Equus_caballus Locus AP1G1
snOPY snoRNA Orthological Gene Database
Equus_caballus AP1G1
Equus_caballus
AP1G1
3
SNORD71
49266..49351
69261
CCACTTAACATGCCCCAGTAGTTGAAGAACAAAATTGTACAGGCGGGCCTACTCAGTTC
AATTTTTGTAAAATATTTTTAAACCCTGCATGAAAGTGGCTGTCTAAGGAAAAAAAGACA
ACCTCCTGTTTATGGCAGGTCCTAAACTCAAGATTTGTGGTTAGTTCGGATCTCCTTGGC
ATCCAGCCACGTGCTGTGCTCTATTCACTTTCGGGGGTGCTTTACCACGAATCTATCCGA
AAGATTTTATTTTAGGTAGGTCACTTTTCCTTTAATTGGGCCAAGATAGCCTGGCTCTCT
TTACATTCACGTGGAAAATATTCGTGTCAGATGTTAGTAATTATTTATCAAGCTAGGAAC
GGTCTGGTTGGACTGTCTTTGGATCAGGTCATTAGTTGATGGAGTCACAGTCAGAAAGCT
CACTCCGGAAGGGTTTCAGCTATCACTAGACCAAATCTTTTCTTTTTACATATAAGGAAG
CTGAGGCCCTTAGGGTTTAAATGACTTGTCCAATATATGAGGTTGAGCAGTGATACTGGG
CTTGGAATCTGTTCTTCTGTGTCATCCTTTTTATAAATACGTCGCAAAGATACCATGAAA
CCACAGAATCCAAGATCATATAGAGCATGTTCCTGACGTTACCTAAAGAGAAAACTAAGA
TCTCAAAGGTGACAGGAAAGAGTTTGGGATTCTCGTGGATCACGACTGGCTCAACCTGGC
TGTGTTCTCCGCGTCCGCCTACTTCGCCTCTCCCGCTTCCTTCACCACCTTGTTAAGCCC
GCCCGCTTCAGGTGGCCCCGCCGCTTCCTGGTAGTCCAGCGGCCCCCGCCCCCCCCCAAG
CGGAACCAATGTCTGTCGGCTCCGGCGTCGGCCGGATCTTTCTCGCACAGACTCTTCGCA
GCGGTGACTCGGCAGCAGCGTCTCGCGTCATCAGTGACAGCCCCGACCCTTGCTACGCTT
TGCGTCGCTCTGCCAGGAGCAGTCACCTCCTCCTTGGCAAATAGTCCTCGGCGGGGTCCG
AGTTCTTGGATAATAGGAGAGGCGAGGCACGGGAAGTTACAGTTAGGGGACGCGGAATCG
ACAAAGGGGGGAAGATAAGGTCCGAAGTTTCTGTCATAGTGTGTGAAGTTAGTTAAAAAC
TCCCTTCCTCCTAAGGATCCCTCCGCCTGCAGTAGCGGTGGTGAGGCCGAGGGAGCCGCC
ATTTTGGATGTTCGGTTCCTACTGCCACTGCTGCCGCCGCCCCCGGAGCTGCTGGTTTCA
TTCGAGGTTTCGGGCCGGTGAGTGTCACTCGCGGCGCTAGGAGCATATTGCTTCTTGTGC
CCCGCGCCTGCGGGGAGCGCTCGGCCGGAGCTTCCTGTCAGTCCCAGGGGTCCCGTCCAG
GCTATGGGGGGTGAGAAGAGAGGACAGAGGCTGGGCCAAGAGGGCCCCGGAGCCCCGGGG
GCTGCCCTGACTTACTGAGGGCCGACCCCGAGGCCTCCGACCGGGAGGCTTCGCTCGCAG
CCGCGTTCCGTGCTGTGGCGTTGCCCGGCTGGTGCGGGCCTCCTTGGACCCATTGACTTT
CTCAGGCTGCGATCCTCCTTTGAGGGCTCATTCAGGGAGACTGGGGTTAGCGGGGCGGGT
CCCACCCCCGCGTGTCTTCTCTGAGCCACGTATCAGCGTTCTCGTATCTTGTACCCCGGT
CAGGTCTTTCGTAGAACTCTCTTTAGTATTTCCAAATGCTCAGTTAATTGCTGTCTACAC
CTGCAATGCCGTTCTCTCAAAACCAGGCATCGGCCTCGCCTTCCTCTAACCTTCCAACCA
ACTTTCCCAATTTTCCGGGGTTTTTTTGCAACTCACCTGCGAGTACAGTGCTTACCTTTC
TCTCCAACTCCAGATCCTGCGGACGTTCGTTTCCAATAATTCTCCCGATCTTCCCGACTA
CCTGAAAGAGTCGGGACGGTTGTATGTTTGCCTGTTAGGGTTTGGTGTTAGGAAATCCGT
CGAACCACTCGCTCAGAGTGTACTTCACCAGTAAATGTTTATAAAGCTGATTAAATGGCT
TGTGGGGGGGGGGGCGCGCCTGGGCAGTAGACTGTCAATATTTTCGCATTTATGGGTTCC
CTTTCTGTTCTGAACACTTAGCTTTTTTGGTACTTATGGACACAAATTTTTCTTGATGTT
ATTTATCCATGGGCATGGAAATCTGCCTGTGTAGAAGAATCTTATTCTGACGTAAGTAGA
AAGGAAAGTAACTTTTTTGGCTGCTGTAGGGATTACTTAACAGAAGAGAGGAGTGAATGA
AGATTTCTTAGTGATCTTAACTTTCAGGTCTTGTGTACAGTAATGATTTTTGCTGACTGA
TTCTAATAAATACTTGGACTTAGTGTATTGGATTTTTCTGGGAATAGTTGGATTTTAAAT
ATTCACTTCTACGGTTCCCCATAATACTTATTAGACCGTATACAACTTAACTTTTGTTTT
AAAAATACAGACTCTCCAGGTACCCATATCTTCATCACTTTTATTCTGCTCTTAAAGTAT
GTTTGCAGTATAGCATGCTTGAATAAAAGGCATTTCACGGTAATTCACCAATTATTTCCA
GCATTTCAAGTTAGATGAGTGTGATTGAATCACCTCTATTTCATCTCATCTTGGGTTTTT
ACATCTGCAAAAGAGAATTTATTTGAGATTACAGCCTAGTGAATGCTGAAATTTAAATTT
GTAACTTGCACTGGATCAAATCTTTTAATACTTCTAATGCATGTGTAAATGCATTATTAT
CATCAGGTTATCAGGTGGATAATTCCTGTACTGGTCGTATGATGTCCCAGTAGAAGACTG
AATGTTTTCATTGATAGTCGGTGTTCTTGTTATTTGTTTTAAGGAGACTTTTGAAAAATA
TATTGGTTACTATTTGTGTATTTACTCTGGAACTATGGAGTTTCTCTTTTGCTTTAAAGG
AACTGTCAAACACTCAACATCTATGGAATGCTCATTAATTTACTAAGTAGCCCCTTGTAG
TTGCTACTGAAATGTTTCATTTCTGAGTTACACTTTTCAAACAAGGTATTGGAAGAGCTA
TCAGATAGATGTTATTTAACTCAGTTCATTTCATGGTATAATGTACAGGTTTTTAAATGT
CATTCATTCTTAGGTATTTTGCATTCAGTTGGAGAAAATGTCCTTTTGCCTTACAAATTA
TGAGCAAAGTGCTGTTTAGTGCACATTGAGTGATCAGCACATACTTGAATGTCTGCTTTG
TGTAAAATCGTTGGGATTATACTTGAAATTAACATTATTGTTTAGGAAACCTCAGTTCAG
TTTCTTTTGGGAGGAGTTGCTTGTTCTTTTATCTCATCTGTTTCACTGACAGCAGGTCTA
GATTTGAGGGTGAATTTTAGGATGAAACTATAAAGTACAAAAGTTATCAGCAATGCCTTG
GTGATATTTCATCCTACTATTTATTTTTAAAAAGTAGTCTTGAAATCAGTGGTGTACAAA
AAAAAAAACACCCAAGTTTTTTGTGACTTACAGAAACTCTTTATACTCATTGAAAAAGTT
GAACAAGTATTTTCCAAAAGATTATTTTTAATTAAAAAAATTAAATTGGGAAACTACATA
CCAAAACAGATTTTCGAAATACTTAATCTCTTTATTTGCATTAGATGAGGATTTTCACAT
TTTGTGTATACAGCAGGACTTAATTGATATCAAAACTTTAAAACCCTTATTTAGATTTAG
CTTCAGAAAATCTAAAACTATTACCTTTCTTTAAACTTCAGCAACTTACTTAGTTGTTTT
TGGTGCTTGTAATTCAGTCTTTGCTTTATGAATTGTTTTCAGTTTTTGATTTGGCTTTCT
TTCATTCCTTTGTTACTTTTATTCAGTTTCTTTCATGCAGGATACTATTTAAAGTAGGAA
GCAATTTAAAAATTAAGAGAACATAGATTTATCCAAGCGTTTATGTTTCTTGGCTTAGAG
GTTTTGAAAATCATATCTTTGTCAAAAGTGTCAGGAGTTGTCCATTTGCCTTTTTCTGTG
GAAAATTTAATTTCAGTAAAGGCAGTCTTTTCTACCTTGAAAATATGTGTAAAGTTTTTC
CTCGCTGAAGGAGTAACACAAAATACTTAATATGGCATGAGTTCTAGTTACCAGGAGAAT
AATCTCTTGTCAAAGTCTGAAGGGTCCAGAAGTGAAAAAAACCACACACTTGCCAAACTT
CTTGAGTCAGCATTAACTAACACTTTTGTATAAAACAACAAGGTTTAGGATAATATGATT
GAAATGAGAAATGCTTTTTTCACTAGGTACTTGGAAGTTTTGCCTTTTGTTTTGGCCTTC
TTAGACCATTGGAGAGAGAAAATAAGTTATAAATGTTGTCAGTGAAGTATAGGCTTAGAA
GGAAAAAAATCATCGTAGTTTTTCAAAAGGTGGAGAAAACTTATGTGACCTTTGTACTTT
ATGAATAATAAAAGACATCTTAAAGGCAAGTAGTTTTTAGCCCCCTTTCTCTGTTGTTAG
AGTACAACAGTCAGTGTAACCCGATACGCAGTTGCTTTGCTCACTCCAGCTTGCTTGTTG
TAGCTGATTATATTTGTGTTGTATTGAGCATCTTAGGTTTTCAGCTTGTCTGGCTTTGAG
GTTAATGTTATGATTCTTGGGAAGAGCAGATATGAGAAAGACATGAACTTAGATCTATAG
AATTGTAAAATATTTGCACTCTCCTTTCAAGGCTTTGGATTAAAATTAAGATTGTCACAG
TAGATAATGGACACTGTTTAGTTATAAGATCTAACTTTTGTAAATGATCACACAATTATA
CAGCTCAAAGTAAATGGAGTTCCATTAGTGTTTTTACAGTACAATTTAGTGAAGCTATTT
ACTAACCCTCACTGTTGGGAAATTGTTCAGTTTCAAGCTGAAGAAAAGGAAGGGAAGTTA
ATTTTTTTAAAGCCTTTTGAGGTCTGCACATAAGATTTAGTTCCCTTGCCACTTTTTCAA
ATTTTTGAAAACATAATAGTTTTAAAATATGGTGAAAATATTGATTTGAGGTGAATGAGG
AAGCTAACTGAAATCGTTAGGCACCCTGTACATAGTTAATTGAATCTTCGTAAATACTAG
GTTTTTGGTATGATTATTGAAGGAAAACTGTTGTAAGAAGAAAGAACCTCTTTTTCTGAT
AGTACCCAATATATGTGATGTTTTAAAATTGTGTATTTCTCTCTTCCGGTGAAGGCATGG
GCTCTGTATTTTCTTTAGAAACTCTCTATGATGAAAGTTTAATAAATGGTGTTGATTATT
TAAAAAAGTAGAATGAGGAAGTAGCTTACAATTTGAGTTTTACTAGCATTTGTTTGTATT
TTTATTTACACACTGAACTTTTTGCTGTTCCTTGAATGCTCCGTGTTCTTTCATTCTCAT
TGTACCTGTTCTGCTTATACCCAAAATGCTTTTCTTCCTTCCACCTTGTGAGCCTGTTCT
TCCTTCCTCTCTACCCCCCAGGCAAAGAGGTGTAGTTCTTTTTTCCCCTTGGGAAAGGCT
GTAGCACTGTTTTCATTACTTGTTGAATTGTCTTACTTTTCCTTGAGCTTCCAAAGGACA
AGAACTATGTAATTTATGGTATCCCTAGTACATTGCTCAGTGCCTGGCACTTAGTAGTTA
CTCCGCAGAATAGATGATAATGAATGAAAATAATATGGAAAAATTGTTCGGGTGCTCAGA
TACATGATAATTGGTTGACGCTAGAACCAAAAGCAGTCAGGGTTCTGACTGAGTTATGGG
ATTCTACTGCAGATGATTTCCTTGTGACTGGTAGAGTTGATGTCAGTGAAGTTTATTTTC
AGGTTTACAAAACATACAAAACCTTGTCTCCAAGTCTTTGAAGATGTTATTTAGATGTTT
AATTCCCAAAATGACATTATCCCTTTCTCTCTGTGATTTCCTCAGACATTTATGCAAAAG
CTTCAAGTGGCAGCAAAAAAATCTACTCTTCCTGCCGTGATCTTTCTTTCTTTTCAATAC
CTATTATGTAATTCATTATGCTGAGGAAACTAATAGTAAGTTGAGAACTTCAGTCTTTTC
CCCCAAAATGGAAATATGTTGACAGTTCAGTGATTTGTTACTGACTCTCCTCTTGTAGTT
GAATAATCTACTTTCATAGTGCTGAGGGTTTTTTTTAGTTAATTTGCAAAATAATAGGTG
TCCATTGTAATAAGTGAAAAAATCTAAAGACATACTTTAAAGAAAGCTCCTTCCCCTCAG
CCCTTCATTGTTACTCCCCAACCATTTTACCAGCTTATGGGTATACATCAATATTTCTCT
CCATGCTTGGTCAAGTACTGTATTTACTAAAATAAATGTGCGTATATAGGGATTCTTTGT
TTTTACAAAAGGGAGATCATACTTTCTATATTACTCTATAACAAGCTTTTCTTAGCACCT
CATGGTCAGTAAATATAATTCTAAACTGTTCTTTTAAACATCTCTATTACGTCTCATAGT
ATGGATGTATCATACACAGTTTATTCAGTTCTTTTCCTGTGGAAATTGAGATTGTTTCTA
GATTTTACCGCTGCAAACAGTGCTACAGTAAACATCGTTGTACATGTCACCTTATTTGCT
GATGCTTTTATTTCTACAAGCTAGAGTCTCCAAGGTGGGATTTATGGGTTAAAGGAAGTA
TATATTAAATGTTATTATTGCTAGTTTACTCTCCAAATAGATGTCATAATTTCCACCTCC
GCTAGCAGTGGGTTTTCCGTAACATCACATCATTAAATGTAATTACTTAGTCTAATTTTT
ACTGATCTGCTAGGTGATAAATGGTCTCTCAGTTTTGTCTTAATTTAAGTTTTCCTGTTA
CTGGAGCTAGCCTCTTTTGATAGGTTTTTTGGCCATTTGAATTTCCTTTATTGAGAATTG
TCTGTTCATGTCCTTGGTTCATTTTTCCTTTAGGTTGTTTTTCTTCTTTTCTTATCTGTA
GGAACACCTTATCATATGTTCATTCTTTGTCGTATGACACATGTATTTATTCATCTAGAA
TTAACTTTTATATGGTGTAAAGTAGGAGGTCTTAAGTGGGATGTTAAGTTCGTGTATGTG
TTTGCTCTGTTTCTAGACATTCTGTTTTTCTTTTCCTGCACCATTATTTTAACTGTTTTG
AGTATAATAACTTTATAGAAAGTTACGCTATTAAGAAAAGCTCCTGACACTGTACTTTTT
CATTTTCTTGACTATTCTTATACATTTATTCTTAGATCTATATTGATTGAAAATAATTCT
GTTGAGTTCATAAAACCTCAAAAAAGCCCACTGTTTAGAATTGTGCTATATTCATATATT
AATTTTGAGAGGCCTGATATTTTTTAATGATGATAATTTTTCCTTGTTATGATGAGTTTC
CATTTGTTCAGTCCTGTTTTAGGTTCTTTAATAAAGGTTTCCTAGATTTAATAGTTTTCT
TCATCTAGTTCCTATACCTTTCTTGCTAAATTTATTCTTAGATATTTTATAGTTTTTGAT
GCTTTTGTCAGACAGTTGGACTTTTTCCCCTCCATTTCCAGCTATTGTCAGAAACATGGG
TTAAAAATGAATCTTTAATTTCCTCTGGACTTGCACCTCCTCCATACCCCACTTTTCTTG
GTATCCAGAATTAACAACTTGAACTCATGAAGACTATGCTAGGGAAAATTTGTTATCTTA
GTATTAAATCACTTTCTAATAAACTTTCTCATGTCATGCTGTAGAAAAATGCCCTTAGAT
AAATGTGACTCTGTCCTTTTAGGATGAATACCATGTTATTATTTTGAAAGTTTGCAGTTT
TGCTTTATTTATCTCTTCTTATGGTTTTTGTTAATTTGAATTTTAAAAGCAATATTTATT
GCTGAAGTTACACATATTGATTATTTGAAGGATATCAGAAAATATACAGAAGTTAAAAGG
GTATCACAGATAATCTCCCTTAACATTTATTATACCCTTTGGGACATAGTTTTGAAAAAA
TAAGATTTTGTTTTGAGAATTTCATGACAATTCTTGATACTTGAGGACTCCTCAGGATGT
TTTTGCTAGTAATATTAGGATTAGGAGAGTGAAAAATTGCTTTTTGTTTTATTATTGTCA
AATTAGATGTTGACCATGTTTATCTATCATTATTTATTTGGCCTTTATTGCTTTTCATGT
ATCTTAATGCGATTGAATTGTTCTGTAGGCATATTTGCATTTACATACATTTATTTTTAA
AATCTCAGTTTTGGTGAATTTTGGTTATGGACAATTAAGCATAAGAGAAGATTCCTGTAA
TTACTTTGGCTTATTAGGGAGAAGTGAGCTTAAGACCTCTTAGAGGGATGCCAGCTGGCT
GCCTAGACCTGGTGTGGTGGTATCTCCCTGTGGTCACACATTTCACAGCTTATTCCTTAG
CTTTGAAGATCCAGAAATTACATTTTAGTATATCACCTAGGGATGATTCAGCCTAATCAA
ACTCAATGATGTGTAAGTTAGAGTAACAATATTCTAATTGACAAGGGGCCATGCTTTCCT
ACTAAATTACCTATATCTACTTTCCAGGGCACCCTGTTCCTTGTATGGAAGTACTTGGGA
AGCAAGGTACTTGAGAAGGCGATTAATAATCAGAACGTTGCATTGTGAACCTGAAACCAG
AGCATAAAAAGTTGGATGGTCTTGAGTGTTTTGTCATTCTAGGCCATGGTGAAACCTGAT
GAGAGCGCTATCCCTGTCCCACAATGGTGTTTGCCTCTCCAGTGACCAAAATGCTTATCC
TCAGATTTAATCTTTCTTATTCAAACAGTGACTGCTAACACTGGTCTCTCCTTTTCTTCA
CGCTGTAGAACATTTCCCTTCTATGAAGACATTTCTTCATACAGGGGAAATAGATAGGCA
CTGCCTCCCTCTCCCTACCCTGCTTCTCCCAAAAGAAAGAAAACCACAAAAAACACAAGG
ACATTGAAAAAACCCAGCTAAGTCGGATTAATAACAGCGGTATCTGTAAGGTATATTAGA
AAGTAAAAGTCTGATTGAAGTATAATACTGTTGACCAGTCTGGTTTAAGCTTTCTTACTA
TTTTGGTTATTGTATTTTGCAAGTTGTAAATGCATTAAAGCAATTCAGATATACATATGA
CATAAAAATTTGAAGTAGGGGTTCTCTGTGGAGCATAATATAAAAATAGAGACCATATGG
AGAATGTGAGAGAGAAAGCATGGTAGCTTCTTTTGGAGAGTTTTGCCTAATGTTAACTTA
GGTCCCTTGAGCATTCTCAGCCATACTTAGAAATCTGTGACTAGATTTTACTCAGTAATC
AGTGGCAAAGTTAATTGAAATCTAATTTCTTGAGTATTTTCTCATTGTTTAGCAAGAAAG
ACTTTAAGTACAGTTTTTTGTTGGATAGATGAGGTAATTTTAATATTGAAAAATTGCTTT
TAATTTAGAATTTCTTTTTAAATTTAGAGCTCAGATACCTTTAGGTTTAAGGGAAGAAGG
ACCACATAGCAGCAGGAGCCCCAGCTTTTTCGTCATATGTTGTTAACTGTTGGCTGTCAG
TAGCTCAGAGCTTACAGCCGGGTAGTGTAAGCTCAGAAGTAGGAAGAAAGTTAACCAAAC
AGGCTAGAATAGAAGGCTGGGTTGAGTCCTGATGCCTTTCCCGTAGCTGTTGGTGAGCAG
CCGTTGCACCTTTATTTTGTGTGCTTTGGAAAGAACAAGTACATTTTCTTTAGATAAGAC
ACTTCTAGCATCTAGAATTCAGTAAATACAGTATTTATTGAGTTCCTGCTCTTTTAGGCA
AGGGGAATACAAGGTTGAATAAGACAAACAAGGATCTGGCATTTAGGGAGCTTATACTTG
AGTGGGAAAAAGAGGCATTTCAAAGAAAAAATGGTAATCATGGTCTGGGGATGGTATTGC
TGTATGAGGAAAACCTTTATCCCTCAAAGGAATTTGTGGAGATTTTGGAAAATAACCATT
TTCTGCATTTTTGGGATAAATTTTAGGAGAGTTGGAACATATGCAGTTATTGGTTTTTGT
TCTGTAGTTTAAAAATTTGTTTCCTATAATAAACATTTATAATTTTGATCTCTCTTTGGG
CATATAAAGTCTCCTAATTTAGTTTAAGCTCCCAAACCTAATTTTGTTTAACCGCTTTGG
ATAGAAAGTTTTCAAAAATGAATTTCACATTTCCTTTTTTTCCTCTAGATTTTTCATCGT
TATTTATCAAATAACCATTAATGAAATAGAAATACATTTATCTACAATCTCTGAACCTTA
AAATGTCAGACTTTTAATTTTTCTGTGTTCCCTTTCTGTTATTGTCCTAATAAGTATTTT
TACTTTTTATTATTCATTTTTAAAAAGAAAAAGAGGGACATTTTATTTTGAATAGTGTAT
AAGCCATGTGAATGTAAAACATAAGGACACTTAGGCATTGAATAAAACTGTTGAATACTC
TTAGGACTTTAGGGGCAGTTGAATGCTTTTTGCTAGCACACTAAGTGGCCTCGGGCTACT
ATGCTGTGTGTGTCTTTAAGATAAATGCTTTAATTTTGGATTTTTAAAAAAATATATATA
AATTAAGGCAATTATTGTGGAAATCAAAGGCAAAGATTTACCTGTGATTTGATCTTTTCC
TTTCTGATTAATCATTTAAAAAATTTTATAGGATAGAAATGTATAATGTAAGGGCACAAA
TTGTATTTTCTGAGTTATGGTAAGAATACAACATGAGATCTATCCTTTTGACAAATTTTC
AATTGCGTAATACAATAGTGTTAACTATTCGCACAATGTTGTATAACAGATCTCTGGAAT
TTATTAATCTTGCTACTGGGTTTTTGAATGCTTGTTTCTGCTATATGTAGGTTTTGTTTG
TGTTGCTGTTGCTTTCATTTCTTCCCTTGCTCTTAGGTGACATTTTAACTACCATCAGTG
TCCTTTCCTAAAACCAACTTCTATTTCCTTGCTCCTACCCTCTTCTGTTTCCCTTCTAGT
TTTCTAATTTGTTCTATTCTGGAACAGGCTGAATGAGAACATGCAAGTAGAGTAGATGTT
TTAGTGTGTTGATTTGATATTCTCTATATTGGCTGCATGAGATTATAAAAATGTGTTTTG
GATTCTCAGCTATGTTCTGTATAGCTGAGTCATTACTATACATTATATTCATATCTTATT
TTTTAAAAAAGATAGAATTTGTTGTTATTTATGATAGGTATTTAACCTGTTGCGTTTTAA
GGAATCTTGTGGTTTTGAGTATTTTGGAAAGCAAGTATAAACTTTCAAAAAACAAGGAAA
TCTATCAACATTGTAATAGAAGCCAAGTAGGTTATGTTTTCCAGATTATGTGGTCTGCAA
CATTCACTCCATAGCTATTAGATGTATTTGAATTTAATTTGTAATATGAAATATTTAAGA
CATGAAACCTATGGAGAATAATAATAAACATTCACTTACCCACTCCCTTATCTAAGAAAT
AAAACGTCACCAATAGAGCCGGAGCCTCCTGGGTATCACTCTGTCCCTGAGCATATTCTC
CTCCCTTCCAGGTCTGCCACTGTTGGCTTTGATCTTTATCCTTAATATGCATGTGCTTAT
TCTCTTACTGCATTTTTGTATCTCTAAAGAATAGGTTCTTTTATGTGTTTTAAGCTTTTA
TAAATATTAATACTGCATATCTGCGACTTGTTTTTGCTCAAAATTAATTTATTCAAGGCT
AGTTTGTATAGCCAACATTATGGCCAACATTTGTTTAGTGCTTACTGTGTGCCTGGCACT
GTGCTAAGTATTTAACATGTGTTCTCATTTAATTCTTGGAACAGTCTTTTAAGGTAGGTA
CTCTCCCCATTTTACAGATGAGGAAACTGAAGCTGTGAGAGGTTAAGCCATTACTCAAGG
ACACACAGCTAATAATAAGTAGTGGAATTGGAATTCAACCAAGGTAATTTTACCTCAGGG
TCATCATTTTACACAATGATAAGGGTCATTGGATAAGGATAAGGGTCCCCAGTCCCTTAT
CTCAGTTCTGAAATCTCCAAAACACTGAAAACCAGGAGTTCTTCATGATTCTTTTGGTGT
TAAAATCTGACCCGACCAGACATGAGGCTGTTTGAGGTATTTATTTCTCTCGTTTGGTGT
GCATATTCATATGTGTTGCTGCAGAAGTATTGTTTGATAATGGAACTGCCATCCCAGACA
TGGTGGGCGAATTATGACGTATAGTATCTACACAGTATTACCTTTCTAAAATTCAGAAAA
TTCTGAGTTCTGCCCTAAAGGTTTTGGATGAGAAATTGTGGACTGGTACTATGCTACAGA
TCTCTTTCTACATGAGATTTTGGAATTGTTGGGCTGATCCAGAAAGCATGTAATTTCATA
AAAGAACAAATTTCTAAATACATTGAATGTGTTTGGCCACGGCAAAATTTGTCTTACCAT
AAATATAATTTTCTGATCTGTCATTGATCAGCAGTTTCTTCTTCTTATTGTATGGCTGAA
GTTGTAAAAATCTATTTTCCTCGCTAGGTTTTTTTTTTTAATTGAGGTTCATAATTGTTT
ATAACCTCACTAGGCTTTTGAGTTCTTAAGGATAGAGACTATGTCCTTGCCAGTGCCCAG
CACCTATTACAATGCCTGGCATAGAGAAGGCTCAGCAAATATTTGTTGGATTAGCGATTG
GCACTTTTTGGTATAATATGTTTCCCTATTACTTAGGTCATCTATGGGTTACTGTGACTT
ATGAATTGAACGAGGAGAAGGAAGAGGTGCATGAAACTAACTTCTGATTCTGTATTTTTT
ACATTCTCTCTTCCCACTTTGAAATGAATTTAAATGATGCTTATGTTGATGTCATGTAGG
ATATTTTCTGTTTTATAACTGTAGTCTGCTGGGACCTGAATTGTTTAAACTTTTTTTTTC
ATTTTCTTGAGTAAAGACCTTGATCCTGCTGCTTTCTGAATTCAAGATTCTGAAACTTAA
TGGCTGTATTTCAGTTAAGTATAGTGTATGATATGTTTGCTCCTTATTGAAGTTTGGTTT
ATTTTTTCCTTGTACAGGTCTGCTTGACAGCATTGATCTATGAAAGGACTACGTTTGATT
TATAAAGAATGGTACTTTTAAAATTAACAAACTGAAAATAGAATGATATGTAATGTGATC
TTTAAATACTTGTTCTCATAGATTTTTAGAGTTAATTTCTGTGCCCTTATTTTTCAGTTG
ATGGAACAAAGGCTTAGAGAGGTCAGATGACTTGCCTTAGGTTGCTTGGCTGACAGTGGT
AGATGATTATTAGGATCTTTCTTTTATTGTTTTGGCTCTAATATTTCTTTTAAGTATGTT
CTTTAGTGGAATTCTGTATTTCTATGATTTACAGGAACTTTGAGGAATATTTAATATGTT
TTTAAGAGTAGTTACTTGATTTAAGAACTTTGACTTGCCATTCAAAATCTTTCTTCAAAA
TATAAAATCATAATCTCCAAGGTTTATTAATGTAAGAAAACTTGAGGAGGAGGCGGAGGG
ATAGGCTAGCTTATTAGGCTCAGTTCCATACCCCAATGGTTTTTCCTTCTGCTTGTGATT
CTTTTACTTTAATTGCTGCTGCTTCCGGTGCATAGTTGCTGTGGTGTGCCTCCCTCCTTT
CAGTGCTTTGTCCAAAATATAGACACAAATTTCTTGTTGTTTTCTTTTGCAGGATTGGAA
ATGGCTGGAATTTTTAGAGTAGACTCTCTTACGTATCTGTGGGAGAAATAAAGAGAAATA
CAAATTCCCGAAGATTTGTCATTGCCCCTCTTCACCTCTTTAAAGTCTTATCTTCTCCTT
CAGTCTTGTTTCACCTGTGTAAAAGTCTAAAAGGGATGTAGTTTTACAGGCGCCTTTTCT
GACCTGCCCATGTTTGGAAGGCACCATCTTTCAACCTGCCACTCAGGAACTCCTTTCTAG
ATAACTTGACACCACCTTTATGGTTCAGATTAGTAGGGCCGTTTTTAGTTCCCTGTCCCA
CATAGGTCCCATCCCTAGTTTATTGGCACCAAAAATGACTTCATTTTGCAGGTGAGAACT
GCCTTCATCCATCCCTTAAATAAGGGTTTGGTGTTTTATTTATTTATTTATTTATCAGGA
AGATTTAGCCTTGAGCTAACTACTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTAGCCC
TGAGCTAACATCCATGCCCATCTTCCTCTACTTCATACATGGGACGCCTACCACAGCATG
GCTTTTGCCAAGTGGTGCCATGTCTGCACCTGGGATCTGAACTGGTGAACCCTGGGCCGC
CAAGAAGCAGAACGTGCAAACTTAACAGCTGCGCCACTGGGCCGGCCCCCTATTTGTTTA
TTTATTTAAACATTGGCACCTAAGCTAACATCTGTTGCCAATCTTCTTTTTTTTTTTTCT
TTCTTCCTCTTCTCTCCAGAGACCCCCAATACATAATTGTAGGTCTTTCTGGTTGTGCTG
TGTGGGGTGCCGCCTCAGCATGGCTTGATGAGTGCTGCCATGTCTGTGCCCAGGATTCCA
ACCGGCAAAACCCTGGGCCTCCAAAGCTGAGCGTGCAAACTTAACCACTCGGCCAGGGGG
TCGGCCCCTGGTGTTATCTTTTATAGGCTGAACAGTATGACCATATCTCAATACACTCGT
CACACACAACGTATTTTTCAAGATTTTACAAGATGTTTTGTTTCACTAATGGTTAAATAT
GCCTTTAAGTAGTTTGGAACAATTAGTAACTTTCTAGTCTACTTTATATCCCGGGTATAT
ATCACTGTGACTGATCAAATAGATCTTAATTGTTTAATTGAAGGGCTTTTTTGTTTACTT
TTAAAAAACTTTAACTTTTAAGTTAACATACAGTAAAATTGACTTTTTTGGGGTTGTATA
GTTCTGTGAATTTTAACTTATGTATATAGATTTCTGTAATCATCACTACAATTAGGATAC
AGTTCTATCATCTCAGAAAAACAACTTCATACTGTCCCTTTTTTGTACCAGCCTTAACCA
CTGACGGCTACTGATCTATTCTCCATCACTATAGTTTTGTCTTTTTGAGAATATCGTATG
CATGGAATCATTCAATATGTAACCTTTTGAGAGAGTTTTCTTTCACTAGCATAATGCCTT
AGAGCTTGTGTTATGGCTGTGTAGCAATAGGCTTTGTTCCTTTTTTACTGCTACGTAGTC
TTCTATTTTATGGATTTTTCCACATTTTGTTTCCAGTTTCTGGCAGTTATGAGCAGAGCT
GCTCTAACTGTTCATGTATTGGTTTTTGTGTGAACAAGAGTTTTATTTCTCTAGGATAAA
TTCCTAGATGTGGGATTGCTGATTCATATGGAAAACATATGTTTTAAGTTCATAAGAAAC
GGCCAAACTGTTTTCCAGAGTGGCAATACCATTTTGCATCCCCACCAGCAGTGTATGCGA
GTTCCATTTGCTCTGCATCCTCACCAGCACTTGATATTTTAGCCATTCTTGTAGGTATAT
AGAGGTATCTTTTTCTGGTTTTAATTTGCATTTCCCTGATGCCTAATGTAGTTGAGCATC
TTTTCAAATATGCTTGTTTATAACCTTTATACCTCTTTGGTGAAGTGTTTTAGTCTTTTA
CTCATTTTAAAAAATTTGGTTGGTTGGTTTTAACTGTTGCATTTTGAGAGTTCCTTTTAT
ATTCTGGATACAAGTTCTTTGTTGGGTATGTGATTTACAAATGTCCCAGTCTGTAGCTTG
TCTTTTCATTTTCTTAACAGTGTTCTTCATAGCATAAAAGTTTGTAATTTTTATGAAGTC
CAGCTTTATCATTTTTTCTTTTATGGGTTGTCTAATGTCCAAGAATTCTGCTTAACCTCA
GGTCATGAAGGTTTTCTCCTATATCTTCTAAAAGTTTTATAATTGTATGTTTTACATTTG
GATCTATGACCCATTTTGAGTTAATGTTTAAGGTGTGAGATTTAGGTCAGGGTTCAATTT
TTTTGCATATGAATGTCCAGTTGTGATGTGTATTGAGTTGTTCACAGTATTTCCTAATTA
TCCTTTAATGTTTGTGGTGTTATCCCCTCTTTCATTCCTGATACTGGTAATTTGTATGGT
TTCTCTTTTATCTTCTAGCCAAAGATCTATCAATTTTATTGGTCTTTTCAGAGAACCAGC
TTTTGCTTTCATTGACTTGATCTATTGTTTTTCTGTTTTTAATTTCATTGATTTCTAATT
TTTAATTTACTTTTTTCTACTTGTATACTTATTTTGCTCTTTTTCTAGTTTCTTAAAGTA
GAAGCTTAGATTGTTAGTTTGAGATATTTCTTCTGATACAGGCGTTTAATGTTATCCATT
TCTCAGTAAGCACTGCTTTAGTGTCTACCACAAATTTTGCTAAGTGTGTTTATGTTTTTT
CTTAGTTCAGTACATTTGCTAATTTCCCTTGATATTTCGTCTTTTACCCATGGATTATTT
GGTAATGTATTGTTTAATTTGCAAGTACGTGGAGAGTTTTCTACTTAGCTTTCTGTTACT
GATTTCTGGTTTAAAATTCCATTATGGTCAGAGACCATGCTTTATATGATTTCCATTCAT
TTAAATTATTAACTTTTTTTACTGACCCAGGACATGGTCTATCCTGGTGAATATTCTATA
TGCAATTGAGAAGAATGTGTATTCTCCTGTCGTTGGTTCCATTGTTCTATAAATGGTGAA
GATGTTAGCACAGGTTGCCAAACTTAAAAAAGAAAATGAACTGATAAGTGTTGATTAGAT
CCGGTTAATTGATGGCATTCAGGTCTTTTATATCCTTGCTAATACTCTATCCATAGTTCT
ATCATTTACGTAGGGGGCATTTTGAAGTCTTTATATTTGGTGGTTTATTTTTTTTCTTTC
ATATCTCTCGGTTTTTGCTTCGTGTATTTTTTAGCTCTTTTGTTAGGTATATTTGCCATT
AGGATTGTTGTATTTTCTTTGTGAATTCACTCTCGTGTCAAGCAGTGGGAGGATAGAGAG
TGATTTACTCCATGCTCTTAGGATCACAGCTCCTCTAGTCAGAGAGAAGATTTCCTCTTC
CCCAGTTTTTAGGTAGGTGCCTGCCTGGCTGTTACTGCCATTGCTTTTCTGTTACAGCCA
CCACCATTGCAGTATTGCCTACAGGCAGGGGTGGAGGAAGGAAAAAAACGTAAAGCCAAA
AGAGAGAATTTCCTCCGTTGTCCTGTTCCTCCTCCTTGGACCTGGGAGGGGTTTTTTTTT
TTTTTAAAGATTGGCAGCTGAGCTAACAACTGTTGCCAATGTTCTTTTTTTCTTCTTCTT
CTTCTTCTCCCCAAAGCCCCCCAATACATAGTTGTATATTCTCATTGTGAGTGCCTCTGG
TTGTGCTATGAGGGACGCCGCCTCTGAATGGCCTACGGAGTGGTGCCATGTCCGTGCCCG
GGATCCAAACCGGCGAAACCCCGGGCCACCGCAGTGGAGCACACGAATTTAACCACTCGG
CCACAGGGTCAGCCCCCAGGAGGGTTTTTCTTTAGGGCTCCTTATCTATTCCCAGTGAAC
ACTTCTGGGCTTTGGGCTGCCCTTGGGTCCAGGCTGGACACTACTGGAGGAAAAATGACA
GCCTCTTGCCTATTTGATGGAACTTCAAATTCTTTTGCTCTCTTTCTCCAGTCTGCTCAC
TGTCATTTACTTTTCAGAGTCCTCAGGTAGCTGTGACACATATTTTTGTCCAGGATCTAT
AATTACATCCAGAGAGAGAGACAGGAGTCTTCCTGGAGTTTGTTTACTCCAGCTTCCCTG
GAACCAGAACTTTTTGTTTAGTTTTGATCTTAGAATGTATTCTGAAATATGCTGAATTCT
TTACTGTGTGAATTAACTTTTATTGTTCATCCATGCCTATTAAGATTTTTTTTTCTGATA
TATAAAGAAATTAAGTTCTCACAGCTTAAAGAAAAAACTTGCTGCTTTTCTCTAAGCTAG
AGGCAGCCTAGTATAGGAGGAAGAGTGCTGAATGGGGGAATCAGGAGACATGAGTCAGGC
TAGTAACTAATTCTGTAAACTTGTACAGGGTAGTTAACACTCTGGATCCTCAATTTGCTG
CATAAAACCTAGTGACATATATTTCTGTGATTTTGTGGCTGATAGCTGAGAAATTGCTCC
AGGTAACTTGTTTTTCTCTCAACTGGCGTAAACTTTTGTGATTTTCCCTGTTGAACTACA
AATTTTGGGATGAGATTTAGGCTTTTTCTAATAGTCTTTGTTTACTTTGTAGAATCATTG
AAGTCTTCATAGAGAAAAGTTATTTTCTAGTACAGTATTACCAATTGATCTTGAGTGATT
TTAGTTGCCATAGACTTCTCTTGTTCCCCGCACACCAAGTTAGAGTTAATGGTGATGAGG
ATTCTTTTTGAAAGTACAATTGCTGGGCTTTGGACAGTCAAAAACTGATTTTATGTTTAG
TTCTTAACCTCTGAGAGCTGTAATATCTTTATGCTTTTCTTAGTTATATTCCACTATGTT
GATATTTTATATAGTATATTGGTTTTGCTTACTCCTAATATTATTTTACCCTAAAGTGTG
TGGTACTTATGGTTATTGTGAAAGAAATAGTTCCTTAGATAGATCTCTAATTTAAGTATT
TGTTTTTTTATTATGAAAATGTTTAATGATTTAAATACCTTGTTTATTGATGCTTTTTGA
CTTTTAAAAAGCTTTTGATTATGAAAAATTTCTGATATACGTGAAAATGGAGAATAATAT
AATGTACCTTCATGTACTCATCATATACTGTCAGCAGTGATCAACATTTTGCCCACTTTG
TTTCATGTTTTTTCCCCTTCCTCTCTTCTTTCTCAGTATATTTTTTCCCCTAGAGTATTT
TAAAACAAATCCTAATTATAATAAAATTTCATTTGTAAAATATGATATTCATTTTTTAAG
TATTGGGAAGAACTCTAGCCTTGGAGTTCTAAGACCTGGTTCAGGTGCCACCTGTCACCT
TTACTTTTGTGATCTTAAGCAAGTTGTATAGTTACTCTGAGACCAAGTTTCTTCATAGGC
AAAGTGGGGATAATGATCTCTGCCCTTAATTCAGAATCCTCTAAGGAACAAATGAGATAA
TGAAGATAATGAATGTAAAAGTGCTTTGTAAACTTCAAACACTAGACCCTCAAGTATTTC
TATTAAAAAGTAATAAAACAAAGTTATGCAGGTAGCTTTATATAGTGTAGAGGACACAGT
CTTCCTAGGAGGGCCAATATGAAGGAGGATATTAATACCTAGGGAACTTTTCTAAATTCC
TAATGCGCTATCCCTACCTTGAGGGTTGATGGCAAAGTGAGCTGAGGGGAATGGGATATC
CTCCTGGTATGCTGGATTAGATCATCATTGAGAATCATTGTTTTAAGGATTCTGCAGCCA
ATATGTTATTGAAGATGATTGTAGTGATATCTTTATCTAATTTTATCGTCATTTTTCTTA
ACATTATTGAGGTATAATATACATACAATAAAATGCACCTGTTTTAAATGTACAGCTCAA
TGAATTTTGAGAAGTGTATATACTCATCACAAACATTTCTGTCACCCCAGAAGGTTTCTT
TGCATCTTAGTCAGCCCCCAGTCCCTACCCTCAACCTCAGGCAGTTGTTGATCTCTTTGC
CATCACTATGGATTAGACTTGTCTTCCCTAGAGTTGCATATAAGTGAAATCATACAATAT
GTACTCTCCTATGCCTGCTTCTTTTGCTCAGCAGAATATTTTTTTAGACTCTTCTATGTT
GTGTATTGCTTCTGTTTTATTCTGAGAAGTGTTCCTTTGTATGGGTATACCATTATCATT
CATTGTTTATGAACATTTGGGTTGTTTCCAGTTTTGGGCAATTATAAATGAAGCTTCTGT
GAATATTTGTGTATGAGTCTTGGTGAGAACATATATTTTCATTTTTCTTGGGTAAATACT
TGGCTAAAGACTGAGTGGATTTGTTGAATCATATGCTAAGTGTATATTTAACTATTTTCC
AAGGTAGTTGAACCATTTTGCATTCCCACGAGCAGTCTATGAAAGTTCATTTGTTCTATA
TCATTGTCAGCACTTGGTATCCCAGTCTTTTTAATTTTAGGCATTCTAATGATGTGGAGT
GGTATCTCATTATAGTTTTAATTTGCGTTTCCCTCCTGACTAGTGACTTTAAGCATCTCT
TCATGTGCTTGTGGCCATTCATATATCTTCTTTTGAGTAATGTCTATTCAGATCTTTTAC
CCATTTTTAAATGATTGTCTTATTATTGAGTTATAAAGTTATTTATATATTCCCAATACA
ATTCCATTGCAAGATAGGAATTGTCTTTTTTCTCTTTCTATGGCTTGCTTTATTTTCATA
ATGGCATCTTTTGGAGAGCAAAAGTTTAACATTTTTAAAAGTCCAATTTATTAATTTTTT
CTTACATGTTTTGTGCTTGTTTTGTATGAAATCTCTGCTTAAGTTCCCAAAGATTTCTTC
CTCTGTTTTCTCATGGATGATTTTTAGTTTTAGCTTATATATTTAGGTCTATGACCCATT
TTGAGTTAATTTTTTTTTCTTGTATATTGTTTGAGGTTAGGGTTCTAGGTTATATTTTTC
CCCCCATATAAATATCCAGTTTTGCCAGCACCATTTGTCAAAAAACGACCCTTTCTCCTA
TTGAATAACCTTGGCCCCTTGTTGACAGTCAGTTGAGTGTATTTGTGTGGATCTAGTCCT
AAACTTTTCTATTTTGCTGTATTACTCTCTAAGTTTATCCTTAAATTCTGTTTCACACTG
TTCTGATTACTGTAGCTTTGTAGTATTTCCTGAAATTAGGTAGTGCAAATTCTCCAACTT
TGTTCTTTTTTTTCATAATCGTTTTGGCTGTTATAGGTCCATTATTTTTTTCACTTTTAA
AAAATATTCATGAGACTATGACACTAACAGTCTTATCCTCTAAGATTGATTTATTTTTTC
CCTCATCCCTTTTTCAAAGAGTACCCGGTGTACTGAGATGATTACTGTTTCTTGGAAAAG
TGTTTAAATCTGACGATTGGGCTTCTCTCCTAGTCTCTCATTTTGTTGAATTGAGCTTTG
ATTGTGATCATATTCAATATTCGTTTGATACTTTGTTGAGTTATGTTGAGTTTAACAACT
GAAAAGAAAATATTTATCTTCTCTAGAGAAGGTTAGGCATAGGCCTTTGTTTATTACTTT
AAGGAGTGAGTAAAGATTGAGGTTGAGTTAGTTCCTAACGTATTTTGATGTTAGTGATGG
ACTTTACATATTGGTGTATTCTATGTCTTATTTTGCTTAATTTGATGTTTAACATTTTTG
TTTATATTCTTTCCAGAAATTTACTGAGTTTTGAGGAGTTTGTACGTAATAGCTTTGCTG
AAGCTTTGTATCATTGGGTTTATTTAGCAAGTTTTGAATTCTTAAAAATTGGAAATTTAT
GTGGGAAGTTGTGTAAATGATTTTGGTAGTAAAAAATGTGAACATCTTTATTTAATGTCT
TTCCATATCCAGAGGATGCCAGCCCCTATCAGATTGCGGGAGCTGATCCGGACCATCCGG
ACAGCCCGAACCCAAGCCGAAGAACGAGAAATGATCCAGAAAGAATGTGCTGCAATCCGA
TCATCTTTTAGAGAAGAAGACAATACATACCGGTGTCGGAATGTGGCAAAATTACTATAT
ATGCACATGCTGGGCTACCCTGCTCACTTTGGACAGGTAGGCTGGGCTGAGACCACATCT
AGCAAGGGTACTCTTATTTGAATAACAGTAGCTCAAAGACTGTCAGGGAGAACAGGATAC
TTTTGATAGCCTTGTAGTCTGATCATTGTGGAACTGAGGGTAGAATTGAGAGAGAAGGCT
GCAGACCTGGAAAAGCATGCTATTGCCATCAATTGTCCTTTCTATTGGGAATCTCTCTTT
ATGTGGATTAGAGTATGTTTTGATGGTGGCAGCTGCCTAACTTAAAGATTAGCCAGTAGA
TTGTGGTTCTTCTGTCACAGGGCCTGGATTATAAGTAAGAAAACGTTTGCTAAATGTTTC
CTTAATTATTTTCTCTGTGCACGATATTATAAGGATGAACATTCAGAACAGATGTTTTTA
AGTAAAAGCAGTTAGGTGGTTGCCAAGTGATGGCATTTAAGGATTTTGTCCTAATTACCT
CATTCCTTGATTGCTACAACCACTGTGCCGCTGCCTCCTGATTCTCTCCCACACACAAAT
GTGTATTATTTGATATAGCCACTTTGGGCTTTGAGCATGATATGCTTGGTGTTAAGTACT
TTCTTCTTTCCACATTTATACATGATGAGGGGGATTGAGTTGCAGAGAAGAGGATAGTGG
GTTGTTTTTAAATTCTTATTAATGCTGTTAATTTTATTTCATTTAATTTAAGAATTGTAT
TATATGCTGAATAGTCTTTATGGAAAAGACTGCAAAATTAAAAGAAGCAATGTACAACAC
TAGGTAGTATGAGGAAAATACCCACTCATATTTCCTTTATTCAAAGATAACTATTGTTAA
TGTTGGATATATTTAATTTATCAGGAAAGGTGGCCACCAGTATGTCTTCTGTTCAGCTCA
GTAACTTCAGTGGAAGGAGATTCCCCCACCCCTGAGTTAAAACAAAAAATTAATGAAATT
GAATCTTACCAGACTAACTTGGGTTATTAGTTTTATGGTCATCTTGGGATTGGGAATGAG
ATCAGCCTCTCTAAAATACATGACTGAGAGTGGGAGAGCGTTAATTCCCCAAAGGAAAAT
TGAAGTGTTAATAATATCAGAGGAAAAGAGATCAGATACTAGGTAGGCAAAAACAACAGC
TGTCTCCTATGTATACACGTGTTATATGCTTTTACCACATCAAAATTGATCCAGGTGGTT
ACTGATGCAGTGCATAACATACTTAGTAAAAACCAAATAGGTGTTCTTATATTCTCATTG
GTTGATTTTAGGTAGACACAGTAGGTTAGATTTACAGAAGTCTGATGTGTTGGGCTATAA
GGGGTAGTCAGGTGGGGAGAAGACTCTTAAACTCTCCACTCAGAGGTAACTGTTAACATC
ATGGAAACAGTAGTTTGACATACTCCCAAGGAGGTTCTTTAAGGACAAACTCTTGAATTT
AAAATCATAGGATAGATTTAAGACTTTGGTGATTTTTAATTTTGTAAAAGAGCTCTCTAT
ATATTTCTAAGATTTCATTTCTATAACATTTTTAAATAAAATATACTTTCCAGGTCTGTC
TAGGTGGCATTTTTTTGGGTGTTTGGCAACTATTTGATAAAATATTTAATTCTTAGGTGG
AAGTGTTAATACTCAAGGAAATTGTACTAAAATCTTGGTACAAAAAATATTTTTATGAGT
GGGAATGGGAAATCATAATTCTAAGTCCCTTTTTCTGTTTCCTCTATTTCAATCAGTCAT
GGCCCTGTCCATATCAGTAATTTGGTACCCTGCGTATTGGAGTTCCCTTTGTAATGTACC
CGTAAAAAAGTTAATATCTAATTCTCTCATCTGCCTGTATGAATCACAGTGCCTTTTTCA
TTTAATTATGTGTAAAAACTGGCCACTCTTTAATTGCATTTTATTTGTTAGACCTGTGCT
GTTCATTATGATAGCCTTAGCTGTGTAGCCATTGGTCTCTTGAAATGTGGCTAGTTCAAC
TGAGGGGAATATTAAAGGAAAATAAAGTTTTGGGGAGTACTTGATGCAGTTATTGGGAAA
CTCTTGAGTGTGTTTTAGACAACTTGGGTATATGAATCTATCAATTGTAAATTTTATGAA
ATCTAAATACAGTTCAAATATTTCTGATGGATATGTAGTGTACAAATTATGTGCTGTAAG
TGTAAAATACATACTGTGTTTAGAAGCCTTAGTGCAAAAGAAAGATGTAAAATAGCTAAT
AATTCTTATGTTGATTATATGTTGAAATGATTATATTTTAGATATATTGGGTTAAATAAA
ATATATTATTAAAACTAATTTCACCTGTTTCTTTTTACTTTTTATTGCAGTATCTAGCAT
GATGCTGTCCAATAGAAATAAAATATGAGCCAGATGTGTGATTTAAAAATTTCTAGTAGC
CACATTGAAAAAGTCTTATGTAAATTTTACAGTAAAACCCATGAGGTGGTAATATCCTCA
AGTTACAGATGAAGAAACTGAAATTCAGAGTCTAAGTGACTTGTTTAAATTCACACAGCT
AGTAAATATTAGGGAGAGGATTAGAACTCAACCTTGTATCACTTCAAAACCTATTCATTC
TTTGGGTTTAGTTTAAATCTATAAATAGCTATTTGCATTAAATTTATTAACTATTTTATT
TAATTACTTTAGCCTTGCCTTGCACAAAGGATTTGAAATGGCTTATGTTACCAGCATCTA
TTTAAAAGAGAAAAAGAATAGTAGAAAGTAAGAGCTGGGAGAAGGAAGAATTCAGAACAC
AAGGCCAGTGTTGTTGTGGTTAGTGAGACAGCTAAGACAAGAAAAAAAACATTCAGTTAT
GTGGGTGTAATTACCAGAATTTAAGAGCACAACTGCAGGAACCAGACTGCCTGCATGTGA
ATTCTGGCTTTGTTACTTTACTATCTGTGTGGTTTTGAGCAAGATCCTTAACCTTACTTG
TCTGTAAAATGAGGACAATCCTAATGCTACTTTGTAGGGTTATTATGAAGATTAAGTAAA
TTAATAAATGTTAAACGTTCATGTTTGGTGCATAACAAACCCTCAAATATTACCGACTAT
ACCATTTCCTCAAGGACAGCAAACAAAAATTCTTGAAAAAGCACAGAATTTTGAAAGAGA
TGTTTTTATGTGGGTCTTTTGTGCAGGAGTCTGTTAGTAATGTAAGAGACAAGTATCCTC
AATGTTGTTAAAACAAAAGCAGTGATAGATTTCCTATAGGGTTGTAACCTTTCACATGTC
TGGCTTAAACACAGCCCAGAAATAAAGTGGAGTATCTAAAGAAGTGGGTAGATTGCAGGA
GTAGAAAATGGTGGCTTGGGGGCCACCTTCTTTCACAGATGTGTTTTTTTCTTGCAAATA
TTTAAAATTGTTTTTTCTTTTTTTAAAGATTTTATTTTTTTTCCTTTTTCTCCCCAAAGC
CCCCCAGTACATAGTTGTATATTCTTTGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGAC
GCTGCCTTAGCGTGGTTTGATGAGCAGTGCCATGTCTGCGCCCAGGATTCGAACCAACGA
AACACTGGGCCGCCTGCAGCGGAGCGTGCGAACTTAACCACTCGGCCACGGGGCCAGCCC
CTTAAAATTGTTTTTAATTTGCTGCTAACATATAAAAACCAAGGAACATCTCGTAGAAAT
CTGCATTTCTAATTTCTCTTAGAAAATCAAAGAATTTGACAACACTGGATTCACATTTTC
ACATGGCAGTAATAGGCTAGTGACCACCTCCAGGCTGGGCATGCATTCTCTTGTTTTTTT
CCCAATTCCAACCTGGCCTGCTGTACCCAATTACCTGGCTCCAATAGTCTTCCCTTCCCT
CAGTATAGTATAGCACCCCACTTCCTTAGGTTCTCTAGTTTTACAATGTTGTCCATAAGG
TCTTACACATCTTTGGTGAAATTTATTCATAGGGCTCCTTGGAGCTCTTGTTCCTATTGC
AAATAGCATTCTTAAAAAATTTTAATAATTATTTTGTAGCTATATAGAAATATAATTGAT
TTTTATATATTTGTCTCCCTAGCAACATTATTGAACTCGGTTCTAAAAGTCTCTGTAGAC
TTCGTTGTTTCTGTGTTGTCAATACTATTGTCTGCAGATAACGGCAGTTTCCTTCCTTTT
CCATTCTTAAATATTTTCTTTTTTCTTATTTCCTTACTACATTGTATGTGTGGTACAATA
TTGAAAAGAAGCAGCGATAGTAGGCATCCTTACCTTGAGCACCCTTCAGCCCAGATTGTG
GTCTTCAAATACCAGTTTACTCTGATAGGGCCAGGGACCATTGGAAAAATGGCTCGTCCC
AAATCTGGGGCGGGAAATGTACAAAATAAGCTTGTACTGTCTTTCTGTGCCAGAAAGCAA
GAAAGACTACAGAGGTAATGTTAAAAGGATTTAGTAGCCACCAAAGAGGCTGTCATGCCT
CAAAATGAGAAAATATGAGCATTAATAAGAATAATAATTGTAATTGAAACATACTGAGTT
TCTATTGGTGAGTTCATAATAATTTTTAGAAATTTTAAAAACTCCATTGGTTATCTTTGA
AGGATACCAGGAAACAGACTCATTATTTTGAGAACTAGTAAATAAAAGGAAAGAAATAAA
CAATTATTCTGCATTTCCTTACCAGCAGTTCCTTCTGAAGGAATTGTTGGTAAGTTCTTT
CTGAAGGAACTATTCATAACCCAATGGTGTACATACAGAAGTTACTCCCTTAGGGGGATA
GCCTAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCCTGATG
ATCATCAGTGCTGCTTATGTCACAAAAAGAGAGACAATCACCAGAAATAATATAAGCCTC
TGATGAAAGTTGATATCACCGCCTTTGAAGTATATTTGCTAAATCAAAACGAAACTGAAA
AACCTGAATCTGATCAAGGCTCCCTGTTCGTTCAAAAAGAGACATTTATAAGAGTGTTCA
ATGCAGCATTGTTTCTAAGAGGAAAACGTTGGAAACAATTGTGCTCACAAAAAGAGTAGG
TAAGTTGTGATATATTCACAAGTGGGGTACTATAGAGCAATGAATGTGACTGATTTAGAG
GCTTCTTGTCTGGAAATGAGTAATACTCAAAAGATGTTGAGTGAAAGAGCAGGAATATGG
TATGATACGTATATAAAGTTTAAAACATTCAAAAGCAATGGTTTCTACGTGTGTAGTAAG
GACATAGGGCATGGCAGTGATGAACAGTGGTTTTAAGTTTTGGTTACTCCTGGTATTGAG
GCAGAGTATGGAGAAGGCTTCAGTTGAGTTTGTAATATTAAAAAATTTTAAATAAAATAA
ATGGGGTAAAATGTTAAGATTTGATAAAGCTGGTTGGTGGGTCAATAAGTGTTATGTGAC
CTTTTGTGTGTTTTTGAATGAAATATTTCATAATAAATTTTCTCAAGAGAAAAAAATGGG
ATGCAGTAGGAATGTTAGTGTTTTGTGGGTTGTTTTTTTCCCTATGCCAGAAGAATGAAA
AAACAGGCTCTGGTCTGTATAGATTTTATGTTGCTAGGCTACATACTGATAAAGCAGTTA
CAAGCTTGTTGTTCAAAAATGTGTGACTGTGTGTGTATAAATTAGAAAGTTATTTCGGAA
TATTAAAATGAAATAAAGGTAACTTTTAAAAAGACCTAACCAATCAGTTGCAGATCCATT
CATGTTTACAAAATTTTAATTGCATCTTTTCATCAAGGTGATTGTTCACATCATAAAGCT
CAAATGTTAAATTTAAAAGTAAATGTATGTGTGCATTTCACCTTGTGGGAAATTGTTCTA
CAAGCTAACAAAATGGGTGCAGCTTTTTTCTGAAGGGCAACCAGATTAAATGTTGAAAAA
AGACTAGTTGTACTTGCTTCAGAATAGTGTAACGAGCCAGAAACCTAATAAAGTTCTCTT
TTTAAAATTACTTTGAAATTCAAAGAAAATTGGAACAATTGTCATCTAGAAAAAGTTTAT
AAAATTTAATTGTCAAGCTCTACCTAAAATATACTCCATCAGAATATCCTGGGGGTGACC
TATATTTTTCAAAAATCTCCCAGATGATTTTGAGCAGTCAGATTTGGGAACCACTTCTTA
AGCCACTGACTGTATTTTTTCCAAAGGGGGCTGATAACTTCAGTCTCTTAGGCTTGTTAC
TTGTGGCTTCTTGGAATGCTGCTGCTGAGAATTCTTTAGGCCACTTGAAGGATCAGCTGG
AGAGAATTACTGTTTGCCCTGAAAGCAGAGAGTAGAGGACAACTGTTAATGGTCTTCCAT
GATGTGGCTCAGTTACTTTAGCCATGAGGAAACTGAGGCCCAGGGTGTTGAAATAACTTG
CTTAGGTCTCTTAGCTAGAAGTAGGGTTGGAGAGGCATGGTTTCTTTCTATTCCACTATG
TATTATGTGAAGAGATAGGAACCTTGCTCTGATGTTTTCTTAGTGTTTCTGATCTGAATT
GGGTGCCCTTCCTAACTTGTTTTCACAGTAGCTTGTGCATAACTGTCACAGTATATATAA
CATACTTTGTGATATATATCCAAATGTTGGTTTTGTTTTATGTGCCCTTCTAATTATATC
AGTGAGAATGTCTAGCACACTGGTTTGTACCCAGCAGGAGTTTACTAAATTAAAGCAAAA
CCACGTGGGGCCGGCTCTGTGGCTGAGTGGTTAAGTTCATGCGCTCTGCTGCGGCGGCCC
AGGGTTCGGATCCTGGGCGCGGACATGGCACCGCTCATAAGGCCACGTTGAGGTGGCGTC
CCACATCCCACAACTGCAACTAAGATGTACAACTATGTACCAGGGGGGTTTGGGAAATAA
AGCAGAAAAAAAAAAAAAGAATGGAACAGTTGTTAGTCCCAGTGGCAATCCTTAAAAAAA
AAAAAAAAAAAAAAACCCCCGGCTCAAACCCTTGGAAAGAAAAAAAAAAAAAACAGAGGG
GGAAGAATTACTCAATCCTCCCTTCTTTTCTAAAATGGGGGAGAAAAAAAGAGAGTTTGG
AAAAAAAATTTTAAAAATGTTGTGTGTCCGCGCATTTTAATTATGGGAAAAAATAAAAAA
ATTTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATTATTTATCTTTGGAATAGATAATGACAATTCATTGATGCAAAATCTAAA
AGATACAAAAGGATATATGATGAAAAAACTGTTCTCTGTCCTCTTCTAGTCACTTAGCTT
CTCTGCTTGTAGGTAGCTAGGGGTATCAGTTTCTTGGCTATCTTTCTAGAGGTATTTTAT
ACATCACTAGGCAATGGAAATATATATTCTCACTCCCTCCCCTTTAAAATATATAACATG
CTGTTTGTACTGTCCATTTATTAATCTATCTTGAAGGTTAGACCATATCAATATATAAAG
AGCTTCCTTTTTTTTTAGCTTTTTTGACATGCTCATAGTAGTCTGTCCAGCACAGTATTT
CGTTATATGTGTGAATCATAATTTATTAAACTAATGCCTTATTAATGGACATTATTTCCA
GTCTTACTGTTTAAAATAATACTATAGTTGAATAATATCCATTATTTTGCATGTGTGAAT
ATAAATGTGGTATAAGTTCCTACAAATAGATTGTTGAGTCAAGAGGTATGTGTATTTGTA
ATTTAGCAAGGCAAGGTCTTTCTTGCTACAGCTTGTTTATACTTCCATCACTGATGTCCT
CACACTGTTAAACCATTTTTTTATCTTTGCTATTGGATTAAAAAGTAGTATCTCAGTATA
GTTTTGATTTGCATTTCTTTTTCTTTTCTAATAACTTCATTGAGGCATATTTTGTATATC
ATATAATTCACTCTTTTCAAGTGTACAGTTCAATGATTTTTTTAGTAAATTTAGCTAGTT
GGATTTGCATTTGTTTTATGAGGAGATTGAACTCCGTATGTCTGAATTACTTTTGTTTTC
TTTGAACTGTCCGTTTTCTTTGTCCATTTTTATATTGGCTTGTTGGTCTTTTCAGAAATC
AATTTGTAGGATCCTGTTATATAGGATTTCATATCTGAAATGAATTGCAAATATTTTTTT
CCAAGTTTGTCATTTGTCTTTTGCCTTTGCTCACAGAGTTTGGAGTAAAAGCAAAAGTTT
TTTGTTCTCTGTAGTGGTGTGAATCTAAAAGCTGGACTGTTTACCATGGTCTTAAAGCAT
ATGCTAGATTTGTGGATTACAAATGTTTCAGATAGCATTTTCAGGTAGCTTTAAGTGAGG
AGGAGTAGTACAGGATGGATTTGAGGTTGTTACCTAAGGGGTGGATGCATTTAATTAATT
ACTATTTTTCTTTTGTTCTGTAATTCATCCAAGTGTTGAGTTGTGTTTTAGCTATTGCTG
CTCAAAAATGGATGCCCTCCCTTCACATTTACCCACACCCTATTGTACTCCCCTCTATCC
TTTTTCTTTTTTAATGTTTGAAAACTTTGATAACATTCTGAAAGGTGAAACATGGTACCT
TCTCAGCACTATTGCTGGCCACCACACCTAAGCGTGAAATGTGATGAGAGTTAATCCTTC
GTTGAAGGATGTATTTCAGATGCCCTTTCCAGTCATATAATCTTATATTTACCCCTCAAA
TTTGTCACCTTCAAAAATAAAATGCTTATTTTTGAAGCAGAGTCACTGTACAAATGGGGA
ATATTAAAAAGAATTAGTTTAGTGTTTGACCCTTTAAAGTTTAGTTTTTCTTTTTGCTGC
TTAGTTTTTAGGTGAGTTTTAAAAAGCAATAAATTGTACTCACTGGTCACTGATGACTTG
TAATGTGACTATCATAAAACTTGGTCCTAAAAAATAACAAGTAATATTAATGCCTAAGAA
TATGTCCTTCTCATTAGTTCATCTTAATAAAACGTTTTTGGGTAATTTATTTGTATAATG
CCTGGTGTTTGCCAGAAGCGTGATTCAATAAGGATGATGAAAATTCAGTGATTCTTGGTT
CCTGGAACGTTTTCTTTCACTGCTAAGATATTTGTAGAATTATTAAATGGGAAGATTTAA
AAACCTTCAGTTTAAAACAGTAAGATTTTTAAAATAACATTTTGGCTCTTGGTTTTCTCA
TTCACCTTAGCAATAATTTTTCTGCTGACCTTGGAAAAATGACTTGCATCATCTTGTATT
TCAGAACTTTTTTAGATTTAAATTGATTGTATAGTGGGAAGGGGAGAGATGTTACATAAT
CTTTGTCAGTCTCCGAAGGCATTTCAGTTTTCCTTTAGGATCCTGATTACTCTCCCTTGG
AGGCATGTTTGACTTGCTCATGATAATATAGTTATTTCACTACCTTTGGGTGTTTTTAAT
GCAGGTACATTGAGAAAGCAATTTTTTTCTTTTTGAGGAAGATTAGCCCTGAGTTAACAT
CTGCCGCCAATCCTCCTCATTTTGCTGAGGAAGATTGGTGCTGAGCTAACATCCATGCCC
ATCTACTTTATATGTGGGATGCCTGCCACAGCGTGGTTTGATAAGCGGTGCGTAGGTCTG
TGCCCGGGATCTGAACCAGTGACCCCCTGGCCCCTGAAGCATAGCACGGGAACTTAACCG
CTATGCCACCAAGCTGTCCTAAGAGAGCAGTTTTTAAATAGCTGAAACAATTTTATTTGT
AAATTCTTTTACTTTCCTCAATTTCACTTTTGAACTTACTAAACAAATTTTTATGGAAAG
TAATCTGACCTGATCTTAGATTCCTGTGTCCACAGGTCTGCATTTGAACCCCTTTCCTTG
GGATGCAATGATTCTAAATGGGAGTATGGTTTGAAAAACCCTTCTAGAGAGTCTAACTTG
TGTACACCTTTTGAAAACCACTGCTCTGGAGGACATGTTTGGCCTTTTCCATGTTTGTTG
AGATGGAATGATAAAGTATATCAGAGTGATTGTGATGTTCAAAAAAAGGCTAAGTAGAGA
GACAAATTATTTAACTGCAATGATTCTTAAGGTCTTAGGTTTCTTAACAATTATGTAAAG
AAAAATCACATAAAACATTTTAGGTTAATTCCACTACTGAGTTTTCCTCTGGCTTTTTTT
TTTCCTTCTATGTTTGGTTCTTAAACCCTCACCTCTTCCATACTACTTGATTCAAGCCCG
AAATATAGCACTTTCCACATTATACTAAAGTTAGTCAGTCTCTCTTCTACAATTGTGCAT
TCCTGATGTTTAGCATAGTGTTTGGCACTTGGGTGTATTTCTAGGTATTGAATTTTTTGA
TATTCAAAATAGGAACCAGACCTTAAATACATACATGAGTTAGGTGCTCACTTAATATAT
TTGTTATTTAATATTTAGTATAACCTAGGGATTAAGTTAGGAGTTAGGGTTATTAATATC
TTATTATAGTACTTTACTAGTTTGTGTGGATCTGTAGAACTAAGTTAAACTTCACAGACT
TGGATGACAGATTTCATAGGACCTTGACAAGATGATCTATTCCAGAACTTGACTATTATT
ATCATGATATCCAAAGATCTTAAATCTTTGCCTTTTAGCTAGGTAGTTTGATGATACGGT
TAGATCTGTTTACTTTAGTCACCCATTGACTCTTGAATTAAAGACATTGCTTTTCTAGAT
TTTGGTAGCAATTTCTTAATTTCTTTTTTTCCCCCTTTTTCCTTTTTTTTTATTTTCAGT
TGGAGTGCCTCAAGCTTATCGCCTCTCAGAAATTCACAGACAAACGCATTGGCTATTTAG
GGGCAATGCTGCTGTTAGACGAAAGACAAGATGTCCATCTTCTCATGACCAACTGTATCA
AGAAGTAAGTCTTACCTTCCTTCTAATAACTACTTTGCTCTTTTAGGTATTTTTTGTGAT
ATCAAGAACTTATGTTCCCTGATTTTATATTTACTGTCTAGAATACATGTGAATTGCTTT
TGGTTCTGTAGCTTATATGTAAAGAGGCTAAGCAGAGGATTGAAACTTTTGTAGGAGATA
ATTTAATGATGGTACTGCTGTACATCTTCAGGCATAGGGAGACAATTTAGCAATGAAATA
AGCATTTGGGCCTTAGAGAATAGAAAAAGCATTGGTAAATCTGAGCTTTCTTATCTTATA
TTTCTGGGACTTTGAATACCACGAGTAACGAAACTTTACATTTATTAAAGAATTGCCAGG
GTATATTCTGAGTAAATATCACTTAAGGGTAATAAGAGAGATCCTGCTTGCCAGCGAGCT
AATCCAAGATTTCAGTTGCATGGAATTAAACTTAGCCCTGTGAATTTTTGTGTGTAAGTC
TTTTTTATCTTTGATGGCTGCTTAACTGATTTACTAGTCCAGTCATTTTTGATTAACTTA
CAAACCAAGGCATGCTTGCTATATGGAGAAATTAGAAGGCTTGAGCAGGGACTTAGCAGG
TCTTCCCAGTATCTCTCTTATAATAAATTTCTGGTAGAAAGTTATGGAAGTTTTCATGGC
CTTGTTGGTTAAAGGTACGTTTTGATTTGTTTCAGTTTGATTTTGGTTTGTCTATCAGTT
TAATATCCTTTTTTAGATTGCTTCTTCATTTTCAGTATTTGTATGTTTGACAGAAAGTAG
AAGCAGGAAGATACAGGTAATAAATTTGTAGACATTGAACTCTTATACTTACCTGTGGTA
AATACTTCTCTATTTTAAAATTTCTCAATGGATAATGGAAAATTTCAAAAGAAAGTTATG
GTTTGGTTGTAAATATAGCATGTAACGTGTAAATACATTGAGTCTGTGAATTTAATTTTG
AGTGAATCTTGTTTTTTTGGCCTTGAAATAAATATGAATAATGAAAATCTAGTTGATTCA
TTTATTCAACAAATATTTATTGTGAACTTGTTGCATGCCAGGAGCTGTTGTAGCTCTGGT
GATGGAGAATGAAAAAAATGGGCAGAAATCCTTGGTGTCACGGAAGTTACATTGTTGATG
TTCAGCATGACTCTTATACGTTTCCTCTGGACAGGCCTCTGAGAGTTTCTTTAATTTCTG
TTCTTGCATGCTCTGTTGCCCTTTTTACTCAAGCCCTCGATCACGTGCTGATAATTTGGC
AGTTCTGCCTAGCAGCAAGTTCATATTAGAGAGTTAATATCAAACTCAAGTATAGGTTTA
TAGGTTGATAAAAGTTGAAGAATGAGGCACATAGGCAAAGAAGTACTCTTTGTGTTTAAT
TTTAATGAGTCAAGCCCCAAGTGTATTTGAGAGAGAGCTACTTTTTTGCTAATTGGAAAT
TGATCTTCAGTTTAAGCTTGGTTAAAAGACTTTGGATCATTCAGTTTTGTTTTATTTTTA
AATATGTTAATAAATGGGGAGTTTTTTTGCATGAACTTTTTGCTTTTTTTTGTATTATTG
GTCATAGTGTACCAGCATAATGAATGTTTGCCTCCTTCACTGGCCTAGAAAAACTCTTAA
GATATTAAAAAATTTGGGATTAAATCTTTAAAAATTGGATATGATATTTTTAAGAGCTAG
CAACATGCAAATTATTTTTTTTTAAATTGAGGTTATGATAGTTTACAACCTTGTGAAATT
TCAGTTGTACATTATTATTTGTCACTCATGTTGTAGGTGCACCACTTTACCCTTTGTGCC
CACCCCCACCCCCCGTTTCCCCTGGTAACCACTAATCTGTTCTCTTTGTCCATATGTTTA
TCTTCCACATATGAGTAGAATCATACAGAGTTTGTCTTTCTCTATCTGGCGTATTTCGCT
TAACATAATACCCTCAAGGTCCATCCATGTTGTTGTGAATGGGGCAATTTTATCCTTTTT
TATGGCTGAGTAGTATTCCATTGTATATATATATATATACACACCGTATCTTCTTTATCC
AGTTATCAGTCAGTGGGCACTTACGTTGCTTCCATGTGTTGGCTATTGTGAATAATGCTG
GAGTGAACATAGGGATGCATGAGTTTCTTTGAATTGCTGCTTTCAAGTTCTTTGGATAGA
TACCCAGTAGTAGATGGTTGAGTCATATGATATTTCTATTTTTAATTTTTTGAGAAATCT
CCATACTGTTTTCCATAGTGGCTGCACCAGTTTGCATTCCCACCAGCAGTGTATGGGGGT
TCCTTTTTCTCCATAACCTCTCCAACATTTGTTATTTTTTGACTTGGTTATTTTAGCCAT
TCTGACGGGCGTAAGGTGATAGTATAATTTTAATTAACATGCAGATATTCTTAATCATTG
AAAAATGAATGAAAAACAACTAAATATTCTTGGGAACTGAGAGACTAAATGGTAAAGCCA
TAGTTGATACTCAAGCTTCATTTTACCAGTAATTTTTATCTTAAATATTCAAATTGCTGA
AAAGTAGCAAACTTGGTTAATTTACAATTTACCTTCTTTTCCTGTCTTTGTTCTTCAGGG
ACGACTAAAACCACTTGTTAGTTTATTAAAATTACCAATAATGACCTTTACTTGTTAACA
TGAATAACAGTTTTTGTAAAAAATAAACTATTTTCTAAAACAAAAACAATTTAGTGAGGA
GAATGGTCTTATTTTACATTTTTGTAAATCTCTTTAATATTTGGCTTCATGGAAGACAGC
TAGATGCTCATATTTGCTTTTGCATTCAATTTCTTGTATTATATTTTGATTGAAGTTCAT
GAAGAAGATCCAGCCTTTCACAGATAATGAAGTTAGAAAAGGAAGAGGACTTTAATAGCC
TTTCAAATAGCTATAGAAATTCTTCTTTGATACTATATCAAAACTCCACAAGTGGTAGTT
TCTTAAGGATTAGTTATGATGTGGAACCTGCAACTCTATCAGTGAAGTTGGGTACTTTGT
TAAATTAAAACCCATTGGTCTGTCTTGACACTTTAAATGAATCTTTTATTCTTGCATGAT
TTTGTAACACCATGCCTAAGGCATTTGGAAAGAAATGGTTCACTGAGTTAAATTATTGGT
AGACTGTTAAATTCATGGTAGCAATACAAGTTTCCAAAATTCTAATTTTCGCTTCAAAGC
TTGAGTTTTATCATTGGCAGCAAATATCATTAGTTGTTGCTCTTGAAAGTGATAGGTTTA
CTGGGGACCTTTTCCAGAAAATGTCTTTCAGATACCCAAATCTTATGAACTATAGTTGTC
CATCAGTTATTTTTTGAATAAAAATGATGTCCATTTTAAAAGCAGCTAGTTCATAGTTTA
GCTTACAATTGAAACAAATGCACAAGTGCTTTTCTTTGAGATTGCCACTTCAGTATGCAG
CGAAGTACTTTATGCATACTTCCTGTTTCATCATTTCATCATACAGAATATTTAAAAATG
TGCTCTCAAGAATCAATATTTAATAAAACTAATCATTTTTACTGCTTTTTCATGGGCAGT
CTTAAATGATACTAACTTTCTTCCTCTGTGAGCGTGTGATAGTGAATACAATGACTACTA
GTACGCTTTGGTGCCACTGCCCTAATTTTTGCTAATGTACCAGTAGTTTTTTCCCACCAT
TGCTTTTGCACCATCAGTGCAAATATTAGTATGGTTGACAAATAACGAATTAGTATTGTG
AAAATAGTTTGGATCTCATGGACTCTCTGAAACAGTCTTGGGGACTTCTAGAGATCTGTT
AACCACACTTTGAGAACCGCTGCACTAAAGGATACTAAAATGCGTTTAAAGCTGGTAGAA
GTAGCGTAACTTATAATACTTCAGCTTCTGAGTGTAAAATTTGACTATAATATATGGATG
AGTTTACTGGTTCAAGCTTTTAACATTTCACCTTTTGCTGAAGGTGTACTTCCTGGCTGG
TTTGGAAATAATTTTGTACAATAATCAATGCCTGTTAGAAATAGGATTTTGTGTATCTGG
ATCACCAGATAGTGAGCCTCTCTGTAAATATCTAACTTAGTTGAAGGTATTTTAAATAGC
TAATTTTTTTAGTTAGTATTTTTTCCCTTCTTTTGAATAAGTAAAAGTGTAAAAATTAAC
GTAACATGAAGGTTAATACTGTGCCATAAGATCAAAGGTTTCAGAGTGTTTCTGTTGTGA
TGTTTAATTTGTCTTAAGTGCTCTAGCAGTAGAGATTGTGTTTTCTGATGTTTTTAAAAA
AAGATTTTGGTTAATGTATATCTTCCTCTTTTTTTGTAGTTAGTAGAGCATATTACAGAT
CTTTTAGGGGGCTGGCCCCGTGGCCAAGTGGTTAAGTTCGCATGCTCTGCTTTGGCGGCC
CAGGGTTTTGCTGGTTTGGATCCTGGGCATGGACGTGGCACCACTCATCAGGCCACGCTG
AGGCGGCCTCCCACATGCCACAACTAGAAGAACCCACAACTAAAATATACAGCTATGTAC
TGGGGGGATTTGGGGGGAAAAAGCAGGGGAAAAAAAAGATTGGCAACAGTTGTTAGCTCA
GGTGCCAATCTTAGAAAATAAAAATCTTTTAAAGATACAATTATGCTTCATATTGCTATC
ATTACTAGTTTTTAGTTTCAATGGTTTGTTGAGTTTTCTAAAGTGGGTTGTCTTTATTGT
CCAACAGATAACGTGTTGTCCAATTTCTGTTGCTTTGGTATCTGGAAACATTGGGTTGTA
AGCCTATTAGGAGGGACTGTCAGTTTACTGTATTGATAATATGTAATAAAGTTAGAATAA
ACTTTTTTTGCAACAAATAATCCTATTATTTTTCTTATTGGAGAAATCGTGAATCGTTCT
GAGCACCTCATTAGATTGTGAAGCTTCTTCATGGGGAGCACCAGGCAGAGCGTGTTCATT
TTCACCTTCTTTTCTTTTGCAGTGATCTTAACCACAGCACGCAGTATGTGCAGGGTCTAG
CACTTTGTACCCTCGGCTGCATGGGCTCCTCAGAGATGTGCAGAGATCTTGCAGGAGAGG
TAGAGAAACTCCTGAAAACCTCCAACTCTTACTTAAGAAAAAAGGTAACTTTTAATGAAA
CCAAATGTCTGTCTTTGGATTAGGGAGTATCATGCAGATGAGAAGGCAAATTATTCATTG
TTGAAAGCTCTGATGATAATATAACATATCTTTCTTTGTGCAGTAAATGTATTTTAAATG
ATTGTGTATGAGTCAAGTGTTTATAAATCAAAATCTATTTTTTGTACTAATTTTAGAGAG
CTGTTTTTGAATTAACTCTCCAATTGATAAGTCATTGTGAACACTTTAATTCTTCTCTTT
ATTCATCTTTTTTCAAGGCAATGATTTATAAACACATGTTACTCGATATCCTAGATGGCA
TACCTAATTACTTCCTAAATTACCTGATTCTAGACAGTATTAAGACAAAGTAATAATTAA
CAGATCTTTACAAATTTTACTTTTATCCTAATTATTAGTGCCCATGCCTTTGTATTAGGG
CCTTTGAATCTCTGGAAGTGCAGTTCCATTGGGACCTACATAATTATTAGAGAATGATCT
AGAACACACTTTCTAAAATTGGTGTGTCTAAATGGAATAGTAATGGAAGACAATGATCTT
ATTCTCTATCTGCTTTTATTTATTGCTATAAACATTTTATTTTATGTCCTTGAACCCTAA
AGCCTTCTTAAACAAAAGGTATAAAATTTAGAATTCCAAGAAGTGAGCACATGCTATCCT
CTGGTTAGCATTTATGGTGCCTCTATATTAATGGTCTCTGTCCCTCTGTGTTAATGGTGT
GAGACAGAGACATTGAAAGGGCCACGCTCTTTTCCAGGATCATATACTTTAATGATAGCT
GCAACCCAAAGCCAGTCCTTTCTCTTAAAGGATATGAAAGCTGCTCTTGTTCAGAAGGTA
TATTATTTAATTAAATAAAACATTCGTGCAGATTAAGAGAAAAGTCATTTTTTCTCCAAA
TAGAACATGGGAAGAATTAGCTGAAATCTTTTCTTATTAATGTATCTAAACTTTGATGGT
ATTCAACTCCAACAAATAGTAGTTATGCTTACTTTGCAGGGGAGTAACAAAAATCAATCT
TTGAATGTACCTTTCTTTCCAGTGAACAAGCTGAGACCATCTTTTCTTTAGTAGAGACTA
GCTACGTAGCTTACAAATGATTCTCTTGATGTCCTCAGAGAGTGAATTGAGGAAGGTATA
GGTATTATTAAAAGTAACAGCAGGTTTAAGCATCTGCAGTATACATCTTTGAATTGCATG
ATGTTTTTATAAAACTTTTTGATCATCTTAGAAGAATGATTATCACAGATGGAAGTCTTT
ATTTTTTACTTTGCCAAAACTCCACATGAGTTATATTTAATTTGTTTGATAAAGTCATGT
TAACCATGGTCTAGTCTAAAAAGTTTTTGTCCACATATTTAGCAATATGTGAACAAAGGG
ACAGGTGAGCTAGAGGTTCTCATTAATGCGATTAATAGTATAAATTGGAAAGCCCTAACC
AGTTAATAAATAATAAATCTGATATCTAACTTCATTCTTCCTTATTTTTCTAGTAGATCA
ACTGGTTGATAATGTTTTTTGTGTTTTTATAAGACTGTTTTATAAGCCTTGACTTAATTG
AAATAAATCTTTTGTCCTTTTTATTTTTTTTATAGGCAGCACTATGTGCTGTTCATGTCA
TCAGGAAGGTTCCTGAACTTATGGAGATGTTTTTACCAGCAACAAAAAATTTATTGAATG
AAAAGAACCATGGTAATGTGATTTGGATGCACTGATGAAGTACTGAGGGAGCAAGGGAAG
GAGACAGGCTTAGGCAGCGTTGGCCTCTGTCTCAGTGCAGTGGACTTGGCTTTCTGTGGT
ACTTAGATGCTTTTCCAGAAAAGGGCTCATCTGTCTTCTACTCTCATATCCTAGTTTTCT
GATTAGAGATTGATTCCTTAATAATGAACTTGTTTTTCATCTCTAGTCCTCTTTTACTGT
ATTAAAAGTACTCTATTAAGTTACAAAAATTCAGTGCAATGTACAAATGATCCTAGCCTT
GATTTTCATGTATAAAACCTTTTGATTTCTTGACTATTTTATAATAGAAGAAAAATTATT
TCTTTATTGCCTTCTGGTAAGAGTGTAAGATTTATGAACATTTTTTTAGGTTACTTGTAA
CAGGAATTTGTACTGGGAACTCAGGTATATTTATATAACACTTTGAGAGAAATTCAATGG
AATGTGGCTAGTCTTTCCCAAACATTTTATTCTTATTTTGAAGTCAGTGAAACAAGTTTT
GAGTAAAGAAAATTCATGTGTCCTAAATGCTAAGAGAAGAAAAAATGGTAAGATATATTT
AATTTGATTAATTCAGTCCTGTGTCTAGAAGGCTCAAAATATACTTGTTGAACAAATGAA
TGTTAGGGCACTTATTTATTATTTAGTGAAAACTATTGTGAGATTCTTTTTACTCTGGAA
CAAGCAAATTCACTTTGTCATCCACAGTTACCTTGGAGTTTTCATACATTTTATCTGGAA
ATTTAAAATCCTGTTAAGATTTTTGCTTCTCAAATTATCTATCAGAACGCAGCTAAGAGC
TTATTGATAAAGTGTGGAGCAGATGATACCTATCTTATACTGACTGTGAGCATGTTTTAA
TGGATCTTCTCAGATGGAGAGACATATGTATTGGTTGTAATTTTTTAGCAATTATTTTGG
TCACATAATTTAAAATCTTCTGATTTGACTGACTTGACCAGTTATTAAATCAGCAAGCAT
CTGTTAAATACCTTCTTTGTATTCACCTCAATGCTTAGATTCTTTGGGAGATTAAAAAGC
AAAAGTGGCAACTATCCTTTTGGAATTGACCTTCAGAACTCAAAGCCCTGTTCTATGAGG
TTGAATAATATAGCCTCAATTTTAGTTTTCATTTGCTCTTTTCTTTCAGGTGTCCTTCAC
ACGTCTGTAGTCCTCCTCACAGAAATGTGTGAGCGAAGCCCAGACATGCTTGCACATTTC
AGAAAGGTGCGTGCCATTCTGTATGCCTAAGCCTTTCTTGATTGAAAAATAATTTTCCTG
AAAAGTACATGTTTTTCTCACTTATGAATTTTCTTTTGAAAGGAAGCTATGGAGCTGAAT
AAAGGACTTAACCAGCCCTGCTGTGTAGTAGGGCTGGAAGCCAGATTCAGGCTTATAAGA
GCTGGCAATAGTACAGTGTTTTCCCTTTCATAATAGAAGTCTTCTCTCATTGTTGGCAGA
CAGTAATCTCTCATGTGATTTATCTACTGTTTTCACATTGAAGTCAGGAAATGTAACCTG
AGGTCAAATTACAAACAGGAATTGTGTTTGTGTATATGTTTTTTTTTTTAAGGCAGGTAA
TTTCTTTTAATTTCCATTTTTTTTAAGGTGAGAACTCCAAACTGAAGTTTGCCATTACTT
TTACGTAACACAGGGTCCCCCACTGTTCGTTTTAGGCTGTTGACTCCTGTGAAGGAAGTC
TCTAGCTATCTTAAGTCCCTCCCTCCCTCTCTTTCTTATAGCATTCTAAAGTGGAAATTT
TTGTTTTTTCCACTTACTTTTAGAAGGAAATAGTAAGGAGAACTCAGAGAAAGACTGTTC
TTTGGGTAGTTATGTACATTTAATTCCTTTTATAGAGGGCAGTTCACTCCATAAACGGGG
CTTACTTTGTACTTTAGATCTAATGAGGTTCTAATAGCAGTTCTTTTTGGGTTTTTTTTC
CCCCCTTAGATGTTCATGTCTTGATTAAATTATTGTAAAATAGTATGAGACCCGTATCTG
TCCCTAATGCTTGCTTTATATGTTTTGTTCCTGTTGTCTGTTTGGAATCCTGCTGTATGT
TAGAATGAAAAGGTAAGAATTAACCCTCTTTTAGATGGTGCATGCTGATGTTAGGTCCTT
AGTAGCTTTTGTGTATCCATCCACAAATGTGGCTTTTAAAAATATACTAATGCTGAAGCT
GTGCTTAATACTGTTATTTGTTCTAGCACTTTTGGCTAACTCCCTAGTCCAGTTTTTGTC
TTGTCTCTTAAACTCCTTACTCCAGAGTCAGCCTTGGATTTCAGTTGCAGCCTTTCCTGA
ATTGTAAGCCTCCTTCTCTGCCTTTCCTTTATCTTCCTTCACTTGAGAAACTTTGAGCAG
TTTCCCAGTGGCTTTGGTGATAGCAATTCCAGGTCACTTTGGAGCCTTGACACAAAACAC
TGCTTCTTTTTGAAGTAGATGTTTTAAAGTCATATGTGAGTAACCTCATACTTTAAAAAG
CTCCATGTGTTCTTCTGAGCTTTCAGTTCAGACTAGAGCTTTTATTTCCCTCTTATCTGC
GCTTAATCTTACCAGAAGTTTTAGAATATTAAAAGGATTTTGAGGTAGAGTGGGTGGGCA
TCAACTGATTTTCATGGCTGCACCCTTTCCGTTTGTCATCTTATTTTGTTTGTCTTGTCA
TCAGTTTTAGTAATTTGCATTTTTGTCTGAAAAATAAAACTGGGTTCCAAGAATTTCTAT
GCTGAACACTTAGACGTTTGTGCTTTTCGTCCCAGGGTGATCTTATGTGATGTGCTGGTC
TTTTGGCGGTGAATAAAACAGTTTCTAAATTTAGTAGCCCAAGGAAAAAGGACTTCTCCA
AGAAATAAACTAGATTAAAAAAATCATTAGGCATATATATAGTACAAAAAAGTAGGCCAT
TGGGAGGTTTGCAAGGTGAGCCGCTTTTTGTGCAGAGCTTGGTAACTAGATGATCCTGGT
TTTATTATATTTTAAAGAACTTTGTAAAATTATATTATTCATACCTCTAATATAAATCGA
CCCACAGCTGACAGGTTTAATGAGGATTCTGTTTAGAATTTACATGTCTCTATGGCTTAG
ATTTGTTTTAATCTTGAATTGTTCAGATTAGATTTTTGTTTATGTAACTTATGAATCACT
TAATTCTGAAGTGTTATGGCCAAACTTATTTAAATTCACAAAGACTATGTTCTCGTGTAT
TTAGAAGTGCCCTTAGTGTTGTGAATGTCTTGAGTACATACCTTGGGCATAGCTTGGCTT
TTATTTCAATCTCAACCTCCTTTTAGAGTTGGGGAATAGGGAGATGACAGTGTCTGAATA
CAATGAGAAAAAAATGATTGAGTTGTAGCAAAATTGGGGCCGTTCTGATTACTTCCAAAA
GAGGTGTGATTCAGTTCACTTTGGACACTTCTTAATTTTATGTGTTTAGAGTTGTTTATA
TAACTACGTTGAGTTTTTAGTTGGAGACTGGAAAATTTCCTATTATGGCAAACATTTTGG
AGTAGGGTTTTAATATTAAGTGACTGATCAACGAAATGAAATGAATGATAATATTTAAAG
CATCTTTAAGTTCAGCTTGGCAGTAAAATTGCCTCTACTATGTGTTGTGACACTAATGGA
CAAAGTAGGGGAAAGATAAGAAGGGAATTCTGACCATAAGGAATATACAGTTTCATAAGT
AAGATAAGACAAGAAAACATGCAACAAATCAGTTTGTATAATGTAGTGCCAAAATTAAAT
TTTACCGAAAATTGTGTCATGAGTTAAGAAAAAGGAAAGGAAATTATTCATGGCCTTGGT
ATCTTCTTAAGGTGAAAGATAATAATTTTTCTTGTCTTTTCCACTTGGTCAATGTTAGAG
GCTTTTGCATTCCCTGTTCTTTGTTGGAAAAGGACATAACTAGCCCTATCTTAAGAAATT
TTTTTCTCTGAGATAGTATGTTTTAAAACCAAAATTTTAATAAGATCCACCAGTATTTTT
GATATGATAATGTTTTACATCCAAATGTTTGAATGGATAAAAACTGAACATGTTTGTGCC
ACCTAGGCCTGTCAAGTTGTGTAAAAGTACATATGCAGTATGTCCCATAGGCAGAATCTG
TTTTATTTGGTTCCCATAGGCTTTCTGACCTACTGTTATTTGTTATATCTTTGCATATAT
AACTCTGGAGTAAAAAAGTATAATTTGTTTTTAATTCAGATATAATACATATTCCTTCTT
GAGTTTTTGGCCTAAACACTTGTAAGTTATATTTATCTAACATCAACAGTATGTTGTATC
AATAGAATTTACTTGGACTCAGACCCTTGCACTCTTTTTCTAAGCCAATTACCTGCCTAT
TTATGAGAAATTCTTTGATGTTCACTGTTTTTTTGACGCATCTGTCTTCCCTGCAGCTTG
TGCCCCAATTAGTTCGTATTCTAAAGAACCTCATCATGTCCGGATATTCACCAGAACATG
ATGTTTCTGGTATCAGTGACCCCTTTTTGCAGGTGAGGTTGAAAGAAAGTTTCAAATAAA
TGATATATGAATTTAATACCTTTGAAATAGATCATTTCTTTCTTGTTAAGTTGGTGTCTG
ATAGAAATTTGGTAGTTAATTGATTAAACTAATTACATGAATGAATAGTAATACAATTCT
GTATTTTATTAGATTAATAGAGTAAAATTAGTCGTAATAGTCAAAATTATGTACTACATA
GAGACTTATCAATATAATATATCTCCACAGCTGGCAGTATCCTTTAGCTATGGAGTGGCA
AAGTATGGGTTGTCTAATAACTTCATTAACATGTAGAAACATATATAACTTCTCTAAAGA
TAATGTTTAAAATTCTTCTGTTTGAATTTTGACCATTTCTAGTGGCATCTAAGACTTCGT
TTAAGTTATTTGAATTTCATACCAAGCAAAGTTCCTTTGTGCCAGATTTAATTTGTTGAC
ATTTCTCATATTTTGCACATTAGGTACGAATTTTGCGGTTATTAAGAATTTTAGGACGAA
ATGATGATGACTCAAGTGAAGCTATGAATGATATATTAGCACAGGTGAGTAGACCAGACT
TGCATTATTTTGAATATTCATTGTGGTTTAGCAGGCGGTAGAATGACTGTGATTATATGG
AGCAATTTTCATTTGTATTTCCTCATTGGTGGCTATAATCAGTCACAAAACATCTCTTGT
TACCTCTGGATACTGTTTGGAAGCATTATTTTATCGCTTATGTACTGCCCTCTGTGTCTT
TTCAGGTTGCCACTAATACAGAGACTAGTAAAAATGTAGGAAATGCTATTCTTTATGAAA
CGGTTTTGACTATCATGGATATTAAGTCAGAGAGTGGACTGCGAGTAAGTCTTTTTAAAT
TTTCTCCCTAAACTTTTCATTTAGAATAATTGGCTTGGACTTTAGTACTTTGGAAGTGAA
TTCCATTTGGAGATTAACTTTCAGAAAGAATGATGCAGAATGTATAATGCTGTATTTTTG
GTATCTGAAGTATCACTCCCTCCCATACAAGGCTTACTATTGATTATAATAAAATTTGGA
AGATCTTAGGTATAGTTGGATATATAGACATTGTTGAGTGAAGGAATCATTTCAGAATAA
GCTTTCACTAGAGCCACAATTTGAGTTGTACTCATTGCTTCAAACAAGACATCATGTTTG
ACTTCATTTATTCTTCTTAAATATTTGTTTTTATTTAATAAATAAACATATAAAATAAAA
AACTCCGACAATACAAAAGGTACATAGGGAAGAAAATGTCTGCCTGTAGCTTTCATGTGT
AGACTGTCAATTCTTCCTTAGTGGGAAATACTGTTATCATTTTCTAATGTATTTTTTCAG
AGATGTTTTATCTATATTTAAATGTCTGTACATGTCTATTTCTTGTCCAATTTTAAAAAC
TTTTTATTTGAAATAGTTTTAGATGTATAGAGAGGTTGTAAAAATAGTTGAGTTGCCATA
TACTCTTCACTCAGATTCCCCTAATGTAAACATCTTATATAAGTATAGTGTAATTATCAA
AACTAAGAAATTAATATTGGTACCATACCATTAACTAAATTATAGACTTTATTCAGATTT
CATCCATTTTTCTATTAGTCTCCTTTTTCTGTTTCAGGAGCCAATCCTTGATCTCACATT
GCATTTAATTGTCATGTCTCCTTAGTCTCCTCCAGTCTGTGACACTTTATCCACCTTTCC
TTGCCTTTCATGACTTTGACACTTTTGAAGAGTACTGATCAGTTACTTTATAGAATGTTC
CTCAATTTGGCTCTGTCTGGTATTTTCTTGTGATTAGATTGAAGTTATGTTTTTTTTGGT
GAGACTACCACAGAAGTGATGTACCCTTCTCAGTATCATATCAGGAGGTACATACTGTCT
GTCTCACTGATGGTGAGATTAACCTTGGTCATTTGATTAAGGTGGTGTCTGCTGTGTCTT
TCTACTCTAAAGTTATTTTTCCCTATGTAATTAAAAATATTTTGGGGGAGACGCTTTGAG
ACGATGCAAATATCCTGTTTTCCTCAGACTTTTTGCCCACTGATTTTAGTATGTATCAAA
GGATCTTGTCTACAACAGTTACTAGGGTGGTGTTCTAATGATACTTTGCTATTTTCTTCA
TTTTTTTCTTATTAAATAATTGGAATTCTTCCATAGGGAAGAATTCTCCTTCATGAATTT
ATTCTTTTAATCATTTATTAACATAAGAATTGCCAGCCCATAGTCTTGTAAGAAACAAAT
TTACTAACTACAGTACAGTATTTGTGTATAGTTCTTTTTGTCTTTAACACTACAATATCC
AAATAACAACCAAAGTAACTTAGGTTAGTTCTTTTCCTCTCCTCATCTTTCAAACAAAGT
GGTAACATAGCATATATATTGTCCTGCACTTTACTTTTTTCGCCTAACATTATCTTGGAG
CTAGGCCATATTCACATGTAGAGACCATTGTCATTTTATTTTTATTTATTTTTGGTGAGG
GTTGTTGGCCCTGAGCTAACACCTGTTACCAGTCTTCCTCTTTTGTTGCTTAAGGAAGTG
TGGCCCTGAGCTAACATCTGTGCCCATCTTCCTCTATTTTTTGTATGTGGGTTGCTACCA
CGGCATGGCTTGATGAGTGGTGTAGGTCCATGCCCAGCATCTGAACCTGAGAACCTAGGC
TGCCGAAACAGAGTGCACCAAATTTGACTACTGCGCCACCAGGCTGGCCCTGACCATTCT
CATTTTTTTAAAAAAAAATTCTCATAGAACATACATAACATAAAATTTACCATTTTAAAC
ATTTTTAAGTCTGTAGTAGCTCACTGGCATTAAGTACATTCATGTTGTTGTGCTACCAAC
ACCATCATTTATCTTCAGAACTTTTTTGTCTTTCCAAACTGAAACTCTGCCCATTAAACA
ATAACTCCCCATTATCCCCTACCCCCAACCCCTGGCAACCACCCTTCTACTTTCTGTCTC
TATGCATTTGACTACGCTAGGTACCTCATATAAGTGGAAGCATACGGTATTCGTATGATA
TTTCTCCTTTTGTGTCCAGCTTATTTGATTTAGCATAATGTCTTCTATTCATCCATGTTG
TAACATAAGTCAGAATTCACTCTTTTTAATGGCTGTATAATATTCCGTTGTATGGGTGTG
CCATAGTATATTTAGCAAATTTGCCATTAATAGAGACTTAGGATGTCTCCTATCATTTGT
GATTACAGATAGTGCTGCAGTAGATTTTTGTGTATATGTACAAGTATGTTTGTCAGATAA
ATTCCTCGAAGTGGAATCGTTGAAGGAGAAGATATATTTTCATTTTGAATATTTATAGTT
ATTGTCAGATTTCCCTCCAAAGAGGCTGTACCAATATTATTCTTTCACTAACAATATAAA
AACTTTAAAATATAATCTTCCAGCAATTACTTTTGAAATAGGATATGATTTTTTACTCCT
TTAAATCGTTTGTACCCATCAGAGGCCAGGAAGTGATCCTTAAACAATATAAATATTTAA
TTTTCCTAGATTTTTAACCTATGCTGTTTTTCTTTAGGTCCTAGCCATAAATATCCTGGG
TCGTTTCTTATTGAACAATGACAAGAATATTAGGTAAGTCAACTGAAAAATGTCTTGCAT
TTTGGTATTACAAATTCAGTGTTTTCAAGAGTGGCTTTGCTCAAGATCACATGTGTATTA
AGTGATGTATCTAGAAGTTCAACTCAGGATTTCTGTTTTTAGTCTGGTCTTAAAACTACT
GTTTGTTAACAATTTGAGGATTTACTTCATGGCTTAATTTTTACTCCTATTTATTACTAT
AAATCAGGAGTCAGCAAACTTTTTCTGTAAAGGACTAGATGGTCAGTACTTTAGGCTCTG
TTGGTCTTAAGGTCCCTGTGGCAACTACTCAACTTTTCCTCTTGGCATGAAGGAAGCCAT
AGACTATGTATATAAGGAATGTGGCTGTGTTCTTATAAAAATTGATTTATAAAACTAGAT
AGCAGAGAGCTGGACTTTTGCAGGTAGACTATAGTTTACTGCCCCCTGCTCTAAATTAAG
AAGAAAAATACAGCGTCAGGTTGCAAATCTTGGAATGTGTTTGTGAATTCCAGTTAGTTT
TTTAAAGTAGATGAATTTATCACTATTATCTTTTATTTTGTTACTTTCTCTTATGTAGTA
TATCCTGCTTCCCTTTTTTTCTCTTTCAATCAGGAGAAAATTTTCTTTCTTATCATGTCA
AGCATGAAAAAAATGTGGAAATAATCATTGTGGTACCCTGAATTGTCTTCTCCTTCCAAA
AGAATTTTTAAATAATTGGATCTTAAACTCAAATTTTTGTAGGGGCAGTTTTGGTACCAG
TATCAAATAAAAGAGAAAATATAAATAATAAAATTGAAATTATTCCCTCTTGCATTTGAA
GCTAAGGCCTGAAAAGGCACACTATATCCTTATTTTGTTGTACTATTTGGAAGAGTTTGA
AAGAATTGAGTCAATCGACTTTAGAAATTTAAATGGACTTTAACCATGAACGCAAATCTA
AATACAGGGCTTCTCCTGGTTGCCACTATAGATTATAGTGTCTTTTATTCCTTTAAAATG
TTGCCATTATACTTAGTCTTTTCTTTTAAATGTTTAAAAACGTATGCTTTCCCTTAGTCA
TTAGACTTTTTTTGGTCATTGTTTAGGCAAAGAGCTATCCTGAATTTTACATTTTAATTC
TGTTCTTCTGCAACTTTGTTTCATCCAGATACGTAGCTCTGACATCTTTGTTGAAGACTG
TGCAGACAGATCATAATGCCGTGCAGAGGCACAGAAGCACTATTGTGGACTGTCTAAAAG
ATTTGGATGTCTCAATAAAACGGTAACAGATTGTTGATAGTTCTCTGCCCCTGCCATCTG
ATAACTTCGTAATAGTTTTCAAAGTGAGGATGTTGACATTTATGTTTTTAAACATCATTT
TCATGGGTGAACTCTCTGCTGAGTAAATTCTTTTTTTAGAAAGGATTGGCAGAGCAAAGT
TTTGGTCAACTAAGGAGGCCAATAAAGAATACTTCAGCGCACACTGAAGTTATCCTTGGT
TCTTTGACAAATAAAACAGATGTAGATAAGCTGGGCAAAAGTTTATTTAACAAAAGTACT
GTGCTTTGTGTGTTGGAGGATGAAAATATGGAGTGATCCATCGGCTAAGTGTTTTATCAC
GATGCTGAAACTCAAACTGCTGACAGCACACGTTTTCTCACAGTACTTATGCCCCAAGCT
ACTAGAGGCAACCATGTTTCTTAGAACAGTGCATCTAGGAATGACTTTTAGGCAGCAGAT
AGCACTTGCAAAAGGCATAATTTTTTTCCTTGATGAAGTAACTCTTCTGGTTCTCCTCTG
AAAAGAACTGTAGGTGTTTGTGAAACCTAGCTATAGCTGGCCTTAATGAACTTTTGGCTG
TATGTTCAAATCCAGCACAAATTAGATTTGAAGTGATCTCTGAAACCATTCATTTAATAA
ACATCTGTTGATATTGAGTTCCTTTTATTTGTAGAGAACAGGTGCTAAGTACTTGGACAA
TCTAAAGATAAGACCTAGACTCAGTAACAATAACTTCTACATAGTGCTTTGCAAAAGGTT
TATGAGCACCCTTTCGGCTGGTTCTCAGAACAAGCCAGTTAGAGAGACTAGGCAATCACT
TCTATCTTCAGCTAACAGATTACTTAAAATGGAGTCCCAAAGGAATCAAATGACTTACTC
TAAACCTTACCCCTTGTACAGGGGCAGACCTAGAAATGGAAATCAGGCGTTATGGCTCCT
ATTGTGTTGTTTCTCTGTAGCTTGTTGCTCGATTTTGCATTTCAAAATAGAACCTGTGTC
TCTTTGACAGGCTGTATAGCAGTAATAGCTCAGACTCTGGAGCCAGACTGACTCATTTCA
CATCCTGGCTCTGCCCTTAATACACTTGGTCTGGTTATTTAACCTTTTAGTTCCTCAGTT
GTCCCATATGTAAAATGCAGATACGAGAGCACCCATTTCATAGGGCTATGCAGGATTAAC
TGCATATTAAGTAATAATTAAGTAAAGTACTTAAGTAGTGCGTAAGAATTAGCTCCTGTT
GTGTTTCCATAAGGATTGAATTTTTGTTGCTTGTAAATTAGCTAAGATGAAAGTATTTTC
TACTTATTAAATTGGTATTTGTGAAAGTCAGTTTATATGCCATGTTTGAAATTATGGACC
AAATATAAAAAGATGCATATAGCAACCTTATAACTTTTGTGTGTTAAACATTGCCATTTT
TGCGTTGGTTGCCAAATTTGATTGGCAGTTAGAGAAACTTTTATTTGCTCTCATAGCATA
TGTCCTTTTTCCTTTTCATAGCCCTCATTCTCTCTTTGAGTTTTTCCCCCCAGCTTTATT
GAGATATAATTGACGTATAACATTGTGTATGTTTAAGGTGTACAGTGTGTTGCTTTAATA
CAGTTGTATATTGCAAAATGATTATCATCATCCATTAGTTAACACCTGCATTGATCACAT
AATTACCATTTCTTTTTTGTAGTGAGAGCATTTAAGATCTACTCTCTTAGCAACTTTCAA
ATTTATAATATAGTATTATTAACTTTAATCACTGTTCTATACATTAGATCCCCAGAAATT
ATTCATCTTCTAGCTGGAAGTTTGTACACTCTGACCCACATCTCCCCTTCTCCCCGGCCC
CCAGACCCTGTAACCACCATTCCAGTTTCTGTTTCTATGTGTTAGCTTTTTTAACTTCCA
TATATGAGTGATATGATACAGTATTTGTCTTTCTCTGTTTGACTTATTTCACTTAGCATA
GTGCCCTCACAGTTTGTTTTTATTCTAATTTTCCAAATAGCTTTTGATGTAAACTATGAT
ACATCATCTTTGGATGAAAGTGGCTGTAATAAAAGTGACTTTATCACATTTTTAAGGAAT
AATGGAGAGAGAGATCATTGAGTAATAATTTTGTTTCCTCTCTTTGTGACCCTTTTTAGG
TGTTCTAAATTTCAGTTTTGTAGAATAGACTATTGAACCCTAACTACCTTTCTGGTCATT
AGTAGTGTATCTCTTAGGAATATTTGAAGAAAAATGTTGAATGAAGATTCAAAATATTAA
ACCTAACTTTGATAACTTTGGTTGTGTCACCTGTGAAGATTGGGATCATAAGATTGTGTG
AAGACATTAACACATCTGCCAGTGCTTGGTGTTCAGAGAGAACACACCTAGGTCTTTGTT
TCATTCCTACTGTAAATGTCATAACTGTTTTTTGTTTTGTTTTGTTTTCCCTCTGCAAGG
CGTGCAATGGAATTGAGTTTTGCCCTGGTAAATGGGAATAATATCCGAGGCATGATGAAG
GAATTACTTTATTTTCTGGATTCATGTGAACCAGAATTTAAAGCAGACTGTGCATCTGGA
ATCTTTCTTGCTGCAGAAAAGTAAGATTTAATATTTACCTTTACTGGTAAAAGATTCTTG
AAATTTTTAAAAACATCTTTAAAATATGGGGAAAATGTTATAAACATGTTTAAAACATGT
AACATTTATTTCATACTCCCAATTAGAAATTAGCTTTGAGAAGGCTACTATAGCTAACAT
TTAAATATGCTAAGACCAAAAAAAAAAATCCTACTTTTATAAAGTCTCCTCCTATGTCTG
TTCTTTAACCTCTTATCTATGATGCCTTTTTTTATGAAGAGAATCGAAAATTTACAGCAT
CTGAGTTGTGGTTCTGTGTAAAACTTTAGGAAGAAGTACCTCAAGATTTTGGTGGTATGG
TTATGTCTCCACTTTCCACTGTGAATTTAAGGGAATGAGTTCCTTGTCCTGTTGTTGCCT
GTGTCCAGGAAGAGTCCTTTTCTTCGAAGTTTCTTCTTTATCCTCTCTGGCCCTGACTTT
ATGATTTATTTTTTGAGAAACTGGAGACAGAGTACCATTTCTCAGTTTGGCAGCTCCTAT
TGCATTATTATGTGAAACATCTGAGTTTGACAATATGCCATTTCATCACCCTTTTAAATG
GGGATTGCTGCTAGATTTGAAGGTGAAATGTCTCCAAATATAATCATTTAACCAATGAAC
CTAAAAAAGACTGTAGGCAGGATTTTTGAAAGTCACTGAGCACAGTATAGTTTACAGATT
CCAGTTTTTTCACCTGGTGCCATTATTTTCTCAGGTATGCACCTTCCAAACGGTGGCATA
TAGACACAATTATGCGTGTTCTGACTACGGTAAGTAGCTCTTTTTAGTCAATATACACTA
AGGCTGGATGTGCTGATTAAGGCAGACAGAGCCCTTGTTCTCATGAAGCTTATGTTCTAG
TGGGGAAGAAAGGAAATTCATGGGGAAATATGTACTGTACTGTCAGGCAAGGCGAAATGC
TATGAGAAACTCTAAAGCGGCATGAGGGACTATAATGATGCCAGAAGAGGATGGGATATG
GGGCAATGGGCCAAGTATTTTAGGTAGAGTAGTTGGAGCAGGTCACTCAGGAGGTAAAAT
TTGAGTAGAGAACTTAGTGAAATGAGGAGCCATGAAAAGATTTGGGGGAAGGGTATACTA
ATCTGAGGGATCAGCAGGTGTTGCAAAGACCTTAGGTAGCAACAAGCTTGGTCTGCTTGG
AGAGCAACAGGAAGGCAAGCAAAGCCAGTAGAGTGAGAGACAGAGAACAGTAGGATTGAT
GCAGGGGCTAGATTATATAGGGCCTCACAGGAGTTTGGATTTTATTTTGAATATGATAGG
AAGCCATTGGAAGGTTTTGAATGACTGGATTTAAAATTACAGTTTTATAAGATGTTCTTT
CTTTGGTAGTCTTCCAGAATTTTGGAGCTTGTCTGTTTATCATTCAATTAATAGGGACTA
GAGATTTAAGAGTAAAAATGAAGGTATAGTGGCATATAAAGAAAATGTAACTATATATGT
CTAATTATGTTACCAGAAGTACATACCATAAAGAAAAACATTCAGAAATTTGACCACAAT
AAAATTTAAAACTTACATAGCAAAAGGAAAAAAATCTACAAAGTTAAAAGGCAAACGACA
AGTAGGGGAAAAACATTGTAACATATGACAGCATTTTAATATTTTTAATCTATAAATAAT
TTACAGTTAATAGGAAAAATCAAGCACTCTAATGGAAAAATTAGCATTCGAGCAGTCAGT
TCACAAAAGAAGAAAGAAATGACTGGTTAACATTGATAAAATACCCTCACTAATAAAGAA
ATATTAAATAAAATAAAAGGGGTATAATTTTTCACATTACTTTCTGGTCTAATTCCTAGT
ATTAGTTAGAAAATAGATAGGTAGTCCTCTTCACTTTATGTGGGTATAAATAGTGCCATC
TTTCCAGAGCACAGTTTAGTAGCATGTAGCAAATATCTTAGTTTATGTTTTTTAATTCAT
TAATTCAAGTTTGGGACTTTATCTTGGAAGAATAAAAGGACAAATGTACAAAATGTGTAT
ACAAAAATGTTCATCCCAGTCTCGTTTATAATAGAGGAAAACTGGAAACAACTAGAAGTC
TCCAAATGGGCATTGGTTAAGTAAATATGAAACATCTGTAGGAAGGAATGATACCATTAA
AATTGTGATATATATGTGGCTGTAGAATTCTTTCTGTGATGTATTAGTTTTGTAGTTTAC
CTACAATGAATTAATTTTGTGAAAGTTAAAAGTTAAATGTTCTTAACAATGGAGAAATTA
TATTCTAACAAAAGATGTGAATCAAGACACACTTCTTAAGTTTTTGTTAATCTCAAAAGA
GAAAAATTAGCACTCCTCAAGAAAAATGTTTATCAAAATTCAAAACCATTTTTTTTAATG
CTCCTGCTTTTCATCCTTCCAGTTGACTTATATTCTCTTATGAACATATGATTTTTCTTC
TTTAGCCTGTTGATATGCTGGATTACATTAATTGATTTTTGATTGTTGAACCAGCCTTCC
ATACCTGGAATAAATCCCACATGGTTGTGGTATAGAGTTCTTTTTATACATTGTTGTATT
TGATTTGCTAGTATTTTTAAAGGATTTTTGTGTCTATATTCATGAGAGATATTGGTCTAT
AGTTTTCTCTTCCTGATGTTTTGATCCGTGTGTTATTTAGTATTGTGTTCTTTAATCTCT
AATTATTTTGAGATTTGTCGGCTATGTTTGTGTTACTGATTTCTGGTTTAATTCCATATG
ATTTCTATTCTAAAATTTAAGGTATTTATGGCCCAGAATGTGGTCTGTCTTGGTGAATGT
TCCATGTGAGCTTGAGAGGAATGTGCATTTTGCTGTTGTTGGTTGAAGTAGTCTGTAAAT
ATCAATTAGATTGTGTTGTTGCTTTCTCTTAGTGAAAACACTCTGCTTTTTCCCATTATT
GAAGAGTGTAAATATCTATGTCACATCACAAATTACCTGCTTTTTAGCTTCTCTCCTTTC
CTTTTCCACCATTTTCCCAAACTTCTCCCTCTGTCTTTATGTTTTTTAACAGAAGTAGGT
ATCCCAATCACCTGGGAATTTTTCTTTTTCTTTTTTTCTTTTTCCTTTCCAAAGTGCACA
TGGTTAGGCCTGCTTTCAGTCTTGTAAATCAGATCTGTTCTTCTGTCCAGTAATGGGATA
TTTACCAGGGTGGGTTGATATTAGGCATAGGTTCCACTGTTTGTATATCCTGTGCAGCCT
GGTTGTCATAATGCTCTGACAAGGCCACATCTAGTTTCCTCATAGGTTAAATAGCTTTAC
TTTGTTCCATGGTTGCAAATGGTATCTCAGATTTCACTAGTCAAGAAGACATTGAAGAGA
CCAGGTTAAAAAGAAAGTGTGGATAATTAAATAACAAAATATTTCCCATTTCCAGGACTA
ATGGTTGGTCCTGTAATATTTGTAAACTCTAGTCTTTAAAGGGCAGTGTGATGTTTTAAA
TAAACTCAAGTTTTCAAAAAGCTGCTATTTAATTCTTACCTTTTTTAAGATGTCCTTTTG
AACTGCTTGTGTACACTCCCCTCACCATCCCCCAAAGTAACATGATTACTATTGCTAGCC
CATATGAATTTGACATTGCTGTTGGAGAGTTGTGGGAAGGGAGAGTTTGTTGTAATTAAA
TTTCCAGTGAATGTACATCTTAAATTTTTGAAATCTTAGGCCTTATCTGTTTTGAGTAGA
AAAAGTCTTTCTTGAAATTTTAAACCTTTATATTTTACTTTTATTTTGGATAAAGAGAAT
ATTTTATTTTTTTAATAAAATTAAAAAACTTAGAATTTTCCTTTAAATAAGTAAGACTTT
GAAGTTGAGCTGCTTATGAACCTGAGAATTGGAATCAACTTTATCTTTGGGGGTGTTTTG
TAGTATAGTGATGCATCACTTAACAATGGGGATATGTTCTGAGAACAGTGTCGTTAGGCT
ATTTTGTTGTTATGTGAACATCATAGAGTGTACTTACACAAACCTAGATGGTGTAGCCAT
ACCTAGGCTATCTGACCAATCCCGTGGGACCATTATTGTAAATGCAGTCTGTCATTGACT
GAAATGTCGTTATGGGATGTGTGACTGTAGTCCCCTTTTAACAACAACAATAGTAGTTAA
CATTTGTTATCATTACTCTGTGTTTCTGGGGGTAACTGTCTGCATTTCCTTTTAGGCAGG
AAGCTATGTTCGTGATGATGCAGTCCCCAACTTGATCCAGTTAATAACCAATAGTGTGGA
GATGCATGCCTATACTGTCCAGCGCTTGTACAAAGCAATTCTTGGTGATTATTCTCAAGT
AAGTATTTCATTTGTCTTTTTTTCTACTTTAGAGGGGAAATTATACTTTATTATCCTGGT
ATGTCCTTATTACTAACACTGTAGATGTGCCTCAGTTTTGACGTTTATCATTAGATGACC
TATGATTTGCGTTAATCCTTGCAAAGATTGAAGTCCTTGACAAACGGTGACTTTCTTTTG
ACAGCAACCTTTGGTACAAGTAGCTGCATGGTGTATAGGTGAATATGGAGATCTTCTAGT
ATCTGGCCAATGTGAAGAGGAAGAGCCTATTCAGGTACCCCTTGTCACTCTTGGCTAAGG
ACAGGAAAAAATCATGTTTTTGGTTATAAGAGGGTAGTGTTTAATGAAAAGTTAAGGTTG
ATTCCTTCAAAACCTTTTAAAGAAGTATTGAGAAATCTGCCAGTTTTTGAGGTAGAACCT
TAGGATCCACTCCCCACCCCATCAGACTGAATTATATTGTTTCTCTTATCACTGGCTGAT
TTAAACAGGAAGAATGGAGACATGTATCCCTGATTCCATTTGCTCATTAAAGGACTGGCT
TTAGGAGAAATTGTGGCAACAGTGTTTGAACTCTATGTGTCTTTTTCTTTCTTCCTTACT
TCTGCCTCCTGAAGCGATAATATGCCTCTCAGCCCCCAAGGGGTGTTTTTTACTCTTTTT
TACCTACCCTCTTACCTGCTTCTGGTTGGTGGAGCAGCTTGGACAGTTACCCTGGCAAAA
CACAGATTGTGTTAAAAGCTTTAGTAGAGTTGGTAGATTTTCTTTCTGGTGGCATCCTGT
GACTTGATATCAGATTTATATATTTATTGTTACAATACATTCCATATTGTCTTTGTTTTC
CTCCCCAGGTAACAGAAGATGAAGTGTTGGATATTTTAGAAAGTGTCCTAATCTCTAATA
TGTCCACCTCTGTGACACGAGGTTATGCCCTCACTGCCATTATGAAGCTTTCTACTCGAT
TCACCTGTACTGTAAAGTGAGTATGGAGAAGAAGTAGGGTGAACAGGTTATTTTGTAATT
TTAAAAAACTTTTTATTATGGAAAATTTCAAAGACGAAAGTAGAGAGAACAGTAAAATGA
ATTGCGTATACCTGTTATTCCACAATGGCAATTATTAATTCATGGTTAATTCTTATTTCA
TCTATACTTTGCTCCCTTTCATCTCCCAGCCCACCATTGATTATTTTGAAAAAATATGTT
TTGAAAATCAGATTTCGAATGCCTTTTTTGTTCTTTTTTTAATATCACTAATAAACAGTT
AAATTTTATTTACTTATGATTATTTTTTAATTAAATTTATTTTTTTATTGCAGTAACATT
GTTCATAACATTATATAAAATTCAGGTGTACATTGTAATGTATTTTGAGTTCTGTTTAGA
TTACATCATGTTCACCACCCACACTAATTATAGTCCATCATCACACACGTGTACGTAATC
ACCCCCTTTCGTCCTCCTCCCGCCCCCGCACCCCCCCCCCACCACAATAAAGAAATATTC
TGAAATTTTTATTTACAAAACGATTTTAGGAGATGTGATCCCTACGGGAAAATCAAAGAC
TATCCAAGATATATATGTTAGATATGGGGCCCTGAATTCCCCCAAACTTTTAGATTTTTT
TTTCCTGTAAAGATATAAAAGGATGGATATGGGGAAACAACAGAAACTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTTCTGTTT
TGTCATCTTTTATTCTGCCTAGCCTCTAAAGAAATAAGTTAACTGTGTTCTTTCATTCCC
CTTCTCCCATTTCTTTTGGTAAGGAAAGTTTGCTTCATTTTCCATTTTATTTGGTTAAAA
AGTGGGAGTTGAATTTTTTCAAGGGAATCTCATTCAAGTATCATTACTATTAACATTTTG
TTGCATGTCATCCTTTTTTCCCCCTTCTTCTGTTATGCAGTATCCTCTTGATTGGAGACC
GTTAATATGTGCTGATTTACCTTTCTTTCATTCCAATTTCTCTACCACTGAGAAATCCCA
ATCTCTTAGGGTTTAGATGGACAGTTTGTCCATTCAGAGTTTCTTGCCCGCCCTTAATCC
AGCCAAGAATTTAGGTCATGTATTCTTGTAATCCACCTTCTATTTTAGTGTGTCTGTTGG
GGGATGGGGAGGGGAGATAGCTCTCCATGTTTGGCTCCAATATAGTTGCAGTGATTATTT
TGGGTAGGGAATCTAGGTTAACTGCCTAGAATTTAACCACTTCAGATTCTTCTAGGTCTG
CCCTGCTTGAGAGAATGCCTGTCATGGAAAAAGTGACCACGAATGGCCCTACTGAGATTG
TGCAGACAAATGGGGAGACAGAACCAGCTCCACTAGAGACCAAACCACCACCCTCTGGGC
CACAGCCCACAAGCCAGGTAGCTTTTTACTTGCTTATCTGGGGTCCTGATGATCCTACAG
TTCCTTATAAGCTATCTCTTAGCTGATTCCCTTCAGTGTTCCTGGATTGATTGATGGTTC
TCTTCCTTATTTATAAGTGTTGAAAGAACATTCCATTAGATGTAGATTAGACCAATGACT
AATCAACTGAAATATTAATTTTTTTGTTTAGGCCAATGATTTATTGGATTTGTTGGGAGG
AAATGATATAACACCTGTTATTCCAACTGCACCTACAAGCAAACCAGCTTCTGCTGGTGG
AGAACTTCTTGATTTGCTGGGGGACATCAACCTTACAGGTGAGGCCAGACTGGAGTTATT
TAATGCTTGGATAGGGATAAAGGCCTTGGGGAAAAACTACACTGAACATAGACACATGAT
TCAATTGAAGATGGGAGACACTAAGTGAGAAGCAAGACTAGAATCTTCACAACATCTGGG
ATATAAGCTGCTATAGTAACAGTGCTCTTGAGATAATTCCTAGGGGTTCCTTAAAGTCCA
ATTTTTAATTTTGGGAGAATAAATTACTCATAGTATTTTAAAATAGAAAGGACTTTCTCT
TTCAGGCTAGAAAAGAAGTATATCCCAAGTCACCTCTACTTTTAGTTAGTGTCCCAAGAT
ACTACTTTTTCTAGGTTTCTTTCTACTCATGGTTGGTTTTCAAGAGCTATGACCATTTGT
GGAGAATGGAGAGATATTAACCTACTATTTCCCTCCCTCCCTCCCTTCTCTTCTCCTCCT
TTCCTCCCTCCCTATTATTAAAGCAATGGAAAGAGAAAATCATCCATAATTATAATATTC
AAACATAACTTTTCATTTGGGAATATTTTTTCTTATCTTTGTTTATGGAGTAGACATTTG
TAATTGATATGTTCAGCATTATAAACCCCTGAGTCCAAGAGTATCGCTGTAGGATATTAT
TTCTATCTTAAGTGATTTCTTTGAAAGTATAATGGAGTGTCACAGCATACATGACCTCAA
GTAGAAAACAGCCGTAGGATGAGGATTTTGGGTGGTCATATAAACTGGCAGTCACAGGCT
AAATGATTTTTTCCTTACACAGCAGCCTTCCAGAGCTTATGGTTTATATCTGTGTCTTAA
CAAAATTTCAAAATGTTACTTCCTATGTACTTTTGAGTCATTCACAGATAGTCTATTCAA
ATCTTCAGATGCCAAAAGCTATACTGGATATACGGAAAAGCAGAAACAATACAAACCCCA
TAGTTAAAACTTAGTGTATAGATGATATGCTTTACTTAACATACTCACATTTCCATGTTA
GTACATAGTCTTCACAATTATACTTTAAATGGTTGTCTAACATTTCATCAATAAGTTTAC
ACCATTATTTACTCAATTCCTTACTATTGAGCATTTTTGTTTGCGTCCAGATTTTTCTTA
TAATAACTAATGCCTCAACAAATATCGTTATATCAATTTGTCCTTATTTTGGTTTACTTT
CTTAGGCTAAGTTACTTAGTCTTTCTGAATCTGTTTACGATAAGGATGATAAATACTTAC
CTCAGAGGATATTTGTGAGAAAGGGGCTTATTCAGTGCATGCATGGCACATAGTAGACAC
TTGGTAAATGTTATTTACCTTATCCTCAATGTATATGGCCACCAGTTTCACTATATGGTC
ATGAGTATTTTGTATTATCATTTTAAAAAAGCGCTAACAGATGAAAGATTGTCCTTGTTA
TTTTGTTAATTTTTATTTTTTCAATCACAGGAAATGTTTCATATTTATCCACCTATTTGC
ATTATACTTGAATTTCCTTTTTGCACATTCCTTTTGTATCCCTAACTCATTTATCATGAG
GTCTTAATGTTTTTTGTTCTTACTTTCTTGTTTTCCCAGTGTTATATCAAAAAGCAAAAT
GATAAAATGTTAAAAATTTTCTTTTCCTTATTCATAATGTGTTTTAAGTGCATTTTTCCA
TTTTTGTTACATTTTTAAGTTAAAAATTTTTGAGTTCTAGATTCTTTAAGCCAGTATTAC
AGTTATATCCTAATGCTTAGTAATTTAAATCAGTGGGAATTAGGAAATTAGCATGTGCTT
TTAGAGGAATTGGAGCAGTGAGTTTCTGTTGTTTCCCAAAACCACCTATTGTACCTTTAC
AGGAGAAAAAAGCTAAAATTTGAGGGAGTTAGGGACCCATATCTTACCTATATATCTTGG
ATAGTCTCTGATTTTCCGTAGGAACACATTTCTAAAATTGTTTTGTAAATAAGAATTATG
AGAAAATTACTAGATTAGGTTTATAAAAACTAGGAGACCTATATGAATATTTCTTTGTGT
ACTTCATTGGTAATCTGTGTGCACATTCTGTGGTGTTCACATTTGTTTTAGCTTCTTGTG
TTTTGCTTAGCCATCTGTATTTCTACCTTCCTTGCTAATTTTTAGTATGTTTTTTTCTAG
TTTGTATATTTTCTTTTAAAAGATATTTCAACCTTTATTTTGTTATTGTTTTTTAAAATG
ATGTACTTTCAGTTAATTTCCATAGGTAGTTTGAAATCTGTTTAAGTATAAAATGCATTC
TCTTTATTTTGCTGAATTTTCTTATGCCTCTTCTTAGAATCCTGATTTCTCTCAGTTCCT
GGTCATGTTCTATCACTTGCCCTCTATTGTATGATCCTCAACTTGTTCTTATTTGGAAGG
ATAAAATAAAAATGGTAATCTGGTGATTTCTTCCCTCCACTCCATACCATCCCTCTCTAG
AGTGTGTGTGTTAAAATTTTGTTATGCAATATTTAACATCTATAAAATTCAATAAATGGC
TTGATCTACTTAGCTTGTAAAATAAAATATTATTCTAAGAGTTGACATCCCATGTGTACT
TTTCCCTCGTCTCCTTCCCTCTTGATCCCAGAGGTAACTACTGTCTATCCCAGAGCAGTA
TTTAGCTTTGGTTTGTTTGCATTCCTGTGCATTTCTTGATATAGTGTATAGTATTGTTTT
GCCAATTTTTACCTTTTTAGAAATGATATCCAACTGCGTGTCCTTTTGTACCTTGCTTTT
TTGCTAAACATTGTATTTGTGAGAATAATCTATGTTAAGTGTGTTTCTGTTGTATATGTA
TAGTATTTCATTTTGTCAGTGTACCATAGTTTACTTATCCATTATTTTGATGATAGACAT
TTTGATTGTTTCTAGTAGTTCACTGTTAGAAACTACCTTGCAATGCACACTTTTTGTTCG
TGTCTCCCTGTGTACATATATGCAGGAATTAAAAGCATTCTTAAGAAAGGCATTGGTTCT
CAGCTGGGGGAGATTTTGCCCACCAGGTGCTGGCAGTATCTGGAGATATTTTCGGTTGTC
GTAACTGGGAGGATGCTATTATTATTTAATGGCTGGAAGCCAGGGGTGCTGCTAAACATC
CTACAGTGCACAAGACAGCCCCCCACAACAGAGAATCATCTAGCCTAAAATTTTATTAGT
TTTGAAGTTGAGGAACTTTAGTTTAGGGGTATATTCGTGTTCGGCTCTGCTATTGCCACC
TTGTTCTCCAGTTTGGTGTGGTACCAGTTTATGGTCCTGTGACAGAGGTTTGGGAGTCCC
CATTGCTCCATATTCTTACTGGTATCTGGTATTATCAGACATTGAAATTTTCACCATTCT
GATGGATGTGAAGTAGTATCTCATTGTGGTTTTAAGTGCTGTTTTCCTCATTGCTGGTAA
GATTGAGTATCTCTTTTCATAAGATGCCCTTTTCATTCATGTTCCCTCTTCTGTGAACTT
CTTGTTTATATCTCTTACCGCTTTTAAATTGGGTTTTTTTCTTATTGATTTCTAGAAGAT
ATTTATAGTTCTAGATACCCATCCATTTGTTATTTTGTAGCAAACATTTTCTCCTGCCTG
TGGTCTATTTTTTTTATAGTATTTTTTACTGAACAGAAGTTATTCATTTTAAAGTGTGTG
AATTTTTCTTTCTTTCTCTTTATGGTTTATGCTTTATGCGTCCTATTTTTGGAATCCTTC
CCTTAAGCTGAGATCATAATAATTTTCTCCTGTTTTTTCTCGGTGAGCTTTGTCATGCTG
GCTAAGACTGACTTAATGTTGGAATGTTTCGTTTAGGTGCTCCAGCTGCTGCTCCTGCCC
CTGCCTCAGTCCCACAGATATCACAGCCCCCTTTCTTGTTGGATGGGCTTTCATCACAGC
CGCTCTTCAATGACATTGCTACAGGTATGATTACTAGTGTTGTCATCATTAGAGCAACAA
GGTAGTTATTGAAAAAAGCAAATAATAATTCTGCAAGCATTAGACTGTCTACAATTAGAC
TGATTTTCCTGTGCTTTCCCAGGCATCCCCTCCATCACAGCATACAGTAAGAATGGCTTG
AAGATAGAGTTCACCTTTGAACGGTCAAATACCAACCCTAGTGTCACAGTGATAACGATA
CAGGCCTCCAACAGCACAGAGCTTGACATGACGGACTTTGTTTTCCAGGCTGCAGTACCA
AAGGTACTATAATATCTTCTTTGCCTTTTTCCCTTGATTAAAAATTGGCTGATTTGTTTT
CATGCATTCGGTAAGGGATATATATAAAATTAAGTTTATAGATTTAACCCAAACTAACAA
CAGTGTAGCTATTATGGTTCATTGAAGCATGTCATTTTTAGTGAATACTTTTTACTTGAT
CATAAATATTCTTACAGTTAGTATTATAGGATAAAGAAAGGACATTCTAATAGTAGTGAG
AGAGCAGAATTCTACAAGATCGTTTGTTAATGCTAAGGACATTGAGGATAGGTTGGGGTT
CAGTAATACAGTGGTAAAGACAAAAAATCAAATTCTAACATGGAATTAAAGTTAATTAAG
ATGAAGGACTTTATCAATTTGGTATTCTGGTCTAGTCACTGGATCAGAATAAAAAGTTTT
TATCTCTTGATATATAAATGAGAGAAACATTCCTTCATTAACATCTAGTTTACTATTGAT
ACAGTGACTACTTGTTTTCGTAAATTGAAGTTTTGTTAATACCAAATCTTAGTTTAGGGA
GTGTTTATGTCCATCTTTAAATAAGGAAAAGTTTTGAATAAAGAAAAATTTAGAATGAAG
AGTGGGCAAAATTTTTCTGTGAAAGACAAGATAGTAAGTATTTCAGGCTCCATGGTCTCT
GTTGCATCTACTCATTTCTGCTGTTAGAGTGCAAAAAGAGCCATAGACAGTATGTAAATG
AAGGACTATGGCTCTGTTTCAAGAAAACGTTATTTATAAAAACAGATGTCAGGTCAGTCT
TGGCCTGTGGGCCATAGTTTGCCAACCCCTAATGTAGACTAAGCTAATCTAATCTTTGCA
GTGACATGTGAAGTATGACATTGAGACGACACATTTTTAGAAATTGAAAACCTTTTATTT
GTGGTTACTGCTGACTTTTCCAACCTTCTTTACTTGCATCTTTTAGGAGCCAGAATAATA
CAGGCGTTTTAGAAGCAGTAGAATGAAGTGGTTTCAATATTAGTTGTACAACATTAAACA
AGTTACTTCTGTGTCCCAGTTTCTTTATTTGCAAAGCGGGGTGGTGATGATATCTACTTC
ATAGGGTTCCTTTAAGGAATAAACAGTTTTATGTGCAGGTACTGTTTCAAGCACTTTTCC
TGTGTTCGGTGCTCAGTAAATATTAACTACTGCAACTTATGGTTTTATACTTGTTACTTT
AGGCTGCTGTTTTTGCGACATATCATCTCTGCTTCTTAAAGTCTGGCTTTATTCTTGGTG
CTGTACAATGCCTATTTGCTTATTATGATGTAGCTCGAACTTCAAAGTGTCATATTTCAT
AGATTCTACTATTACTATTTTTACTTTTTATTATCTCTGAAATTGAGGTGCATTTTAAAA
TTGATACCTTGTCGTAGTTTAATTGGCAGCCTCTTTTTCTTTCTCAGTGGCACATAAAAT
AATGATGTGAATTACAATTAATGGCATCTTACATTTACTGAAATAAATGTAAATAAATGA
ATAATATTTTAGCTTACATAATTTATCTTGACAATAGAATTATGACTAAGACCCAAAATA
GTAAGTCTGTGTGTTGAGATTAAATCTCTACTCTTGTAATTTTTAGCTCTAGAGAAGACT
AGATAGACTTCCCTCTTCCTGCCACCTCCACTCCCTTTCTTTCTCTCTCCTCCCTGCCCT
CCTCTCTTCTCTTCTCACCTTTTCCTCCTTCCCTCCCCTCCTCTCTCCCCCTCTTCTTTC
CTTATCTCTCCCTCCTTCTCCTCTCTTTAATATTTTAGAAGAATAAACTTTCAGGAAAGA
TTTTTTTTTTAAGGATTTTATTTTTCCTTTTTCTCCCCAAAACCCCCTGGTACATAGTTG
TATATTTTTAGTTTGGGTCCTTCCACTTGTGGCATGTGGGATGCCGCCTCTGCCTGGCTT
GATGAGCGGTGCCATGTCCGTGCCCAGGATCAGAACCGGTGAAACCCTGGGCTGCCGAAG
TGGAGCACACAAACTTAACCAGTCAGCCATGGGGCCGGCCCCTCAGGAAAGATTTTTAAA
TTGTAGTATGTAGAATTGCTACATACATACCATATTGTGCTGACAATGTGGTTTACCTGT
CTTGCTCATAGCACTTTTATCTCTCTTCCCTGTAAACAAACAAACAAAACCCACCAGCAC
TCAACAAATTATGGCATTTGGCTTTTCCACATCTTTTGCTACAGGCTAGTTCTGCATGTA
GTTTTTCCGTTGGGGTCTTGTGTCCCTACTGAATAGATCCTGATGTGTTCCACATACATA
TTAACAGGTTGGCTCTTTCCAGCCTTTCCTTCACCTCTGTCATGTAGGAGTAGACCTTGA
CACATTCCAGATTATGCAGCCTTTAGAAAACAAAAGTTCAAGTCTCCAGATCTCAACCAC
CGAAATAGATGAAAGCATGAAAGCCTGTAGTTAGTGACTGGTATGCTGGTTTTTAATTTT
TTATTTCTTTTTAGCTTTTTTTAGCCACAGGCATCCTTTTTTTTTTTTTTTTTCCTTAAT
CGAACTCAGGGATTATCCCCTTGGTGAAACTTCTTTCTTTTTCTTCTTCTTCTCCCCAAA
GCCCCCCAATATGTGTCTGTATATTCTAGTTGTGCTATGTGGGATGCCGCCTCAGTGTGG
CTTGATGAGTGGTACCATGTCTGCAGCTAGGATCCAAGCTGGTGAAACCCTGAGCCGCGG
AAGCAGAGCATGCAAACTTAAACACTTGGCCATGGGGCTGGCCCGGGCATCCCTTCTTTT
ACCTGCATAGTTGATCAGTTACTATTAAGTGAGGTTGCCAGAACAAAAATTGGTCACCTT
TTGAAAAGTAGTAGGCTGAAGATCCTTCAGCCAGAAAGGAAAGAATGGCTCATTGGTAGT
TTTCACGATCAATGCCTACCAGTGGGTTTTTCTAAACACCGTGAAGTGATAGTCAGCCCA
CATACTATGAATTGCTGATATCTGGAAAACAAATAGAACATAAATAGTACATAGTGGTAG
TAGGTAATAGTAATAGTAGTAAGTAAATCTGTTACCTGAACCATCATCTGTGTATCTGAC
TTTTTTTTTGTCGACATCTCTGACATAGTATTGTGTGTATTACTTTTTCTGAAGAGTGCC
CTTTGTTTCCCGTAGACATTCCAGCTGCAGCTTCTGTCTCCTAGCAGCAGCATTGTCCCA
GCATTTAATACGGGGACCATCACACAAGTCATTAAAGTTCTGAACCCACAGAAGGTGAGT
AGCACATTTGAAGATAGTATCTGAACAAGGTGTAAGCAAATTTCCTGAAATAAAATTGTG
CTTTGTTTCTCTGAATTTTTTGACTTATAAGTCCTAGAAGAAATCTATGAAAACGTCTGG
TCTAACCTGCTTATTCTTTTGTAGATAATAAATGGAGCCCAGACACATTAAATAGTTTTG
TGACATCTTATTAAAATGCAGCTTTAAAAAAATTCTCTATTTAGAGGTTTAAAGATCTTG
TTTTTTGCAAGAGGACAGAAAAAGCTTAGGTATTTTAATCTTTACACAAGTTGCAGTCTG
AGATAAGCACGTTTGTTGAACTAAATGTCTACCTTTACTACTGTAATTATTAAGTATGCA
TAGCAAAAGTGGAGAATTTTTCATGAAGTAACCAAATGAAAAATAGCTTTAGAAACTGAA
ATTAAGCCATTTTTTTTTATTACATGTTCTCAAAGAAGTAAATTGACTTCACTTAATAGT
AATCAGTTGACTAGTTTTCAGTTTTTGAAAATGGTTCAGAGAATTGCTTCACCTTGAAAG
ATCTCTAGTAGTGTCTCATAAATACCAGTATGATTTTCTCCTCTTGTAACACTCTGCTAT
CCAGCGTATTTTAAGTATTTGCCTGTAGCACAAGCACAAATTCCTTTGACGATCTGATAC
CTAGAGAGAGTAAAAATTTTCTTAGTGCATTAATATTTGAAATCTGCCATATAAAGTAAA
AAGTACTTATAATTGACTTTTCTTAAAACTACTGCTATTACTTGTAAATTAACTCATTTT
TTTCTTTTATGCCTTGGGAATGAAATGAGTTTATGTTTACATTTACAGTCATGCGTCACT
TAGCGACGGGGATACATTCCAAGAAATGTGTTTTTAGGCAGTTTCATTGTTGTGTGAACG
TCATACACAAGCATAGATGGTATAGTCTACCACACACTTAGGCTGTATGGTACCAATCTT
AGGGGACCACTGTTGTATGTGCAGTCTGTCGTTGACTGAAGTGTTGTTATGCAGTGCTTG
ACTGTACTGTAGATTTTACAGACAAAGCAACAGTATATTTGAATATAGAACATAAGATGA
GTATTTACCTCGTTTTTCTAGAAACTTGGATACACGAGTTGAATCTTTTTGAAAAGCACT
CAGTGAATATTCCTATGAAAATGCTCCCAAGTGGTTCTGTCTTATTAATGCAGTTCTAGG
ATTGAAGCCAGCGATGGGTTCTGGAGATGGATTTCCTCTGTTTGACTGCATGATGTTGGC
TCCTTGGCTAATAGCTAGAGTACTAGGTGGTTTTTGTTGTTTGCCTGTGTGTTATTTTTA
AGAGACAGCTTTATTTTAAAATGATTGTTTTTTCTAAGATTAAAAGTTTATTTGTGGACT
GGAGAGATTCTAGAGATTTTATTTCAATGTATAATTTGTGATTCTCTTTTCTTCTCACAG
CAACAGCTGCGAATGCGGATCAAGCTCACATATAATCACAAGGGCTCAGCAATGCAAGAT
CTAGCAGAGGTGAACAACTTTCCCCCTCAGTCCTGGCAATGAGGGTCTGGCACCATTCTC
ATTCTTATCCCACTCAATCAAAGGAACTCTGGGAAGGAGGTTGTGATTGCTGGCAAGTCC
CCCCCAACTGTACCATGGGCATAAGGAGCTGAAGAAAACTGTTGAGGAGGATTTTCCTGA
AGTTATTGCTGACCTTGAAGCATTGTTAAAGACTAATCTCCTCTCCTCCACTGTTGAGGC
CGGCTGCTTCTGGAGGCTACTTTGCACTCTTCCTCCTCTTCTCCTTTTTCCGCACTTCTC
CACCCCTCCCATATTTACAGCCAGAATCAACATTCCCTGGGCCCCTGAGGAAATAAGCAG
CTGGTCTGGAGGAGAGGACTGGAATCCATGACAAGAAAACACTCACTCTGTCTCTGCAGC
AAAGAGTTGCCCCTTCTTTCTACTGTGTTTCTCTGTGGACTGGGCAAGGTGGGGTATTTA
TTCCTCACTAGCTGGGTTACCATCTTCAGGCGCTTTTTACATCTGGCATTCAGAATGGAA
ATGTAACAATGAACATTAGGGAGCCCTGCCTTTTTCTACTGGTTCCCCCAATGTTTGAAA
GAGGCATTAGGCTCCTGGTAGCCTTTTCTGAGCATTGCTGTATACACACAGACACACATA
TGTATGTATGTTTGATACCAAGAACTGGTCAGACCTTGAGAGGTATTTGTAAACACTGGA
CAGATGCAGTTAAAAAGAGCTTTTGTTGAGATGTGGCATGAAGGATATGGTGCTCTATTT
GTAATAGAAACTTCCAAGGCTCTTCCAGCTCCCCTTTCTCTCCATTCTATAGCTGTAGTC
ATGAACACTCTCCATGATTTTCAAAATTGATTCCCCCTAAAGTGCAAAGTGGACAACTTC
TAAAAGATATATATATAATAATAGTTATTAATGCCCTTATTCTCACCATAAATTTTAAAG
TTTCTTCTAAGCCCGTAACTTGCCTGTTGAACTATGGTAAATGGGTGGAAAGAGGAGTTC
ACTACTTTTAAAGATCAGACTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1276, 21492..21695, 32699..32823, 37762..37903, 39515..39611, 40789..40865, 44036..44131, 44603..44683, 44885..44983, 47677..47732, 48868..48981, 51419..51559, 52294..52348, 55735..55857, 56044..56133, 56708..56835, 57428..57435, 58442..58538, 58855..58996, 59191..59317, 63096..63203, 63322..63482, 66615..66713, 68160..68261
21495..21695, 32699..32823, 37762..37903, 39515..39611, 40789..40865, 44036..44131, 44603..44683, 44885..44983, 47677..47732, 48868..48981, 51419..51559, 52294..52348, 55735..55857, 56044..56133, 56708..56835, 57428..57435, 58442..58538, 58855..58996, 59191..59317, 63096..63203, 63322..63482, 66615..66713, 68160..68258
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved