTCTTTTCTGGAAGTCTCCCTTTTCCCTTGATTGAACAAAAGAGACTGAAATCCTGG
CCAGTTAGTGAGTCCTTTGTTGTTTGGCTTTAATTTACTCTGGCACAGATTTTAAGTTTT
TAGGTTTCAGTAATGAGAACGTGGGAAAGGACACAATATTCATATAATGTTAAAATTAAG
CAATTCCTGTTATTTTTACACACCAGAAATTTCCAGTTCAAAAACTAAGAGCTGGAGTAA
AACTTCCAAGTTTGGTGTTGTGTGGAGACTGATTTTGGTTTTGTTGTAAGCTATTAAGAC
GTCTATTTCAGAGACAGTCATATCCTTGTTCATAGTATGTGATGGTGAACAGTGCATATC
CTTATTCATATTTTGTGATGGTGAACAGTGCTGTCTTAGCCATTTTTATAAGGTGTCCCC
AAAGCATTTGATAACATGTTGACAGTTATAACAAAATAATCTAAAACCATCTGCTTGTCC
AGTGTTACTCCATATGATTGGGAAATTGAACCGTTACTCTGTATTCCTGGTATAGCCATT
ATATTACACTCCTTGTTAAAGATCTTTGATCCTTGAGTTTCAGCCACCCAGTCAGTACCC
ACGTATTAACTGAAGCAGTTTTGCAAAACAGTACTTGCCCTTCCTATGTGTGAAGCCAAT
TTCATAAATTATATTTATTTCTATGTATTTCTATTTAAAAATGCTGATTGTAATTTTATG
TCCTGCTAATAGGTCAGAACACTACTATAGGTTACACCAATGATAAATCTTCACTTGGTC
CCTTTTTCTGTAAAGAATACTGATTCTGCTGAAATAAGTGAATAATCTTAGTTCAGCTTG
AACCCCTTTAGGAGCAATCAGAATCCAAACTGTGTCTTTGATGTGAGTGGGATGGATCAG
CCCTATGACATTGAGCTCTAACGAGAGCTCAGGCAAACAATCCTATAGCTGCTTCTGCTA
AGAGTGAGGTAGCCACTCCAATTTAGTACTTTGTCTACTTGTCCTTCTGTCTTTTATTTA
CCTGATTTCCATGTGAGGGGAACAGAAAGAGGGGAATTGATACAGAAAATTCAAATGAAA
AGTTGGAAAATCTCAACTTTGCTTTAAAAAGTAAACATGCCTTTATTTGGTATTTATTAA
GCCTTATGCCAAACATTGTGCTGGATGTAGGAGATACACACAGAAGCTGTTTTATGTTGT
AGGGTGGACTATGGGAAATGGATGGCCTTTAACCATGGGATCTGCATGAGAAACTTATGG
GACCTCCTTGAGAAACTCATTAGTGTTTGTTTATCCAGCTACATTTCATTAAATGAAAAG
CAAATCCTAACAGAGTTGCTCATGATCACTGAATAGTTGTATTTTTAAATAGTGAAAAAC
TAAAGAGGTCAAGGGCTGACAATATAAACAGTCTCCCCCTCTCCACTTCCTGATTATCTC
GTGTTCTCACATCATTCCTATTGGGACATCTTAGGATTCTCAGTTTCCACCCATAGAATC
ACTTAGTCTTATGGAAGCTTAAGTAATCTCTGTTTTATTCGTTAGGCCGTATGTTCCCAG
AAAAGCATTTTTGGGGAGAAGCTGGGGATATTTCTTGGTTTTATAAGGAGTGTCTTTTAA
GAGTGGGTTGTGATTGGCATCTGCCACAAATAAACAAGCTCTAGCTTCAGTATATATAAA
TATTGTAGCATTCAAAATTTTCTCGTGTCTCTGATTCCCTTGCTTTGTCCTCGCATTTTT
CCAGCAAGTGTCTGAAGAAAATATACTTTTCAGAAGTATTGGAAGTGGGTGTATCTACTC
AATGTATTTAGGCATTTAAAGAAGCAAAGTATATCTGTAGGCTGTTATGACCCCTCAATT
ATCTTTTGGATTACCCTGTTCTGTTTGCCACATGACTGTGTGTGTGATGATGACACATAG
AACAAGTGCCTTGGAAGGTTTCTGAAGAGAAAACTTAGTGTGTCTCATTTGGCTTTGTAA
CTAATGAGTTTTTAGCTAACCAATTCCTTTCTTCTCTTTCCTTTTTCAGATGAGTTTGAT
GCCTACATCATTGTATCTTTCGTGAATGCCACACTTGTCTTGTCCATTGGAGAGACTGTG
GAAGAAGTGACTGACTCTGGGTTCCTGGGCACCACCCCAACATTGTCCTGCTCCTTGTTA
GGAGATGATGCCTTGGTGCAGGTGAGGATTCTCAGAGAGCTGCTTACCCACTTACCTTAC
TTTGTCCCTTTTTTTGCCCTCCTTGTGGTATAGGCTACTATGTTCACATTAGTTAGCTTT
GAACTTCTTTGAAGTAGATATTGCAAAACATTAACTCTTGCCTGAGGCTGGTTAACTTTT
TTGTCTTTGACCCAATTGGAGCCTCATGCAGTGGCTCCAGATCTGACAGGAGTGACAGAT
CTGATAGATATGCAGGTCATGCTGAGTGATGAGTCAAATTGCTAAGGTCAGGTTTCCTCC
TTTTAACTGGCTCTAGGTGTATCCTGATGGCATTCGGCACATACGAGCGGACAAGCGAGT
CAATGAGTGGAAGACCCCCGGAAAGAAAACAATTGTGAAATGTGCAGTGAACCAGCGACA
AGTGGTGATCGCCCTGACAGGAGGAGAACTGGTCTATTTTGAGATGGATCCCGTATGTTA
CTTTATCATTCACTGTGGGACTTAGTGTAGGGTCCAGAGGTAAAGATGGGAGTCCAGGTG
TCTAGGTTATATTCAGAAGAAAGAGAATTGAGGAAGGAAAGTGTCTATAAGCCAATCTGG
CCCTTTTTGGGGGGCTTGGGCGTGGGTAAGTTCATGTCTTAATTCGAATCGGAGTTATAA
AATCCCATCTTAGCAATGAAAACACTTGCTTCTCCTGCCTTTCATGCTCTATTTTCACCA
AATATTTGCCATAGGTTTAATTTCTGCAATCTGAATCCATTTCAGATTTTTTTTTTTTGC
TTTTTTATGTGGAAGGATGTTGGGTATACGTGATTGTCATGCTCTCAGAAAGTCTCTGGA
TGTGGCCAACTTCTATAGTTTAACTGTACCTATGATTGAGATTTCTTTGTCTTTCACTTC
CATATTTGAATTCTCTTTTACTCAGAGTGTTCTCATGAACAGATAAACAGTATTATATTT
CCATTTTCTGAGAGGTAGATTGGCTTAGAAAATTTGTGGTGCATTGTACTCGTCAGAGGT
CTGTTGATTCTCGTCAGTAGTTTTACTTGCTCTTAGCCTGTAGAGTTCAGTCTTGGGACC
TCAAGTAGAGAAATACTTGGTCATTGATTATAGTAAGAGGAGTGAGAGGAAGCAAAAAGG
AACTTAACAGCCCCCCTGCTTTCCCCAGGCCCAGGGTTTGGGGGCGAGTTGGAATGGTTT
GTGACCTCTCTTCGTCTTTACTCCTGTAGTCAGGACAGCTGAATGAGTACACGGAGCGGA
AGGAGATGTCAGCAGATGTGGTTTGCATGAGTTTGGCCAATGTGCCCCCTGGAGAGCAGA
GATCTCGCTTCCTGGCTGTGGGGCTGGTGGACAACACTGTCAGAATCATCTCTCTGGACC
CCTCAGTGAGTGTTACCTCAACTTCAAGGATCTTCCAGTTGGAACTGAGCACCTGGCTCA
CTCCTCATGTCTGTCTCTGAGAGCAACAGTACTGGACCCTGAAGTCTCCGTCTGCTGCTT
ATCCTGACTGCCGTAGCAGCACGCCTCGGCAGTCTTCAGCATTTTGAAGATGCTGATCTG
AGACTAGTAAATGCGTCTTTGGCTTAAGCCTTGGCTCCCTTTTATAGTTAAAAACAAAAA
AAAACCCTAAGCCTGTTTGTAGAAAAGGACTTGTACTGGCTCTGGGGCCATGGATGACTT
TTTAGAGGTGCTCCTTTGCTTATTTACTTTCACCATTATCCACTTTTACAAAAAGAGGAA
AGCATGATCCTCTCCAGAGCTTATTCTGAGGTTCAGTTTAACTGGTAACCCACTACCCAT
TTAGAACTCAACTCCTGTCAGGTTTTTCCTGTGCACAAGAAAGTTGTTCTTTACTCCTAG
AAGTGGATTTCTCTGGGTAGATTTTTTCCAAAATTGGTCATTTCCCATGTTTTATTCTTT
TCTCTTTCCCTCTTAGGACTGTTTGCAACCTCTGAGTATGCAGGCTCTCCCAGCCCAGCC
CGAGTCCTTGTGTATTGTGGAAATGGGTGGTACTGAGAAGCAGGATGAGCTGGGTGAGAG
GGGCTCTATTGGCTTCCTATACCTGAATATTGGGCTACAGGTAAGAGATCTGGAGGCTCA
CATTCTTGGTGTCACGCCTTCTTGAGCTTTCATGTACACCTTTGTTCAATACGGGCATTT
TTGTGCCTACAGTTTCAGTTACCCACCTCATGAAAAGTGCTGCCCTGTGTTCACTTTTTT
CACCTCTAATTAGAACAAATCAGGTCGAGAAAAAGTATTTTCATTGAGTCTTCAAAAGTG
CTTTGTGGTCGCTGCTCTGGGTCGGAACTAGTTGGCGTCCTCAGGAGTCACTTGTTCTCA
TAGTATGCAGCTTTTTTTTTTCTAATTTTTAAAGTTTTTTGTTTAATTTTTGGAGGAAGA
TTAGCCCTGAGCTAACATCTGTGCCCATCTTCCTCCACTTTATATGTGGGACGCCTGCCA
CAGCATGGCTTGACAAGTGGTGCCATGTCTGCACCTGGGATCTGAACCGGCAAACCCCGG
GCCACCGAAGTGGAACGTGCAAACTTAACCTCTGTGCCACTGGGCTGGCCCACATAGTAT
ACAGCTTTTGAAACTGATACCTCACGGCTCATAATGGGCTCCATTAGCAATAAAGGACCC
TTAGGAGTTCCCTGTTGTTAAAGCAGCTGAGTTCTTCATGGCATGAAAAGCAGGAACCTA
AGGATCAGATAGTGTCAGGGTTTTTGACCATATACTTATTTTCCTTAATGATTATTTACT
CAAACACGTAAATAATCTAGCCCAGGTGTTTGTTGCTTTTAAATTTTACTTCCTAATTTA
GAAATTCTCAGATGTGCAGAGAAGTTAGACTAATATAATGAACCGTATACTCATTACCAA
TTTTAACAGTTATCAATGTTTTGCTATTCTTATTTTATCTATTCCTCTTGTTTTCTTTTT
CCTGGAGTATTCTAAAGCAAATGAAAGATGATATATTATTTCATCTATAAATTCTTGATA
CTATGGCTCTAACAGATGTGTGGGGTTATTTTTTAAGGTCTTAAATTTTTTAAGTTCTTT
AGTATCTTCTGATACCTTATCCATGTTCCAGTTTTCCTTGTTTAGTTTTGTTTTTTTTTT
TCTATTTCCAAAATGTTTTTACATTTGGTTCTACTCAGGATTCTACATATAGCTGTCCAC
AGTTTACATCTGCTTGACCTTTTTGTGTTTCTTGTAATAACTATTCCATCCCATTAAAAA
AAGACATTTTTTCCCTAAGAAACCAGATCATTTGTCTTGTAGAATTTCCCATCTTCTGGA
TTTTGCAGTCATTCCTTGTACGTTTAATGTTCCTCTGTCTGTATTTCCTGTAAGCTACTG
GGTAGATCCTAGGCCATGCTGTTAGTTAAAAATATAATGTAAGCCATACATATAATTTAG
ATTTTCCAGTAGCCAGAAAAAAAGGAACAAATGAAGTTAATTTCAATGTTTTATTTAACT
TGTTATATCTAAAATGTCATTTCAATTTGTAATCAACATAAAAATTAAGATATTTTATGT
TCTTTCTTTTTTTAAATTAAATCTTTGAAATCTGGTATTTCGTATTTTATACTTAATGCA
CATCTTGATTCTCACTAGCCACATCTGGCTTGGTGACTAGAGTTTTAAAGCTCCCCATCA
ACTTTAATAACAGCCATATATACTAATTACCTAGATTCATCATGTGATTAGGGGTTCTGA
AATGATGGCGTTCTATTTCATTCTTCATTTAATTAGCTGAAACTTTTCTGTAAAGACAAA
ATTTGCTTCTTCATATCTTTGCTTATTTTGAAATACAGTTCATATAGGGAAAAGATACAT
TCTTAATTTTTTCCCCTTTGTTCACCGTATTCAGAGTAAGGAGAGGTGGTACCATAGCAG
TCTTCACACATCACTGATGAAATTTTTTTTGTTTTTTAATATCATGAACTTGCAGTTTTT
TAATATATTTGTGCTTCAAACCATTGTGCTTTATATATTTGTGCTTCAAGTCATTTTTGG
ATGCTAATTGCCTCATTTTAGGGGGTAGGAGTTCCCCTTTGAAGTTGGCTCCTTTGTCCT
GTTAATATGACCCCACTAGCTTGGAGGCTTCCTTCCTTTCTGGCACACACGTCTGTAACA
TCTTACCCTAGACCTGAATTGGCCATTTCTCTTAGGAGTCTTATTCTTTTTAGGAGAAAT
GGTATTTAAAGACCACAGTAGGCCTGGTTGTTTTTAACTATGCATATATTTTAAAATTTA
AAGAAGAGTTTAAAATACACAAAAAAGTTTTGAAGAATAGACAGTGAAAAATAAGGGTGC
TTTTCAGTTAGTAAGTGCTCAGTAACTATTTGAGTAATTTAGTGAGAATGAATGAATGGC
TGGCTCATTATTAGGATATTCTTTAAACCACCAAGTCATTTCCTTCCATCTGCTCTGAAC
TTATGTCAAGTAGAGAAGGAAGCTTCTATCATGGGTAGGCTTCACCCACTCCTCTCCCTT
TTACTAGAATGGTGTGCTGCTGAGAACTGTCCTGGACCCTGTCACTGGAGATCTGTCTGA
CACCCGCACTAGGTACCTGGGGTCCCGTCCTGTGAAACTCTTCCGTGTCCGGATGCAAGG
CCAGGAGGCAGTAAGTAATGAAAGGGGGCAGGCGGCATGGCATGTTCAGATGTTAGTGGC
GGCAGCTGAGAAAAATCCCCTTGGTGTAAGTTTTGCTTTCATGAATTCATCAGTATATAG
TTAATTTGACATTAGTTCTATCTTGTTTAGTTTCCTTCATGTGGGAAGTCTTGGATCCCT
TAATCCATAGCTTCTTAACTGGGGTTCAGTGGCACTGTGCCATGATTTGGTTATAGGGGG
GTTAGAATATTGATTCCTTCAGCCCTCAGGCTAGGCAAACGGAGCAAGAACTGAGTTAGC
TGGAAAGTTCCCATCTAGGGAATCACTTGCCCTTGAGGAACCTTGTATCAATATCATGGT
TTATCCTGTAACGTGAAAGAGGTTAGAAAACATTGTGTCCTTTGTAGCTAAGAATATTAG
TGTTGCTGGGTGTTGTGCTAATTCTTTACTTGTTACTGCATTTAATCCTTGTAACTATCC
AGCTTTGTGATAGTATTCCCATTTTACACTGTGGAAACTGAGCTTCAAAGAGATTGAGTG
ATTAGTCTAGGTCATGTGGCTAGTAGCCCATACTTTTAGCAAATACTAAGACATACTGCC
TCCTCTTTAGGTATCTTTTTTCTTAAGGTAGCCTTTTAGGTTTCTAAAATTCCTTGGGAT
ATTCTGTAGGCTGAAATTCGGGGGTGGGGTGTTTGCTCAGTATACCATGTTTGAGGTTTT
TCCCAAGCTTATTGGAGATGTTTTCTTCCCTCAGGTCTTGGCCATGTCAAGCCGTTCATG
GTTGAGCTATTCTTACCAATCTCGTTTCCATCTCACCCCTCTGTCTTATGAGACCTTGGA
ATTTGCATCTGGCTTTGCCTCTGAACAGTGTCCTGAGGGCATTGTGGCCATCTCCACCAA
TACCCTGAGGTGAGAGAATCCCACAGTTGGAAGCCCATTGGGAAGCCTTTCTGCCAAGGG
GTTGGACTGTGGTTTTGCCAGAGTGTTGGAAGAAGTTATGAAGAGATGGCAAAGAAACAG
CTCTTCACCACGGGACTAGTGTGTTGCAATTGAAACCTTCATTTGGCTCAAGAGTCAAGT
ACCTGGTAGCCAAGTTTCAGTGTTTGGAGTTTTAGCTTTTATTTAGACTTTCAGGGCCAA
GTTTTCATACTTAGCAGTACTGTTCAATCTCCTTGAGATGTAAGATTCTTGTTTTTCAGG
GTAACACAATTGGATTAGTTTTAGAGCAGGCATTGGATCACTGATAACGTTTTCTCACTC
TGTCTTGTCATTTGCAGTGTTACATCTTGAACTTCAACCTCAATATAAATTATTTTGAAA
GTTGATAGACTATTGTTTATGCTGATAATGTGGGAGAGTGAGCACTATGTATATTGCAAA
AGGGAAAATAACCTATTCAGTTTGACTTTCTCAAGTTTTGGGAGTTTTTTTTCTTTTTTA
ATTTTTTAATGCTACCCATGTTGTTGGTGTCCTGGTTATAACTACTGCGTATTCACAGTG
GAACTATAACTTGCTATTCACAATGGAGTTTGCGATGGAATTATTGCTATATGAATCACT
GTTTATTAAGTGAACGCCCAGATTTCTTTGCAACAGTTTTCAGGTTCTTCTCATAGTCAC
TGTTCTCTCTCTTTCTAACCTTCAGCACCTTTATAAACCTATTCCAGTGGGATTGCTCTC
TCTGCATGCCCCGTACATCACTTCGTGGTATTTTGTCTGTGCACCTGTCCCTGGAATGCT
TCCCGCACACATCTCTGCTTATGAACGTTCATGTACAAATTTTTGTATGGGCATATATTG
TCATTTTTCTTCAGCATATACCTGTTAAGAGTGGAATTGCTGGATCATATGGTAACTCTG
TCTTTGACTTTTTGAGGAACTGTCAGGCTGCTTTCCAAAGTGTCTGCAGCCTTTACATCC
CACCATCAAGGTGTTCTCCACAGTCCTCCTCGACACTTGTTATTATCTGACTGTGACTCT
AGCTGTCCTAGTGAGGGTAACCTGGCACCTCGTGGTTCACATTTGTTTTTATTTGAAGGT
TAATGATGCGGAGCATCTTTTCATGTGCTTATTGGCTGTTTGTTCCTCCTCTTTAGAGTA
ATGTCTATTCAGATCCCTTTGCCCATTTTTTCAATTGATTTGTCTTTTTATTATTGTACT
GTAGGAGTTTTTTATATGATCTTGGTGCAACTCCTTATCAGATGTGATTTCCACATATTT
TCTCCCATTCTGTGGGTTGTCTTTTCACTTTCTTGATGGTGTCCTTTGGCACACAAAAGG
CTAATTATTATTTTTTTCTTTTTTTGAGGAAGATTAGCCCTGAAGTAACTGCTGCCAATC
CTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCATGCCCATCTTCCTCTACTTT
ATATGTGGGACGCCTGCCACAGCATGGCGTGCCAAGCAGTGCCATGTCCGCACCTGGGAT
CCGAACCGGCGAACCCCGGGCTGCCAAAGCGAAACGTGTGCACTTAACCACTGTGCCACT
GGACGGGCCCCAGGATAATTATTTTTTAAAGAATTATATTTTTAAAAGTCCATATGAGAA
CTACTGCCTGAAGTCAATCTTGCGTATCACCAATGGTATATGCTCTCACTTTGACAAACA
CTGGCTAGCCTCATATTTTCAAAGAAGAATACAGCATGCGAGCATCTGTGCTCCCTCCTA
TGTTATGTGTCTCCCTGAGGGCAAGTGTTCCCTCTGCCTAGAGTCTGCCTGTTGGCATGG
TAGGCTGCCTTTATGAAAACAGGTCAGTGTGTGAGTTGGACTAGAAGAATCAAAACTTTA
GGATTAGTGGTTGTGGTTTTTGTTTTGTCTATGCCATCCTAATTTTTTTCTTGCAGAATG
ACAACTTTTTTTTAAATGGTTAATTTCATTACTCAGGTGTTTGTAAAATACTCGATTTAA
TGTCTCTCTGAATAAAGAAACATGTTAATTACTCCCTCAGTATTTGGATATCCATGGGAG
TGGGAATGCTCTTAATCATAATATATCAGAAAATATTGTTTTATATTGTATTCCTTTTTT
TTTTAAAGATTTTATTTTTTTCCTTTTTTTCCCCAAAGCGCCCCAGTACATAGTTGTATA
TTCTTCGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGATGCCGCCTCAGCGTGGCTTGAT
GAGCAGTGCCATGTCCACGCCCAGGATTCGAACCAACGAAACACTGGGCCACCTGCAGCG
GAGCGCGCAAACTTAACCACTCGGCCATGGGGCCAGCCCCATGTACTCCTTTTTTATATG
TTTCTGAATTGGTTCTTCTTTTGAAATGGTTTTCTGCTGTCTTCCATTGTTGTTTTTTAG
GTCTGCTGTCAGATTGTATATGATCCGTAGAGAATATTTAAACTACAAATAAAACTCCAT
CATTAAGAGATGAAGTGACTATATTTTTAAGAGTACCTGGGTTCTGCTCTTTTTGCACAT
AGTTTGGCTTAGGCGCATCTCTCTGTCCATTTGGCAAAAGTTGTAGGTCTCCTATTTGCC
TTCTCTTTCTGCATTGTTGTGGGTTTCCAAAGGGTAGGTGATTTTCATTCAGGAGGGCAT
CTACTTTATTTTATGAAACACCATCAGCACTAATACTACGTATGTGCAGGTAATTGCAGT
GCTTCATGATGAATTTGGAATTGGTGTTCTTTATTTCAGGGTTTGTTGGTAATAAGAGGA
AATTTTAATTTTTCACTATCGCATTATCATTAGAGTGATGAAAAATACCTTTGAGGCTTC
TAATGTGGTTTTCACTGGTGAAAACCATAATTGCTATCAACAGTGGTAGGCTGTTGCTGA
AGTGGAAGGCCCTGTTGGATCCCCTTGTCTCCTGTGCAGAATCTTCTAGATTAGAAGGCT
GTTGTTTCATGTTGCCTAATGCCAACATTAGAACTTTACGGATTGATATGTTTACTGTGA
CCATTCACGGACCGTTTCTACACCAGTTTCTAGGTCCTGAGTGAGTGGCCTATTAACTCC
CTTGCCTTTTACCATAGGATTTTGGCGTTGGAGAAGCTAGGTGCTGTCTTCAATCAAGTA
GCCTTTCCACTGCAGTACACACCCAGGAAATTTGTCATCCACCCTGAGAGTAACAACCTT
ATCATCATTGAGACTGACCACAATGCCTACACTGAGGCCACAAAAGCTCAGAGAAAGCAG
CAGATGGCAGAGGTAATGAGACTGGACCTTCAGGATTCAATTAAAAGGCGTTCGTGTGAA
ATTGTGTTGAAAAGTTTAAATCTCTGTAATTGTTGGTTGTATTCTTTGTTATACTTAGAG
ATCCAGCCTCTTTTCACATCCTTCAAGCAGAGCCCTTTACCACAGTCCTTGGTTTTAGAG
GCTTTCTTGTGACTCAGGATTAATACACTGGCCTGCCTTTATTCAGTATTCAACTCTCTC
TCTCTGGAACAGGGTTCTTCAGTCCTTGAGCTTCCAAAACAATCTGTGATCTGTTTCCTG
GATTTGGGCCCGAAGGAGACAACTTTCATATTCCCTACAACACCAGCCCTTTCCAGAAAT
CATTTCCCAGCAAAAAAACAAATAGCCCCAACCGTGTAAAACTGTATCTGGCCTGGAAGA
GAGGAGACAAATAGTCTTAGCAAGGGAAATCAGGTGGGTTAGGTAGAGAAATGGTGGTTT
CATTTTCATGTTTCTCAGACTATTAGTCAAGTATTTGCCATAGCTGATGTTAGTTGTATT
GGCATTAAAAAAAGAAGTACCTGGTTTCCCCTTTAGTGACCTTCCCTCTTTTCCTTGTCT
ATATACCTCTCCCTTTAATCTTCGTTTTGGGAAATCCTGGTTTTTGTTGACAGACTTTGC
TGCTTTATATATTATAAACTCCCCCTGGAGGTGTTCTTGCACTTGTCCACCTCTCATCCA
GCACCCACCTCTGAACACACCAGTTCTTCATTGGTTTTTTGGATTTAGGAAATGGTGGAA
GCAGCAGGGGAGGATGAGCGGGAGCTGGCCGCAGAGATGGCAGCAGCATTCCTCAATGAA
AACCTTCCTGAATCCATTTTTGGAGCACCTAAGGCTGGCAATGGGCAGTGGGCCTCTGTG
ATCCGAGTGATGAATCCTATTCAGGGGAACACTCTGGACCTTGTCCAGCTGGAACAGAAT
GAGGCTGCTTTTAGGTAAGGAGCCCAGGACATCTAGGGTTTTGGAGGCTGGAACGAGAAT
TCTCTGGGCTGTGACTAATGCCTTACTCCTGATTCTTTGTCTGTATGCAGTGTGGCCGTG
TGCAGATTCTCCAACACTGGTGATGATTGGTATGTGCTGGTGGGCGTGGCCAAAGACCTG
ATACTGAACCCTCGATCTGTAGCAGGGGGTTTTGTCTATACCTACAAGCTTGTGAACAAT
GGGGAAAAACTGGAGTTTTTGCACAAGGTAGGAATCAGCCAGTGGTTCTCCTGGATCTTA
GGTCCTACTAGAGTCTCCCACTTTTCCTTAAGTTGTGGGTCAGGTCTTCTGGTGACCATT
TTGAGAGCTAGCTCATTGATTCTGATCCATCTCTTGGTGGCACCTGGAAAATGTTCGGGC
TTTCATGCTCCAGTGATGCTCTGGTGCCTGTGAGTCTCACAGGAAGCTTGTATGCTAACC
ACCCACAATGGGGAAATAGATGCACACTGAATTGGCCCCTTGTTATGGTCTTACTAAGCA
GGCAGCAATTTGTGACCAAAATTCGGCAGTTTTAAAGAATTGATAATCTCTAGGGAGTTA
CTGTTTAATGGTTACTGAGTTTCCCTTTGGAAAGATAAAAAAAGTTCTGGGGATAGATGG
TGGTGATGGTTGCATAACAGTGTGAATGTACTTAAAGCCACTGAATTGTGTACTTAAAAA
TGGTTAAAGTTGTGGGGCTGGCCCCATGGCTGAGTGGTTAAGTTCGCTCGCTCCACTTTG
GGAGCCCAGGGTTTCTCTGGTTCGGATTCTGGGCGCAGGCATGGCACCGCTCACAAGGCC
ATGTTGAGGCGGCATCCCACATGCCACAACTAGAGGGGCTCACAACTAAAATGTACAACT
ATGTACTGGGGGGATTTGGGGAGGGGAAAAAAAAAAAAGAAGATTGGCAGCCGTTTTTAG
CTCAGGTGCCAATCTTTAAAAAAAAAATTGGTTAAAATTGTAAATTTTATGTTATGTATA
CAGTCGCATGTCATTTATTGACGAGGATACTTTCTGAGAAATGCTTTGTTAGGTGATTTC
TTCATTGTGTGAACATCATAGAGTGTACTTACACAAACCTGGATGGTATAGCGTACTACA
CACCTAGGCTATATGATACTAATTTTAGGGGACCACCATTGTATATGCAGGCTGTCATTG
ACTAAACCGTTGTTATGTGGTGCATGACTGCATTTTACCACAATTTAAAAGAAAAAATCC
TGTTCTCTCCTCCACACTGACAGCACATGAAGTGGCTCCTCCAGCTCTCCCTAAGGGGAG
TGTCCTCTAGGAAATAGTTATTTCATAGACCCTTCTTTATGCTGACCTCATTATATCTCC
CTTATAACTAAGATGTCATTTGTCACTAGCACTCCTTTCTCTTCCCTCCATAAACAGCAG
TCACTTCTCAGATACCAAGGCTTCACTATTAATTAATGGTGCCTATTGAATTAGCATAGG
CTCTGAGGCCCCAGGACGTCTCACTTGTGGCATTGATCCATTTGCTGGGTGAAATGCAGC
ATGTGAGACCTGTTTACCCAAACGCCCTCTTTCATAGAGACTGTTGTATGTGTAGTTTAT
TTCTCTGACAAGCGGGAGAGTATCACTCACTGTCCGTCTTCCTGACAGATGCCTGTAGAA
GGCATTTTGGGTTGAGGGGTGGGGCTAGCGTATAACTGTTTATTGTGATAGTTGCATTAC
CTTTTTTTCCTCTCAGACTCCAGTGGAAGAAGTCCCTGCTGCTATTGCCCCTTTCCAGGG
GAGGGTGTTGATTGGTGTGGGGAAGCTTCTGCGAGTATATGACCTGGGAAAGAAGAAATT
ACTCCGAAAGTGTGAGAACAAGGTGAATATGCTGGCAGAGGGCCCCAGATCCAGCTAGTG
AGGAAGGAGGAGACGTTAGAGGGATGATGGACAGTAACTGTTAAAATCATAGTCTTTATT
AGGACCTTGTTGTAGTCCCCCAATTTCAGCCTCAGAATTAGGCCCTTGAGACTTGAGGAA
GGCAGGAGTAGATGGGTTTCTTGACTTCTTCAAACTAAGAAGTAGATTTCTGTCTTGCTT
GCTTCTATAAGGAATTTAACTGTGAGAATTAGGCATATATTTCCACTATGTTGAAACCAG
TTAGCTCTTTTTCCTACCTTCCAGGAATTTATTGCTGACTGCTATTCTTTGATGTGTGCC
ATTTTACAAACATGTTGCAAACATGTTTTTACAAAATATGTTGCAGTCAGGGAAAGCTGG
ACTTTCTGTGGGTTCTGAACCCAAAGGTCACATCATTGCTGTCCCTGTTTTTTCCCAGCA
TATCGCCAATTACATCTCTGGAATCCAGACCATTGGACATAGGGTAATTGTGTCTGATGT
CCAAGAAAGTTTCATCTGGGTCCGCTACAAGCGTAATGAAAACCAGCTCATCATCTTTGC
TGATGACACCTACCCACGATGGGTCACTACAGCTAGCCTCCTTGACTATGACACTGTGGC
TGGGGCAGACAAGTTTGGTAACATTTGTGTGGTAAGTTGATGTTTACTTGGGTTTCAGTA
ATGTGTAGGAAGTCTGGCTCAGTTTGTGGTAAAGCCAAGGACCGGGGACTACGATCTCTA
ATATGGAAAGTAAAAATGGGTATAAAATCCAGTCCTGCCAAGGCTGGCTCTAAAAACAAA
AGTTTGGTTTCTTTAAGCCTTCTTACCAGTCTTAGATTTTTCCCCTGGTTTACCTCCTCC
CTCCCCATAGAACATGATTTAATAATGATAGGTCTAGTTTGAGCTAATGAATAATGATTA
TTTTTACTTTTTGCCGTAATTTTGGCTTATCTTTTTAAACCAGGTCTGACTTTGTTTATG
TTCTGTGGTCTTGCTCTTGCTGTGTTAGACCCTTGCTCATGGGTTGATTGAGTTTCTTAC
TTGTCGGACACCAGGACAGGTGCAGGAGTCTTGGACTTCGACATCTGCTGGAGTCGGTAC
CCCTAGGCTTTCTTTGCAAGGACTTTGGGTAAATATGTTGTTTGGTGACCCAGGTGAGTA
GGTGCAGGACCCAGCCCTGTGATTTATGTCACTTCCTTGTAGGTGAGGCTCCCACCTAAC
ACAAATGACGAAGTGGACGAGGATCCCACAGGAAACAAAGCCCTCTGGGACCGAGGCTTG
CTCAATGGAGCCTCTCAGAAGGTAAGATTGCGGAAGGGGCCCCAGAGGAGAGGCATCAGC
TTGTGTAGTACATTCCCCACGACCTTCACTGAGGAAACATTTTTTAGTGAATTATTCACA
GTGTGCATGTCTGCTGAGTCCTCTCCCATGTATGGAAATCCCTAAGCTGATAGTACATGG
ATGGACGCTGGCTTTGACATAAGGTGACCAAGTCACCATCCCATTTTTATGACTGTAGAA
TAGAAATTTTTCTGAGACAGTTTAGCAGCGTAAAATCTGTTTGGAGCGTAGTGAGTTCCT
TGGGAAAGGTGATTGCACAGATTCGTTCTGGTACTGACCAGCTCTTCTCAGAGGTGTGTC
CTGGGCTTTACTTTTCTCCTGTAAGGATATACTTCTATAGTAGAGCATCTCTGGCCTTTT
AAAAATAGATTCGTTTTAGAGGGCAAGCCTAGCAATTGCTGTTTTTTATAATTTTCTGTG
GTTTCCTCTTTTTTTTTTTATTACAAATTTGATAATTTAACAAAAAGATTTTTCAGTTGT
AATTTATCAGGGTTGATCTAACTTCATGTTTATGAGGGCATTAAGATCTAAGTAAATGTA
AAGAACATTTTAAGGTATTTTTAAATTTTAGTAATTTTTGGATTTTAAAAGTGGTGAAAT
CTGCACTTTGGAAGCACTGCTTACTTTGGGGAATCTAGAACAGGCTTCTGTAATTACTTG
TCTGTTTTTTACTTGCAGGCAGAGGTGATCATGAACTATCATGTCGGGGAGACAGTGCTG
TCTTTACAGAAGACCACTCTGATCCCCGGTGGCTCAGAGTCACTTGTCTATACCACTTTG
TCAGGAGGAATTGGCATCCTTGTTCCATTCACATCCCATGAGGTGAAATCTCTTAGACTG
CTCTGGCCTTTGCCTTCCCAAGGTGGTTTCTTGGTGTTAAATCTACCTAAGAGGACAAAT
CCGTTTGTCCCCATCTGCAAATAGGAGTGTTCTGGAAATTTTATAAGGTGACAGAAGTGG
CTGGGGAGATAGGAATCCTGATTTTTTTCCTTGGGGAAAGCCGTTTATTTTTTATACTGT
AACAGTGTTTGGTTCATTTCTGATGTGGGTATAGGGTTAGTCAGACTAAAGCCCTGGAAC
CAAACCCCACAGACTAGGAATGATGGGAAGATGTGGACTGGGGCATTTAGTGCCTCGCAG
AGTCAAGTCTAGGATTGGCTAAATTTGGTTTATGTCATTCCAGCTAAGGAAGGTGGGATC
AGGAATCCGATTTTACAAACCACTCTTTACATATGGTGTTCTCTTGTGTTCTGCAAATAC
AGGGGGGTTTTCTTTCAGGTTTTAGCTATCTCGTTGTAGCATAAATACCTATGGTCCTCA
GAGGAGTGATGAGATATTTAATATCTGTTTGTGTGGTAAAAATTAATAGCTTATTTGTTC
ATTGTGCTTCTAGAAACCCTAGACTAGTAGTTGAAATCATTTTTTTCTTTTAGTGACCGA
GTCTTTGTTTCTTCCTCCAGGACCATGACTTCTTCCAGCATGTGGAAATGCACCTACGGT
CTGAGCATCCCCCTCTCTGTGGGCGAGACCACCTCAGCTTTCGTTCCTATTACTTTCCTG
TTAAGGTGAGTCTTTGTTGGAAATCTGGGTTGAAAGGGGAGATTCTCAGCCCATTTAACT
GGTATTTTCTCTGGGCCTCCCTCCATTAAAAACCAGAACAGTCCATTAAAAACCAGAACA
GTCGTGAATGAAGGAGCATCAAGGCAGTTAATTGATGGAGGCAGTAATGAAGGAGAAGAA
TGGTTAGTGGTATTCAGAGACCTCTCCCCTAGGGCAGACCACAGACAGAGAAAAAGCTTC
ACGCAGTTTTGCTAATCGGAGCTCTGGCTACCAAGGATCAGCTTAGAATAGTGTTCCTGG
CTCTGTAAATGGGGCTCAGGTGTCTGAGGGAGAATAAAAAGCTTTCCTTACAGCTGCTGC
TTTCAAGCATCTGCTGTTTTCTTTGGGCATCTAACCTTTTTCTTCGTCTCTCATTTTTCC
ATGTTTTAGAATGTGATTGATGGAGACCTCTGTGAGCAATTCAACTCCATGGAGCCCAAC
AAACAAAAGAACGTCTCTGAAGAACTAGACCGAACCCCACCTGAGGTGTCCAAGAAGCTT
GAGGACATCCGGACCCGCTATGCCTTCTGAGCTCTTCCTTTTCCTGTGGGGCTTGTCGGA
GACTCTATGTTTTGTTTCCACCACCACCTGGCTTTGAACCCATATGGCAGAAGAAGGTTG
GCTGGATAATTAAGACTTTGCAATATTAAAGTTACTAGCTCTTTCCCATCCAGTCTTCCC
CTGGAGTGATTGGTTTCCCCTAAAATTAGCATTGAGATTTGCTATGTTTCTCCTTGCCTG
GTACATAATACTTTGCCCCCAGGTTCTGGTGTGGAATGTGGTCCCCCACTAATCCTCAGA
GCTTTCCCTGCATTGATATTTCCGGCTTTCTTGTCTACTTTTGTACACACCCTTAATTTT
TAACTGGTTTTCTTGTAAATATAGTTTTGTACAATGTTATCTTTGTGGGAGGGAGGGAGG
CAAGCTGAGGTGGGGACCAGGTTGGATATAGTATAACTCCTGAGTTCTGCCCCTCTGGAA
CCTAACCAGAAATATAAACCTAGTTTTTAAAGTGGCTGGTGTCCATGTGTCTTTTTTGGG
GATGAGAATTTAATTCTAGATTTTTTTTTTTAATTTTTTTCCTTTTTCTCCCTAAAGCCC
CCCAGTACATAGTTGTATATTCTTCGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGACCC
TGCCTCAGCATGGTTTGATGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACCAATGAAA
CACTGGACTGCCTGCAGCGGAGCGCGCGAACTTAACCACTGGGCCACGGGGCCAGCCCCT
GGGGATGAGAATTTAGATGGGAGATTTGAGCCTGCATTGGAGCAGGAAGAACTGAATATC
CTCCTTCCTTCCAGCTATCTACTTGGACTTCCTGGCACTCTCTGTGATGGGTTTTTTGGG
CTTTCTCTAGTCTTTTATGCTAGGCAGTTGAAACTTGGGCTCAGTAATAACCATGTGATC
CTCCACACCCTGTCCCATTGGATATTGAGGAAGGGCGGCTGATTTCTCCTGTTTGTTTTA
GCTTCATTCTACTTTGAGGTCTTAGAGTAAAGGATTGGGCATGAATTCCAGTTGGGTAGT
CTCTTAACAATGCCCCCTTTACTTCTACAGCTCCAGAAATGATTGTTTGCCATATGACTA
CTAGGAAGGATCAGTAAGTAAGAACCTAGACACTAACCTGAACTTGGGGACAAAGTCAGT
ATATGTCGTCCCTATTTAAAGGCACATGGGTAACCAGGGGAATCTTTCTGCAGCAGACAT
CTTAGGTGGGCTCTGGAGAGTCTTTGGGGTATGGGGAGGTAGCACTGCTAGCCCGTCAGC
TGGAAGTGACCCAGTCTCAGAAATGTTCAAGCCCATACCTGAGAATTCAGCCTTCCTCCT
CCTGCCCAACTGTGGGAAGCCTTAACCTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 2130..2456, 3191..3363, 3946..4087, 6305..6417, 8383..8520, 9822..9925, 20762..20927, 26181..26276, 29053..29125, 34249..34400, 34696..34851, 35609..35764, 36316..36459, 38887..39009, 39754..39908, 43037..43211, 43968..44173, 44270..44426, 45916..46041, 46498..46710, 47262..47360, 48078..48221, 48860..48964, 49389..49911
1001..1070, 2130..2456, 3191..3363, 3946..4087, 6305..6417, 8383..8520, 9822..9925, 20762..20927, 26181..26276, 29053..29125, 34249..34400, 34696..34851, 35609..35764, 36316..36459, 38887..39009, 39754..39908, 43037..43211, 43968..44173, 44270..44426, 45916..46041, 46498..46710, 47262..47360, 48078..48221, 48860..48964, 49389..49526
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved