Equus_caballus Locus Q0QEN4_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q0QEN4_HORSE
Equus_caballus
Q0QEN4_HORSE
6
SNORD59, SNORD59
1863..1937, 2977..3047
7883
CTTCTCTCTCTATACTCATCTCTTTACTGTCCTCTCTTTTTTCCCTTCCTCACTTCCAA
CTTTCCTCACCTGTAGTTCCACAAAAGGGACATGCTGTTTCAGGTAAAGCTGTGCTAGGA
ATAGTCTCCTTTTCCGCTTTACCCTAAGAATTTCTACTCATGTTTCACAACGGATCTGTC
AGCCTCCTCCACTTTGAGGCAATTTCCCTACACCTCCAGGTGACCCAAATTTATCCCCTC
CTCCTGCATGCACCCACTTACCCTATACTAACCAGGAGCCATCACACTTTATTGCATAGT
TTGTTCATCTGTCTTTAAAAGGGAAGTCCTAAATCTTATTTATCTTTGTCTTCTCAATGC
CTAGCACACATCTGTTAAATGACTGGTTACGTTAGTTATTTTCACCGTACAGCTTTAAGT
GATAGACATTCTGTCCGGATTGCTGACCTGCTGAGCTGCCTGCAAGTTTCCAATCTCACT
GCTGCGGAAGAAAAACCGTGTTTTGACTCTAGAGAAGGTTCCTGACTTCGCCAAGGTCAC
TATCGGTGGCGCTTCACGACACTACCACTTTCCTAACCCCCCCACCCCCACCCCCACCCC
CCGCCGCGACTGTCACCCAGCTCAAGGTCCTACCTAAGGAGAAAGCCCAAGGACAGCCAA
AGACAGCCCACGTGCTTCCCGACAGGAACTCAGCCCCTTTCCTAAACGTAGTTCCGCCAA
GTATTGCCTCCAACTGACATCCCTGTTATCCAATTATGTTTCGAGGCTCTGAGGGTTGCA
CCTAGCCCGACAATGTCCAATAAAATAGGAATTCAGATTAGCACCAATTTTGGCCAATGG
TTGAGGAGATGAGAGATTGTCAGCCTATAGGAGCAGCGTTGAGAGTGATGGGCAGCAAAT
TCATCCAATGGACGTGCCTACTGCAGAGCAGGCCTCCTCCCAACTGCAGGCGAGTTGGCG
CCGGGACCGCTGCGGGGCTCAGTCTCCACCCGGACTCCGCCATGTTGGGGCTTGTGGGTC
GTGTGGCCGCTGCCTCGGCCTCCGGGGCCTTGCGGGGACTCAGCCCGTCCGCGCCGCTGC
CCCAAGCTCAGCTCTTACTGAGGGCCGCCCCGGCAGCGCTGCAGCCTGGTAAGTGCCTTC
CTCTAGGAGCTGGGTTCGTTTCTGCAGCCCCATGACCTTGAGTCGGGGGCCGATTGTCGC
TCGGGCCTAAGGGATCTGTGGTGCTAGAGGGACGCCAGGGCCAGTGCCCTGCTTTCTGAT
GGGAGGAGGACAAGAACGGATCGCCCTTGGGAGCTTTCTTTGATCTAATTCCATCTCATT
TTGGAAAAGGGGCGCTGTGTGACGGATAAGTGTGGGCAGGTGCATTGACCTTCCGGTAGA
ATGAGGGCACCGAGCTCTCTAACGATGGGGTTTTGTGCATGAGGATGGGAAGATTGTGCA
GGCGCTTTCTCGGTTCCTGCGAGGCCCTCCCTCTGGACACGCCTTCCGAGCAAGCGGAAG
GAGGCCGGGCCTGGGCCAAAGTCACCAGTCCTTGTGGGTCAAGTCGGGGGCTTCCGATGA
CCTTTCACCGTCCTGACCCCAGCTCCTTCCCATATGTTTTTTGTCTGTTAGCCAGAGACT
ATGCTGCCCAAACATCTCCTGCGCCGAAGGCAGGTGCCGCCACCGGGCGCATCGTGGCGG
TCATCGGTGCGGTGGTGGACGTCCAATTTGATGAGGGACTGCCACCCATCCTAAATGCTT
TGGAAGTGCAAGGCAGGGAGACCAGGCTGGTTTTGGAGGTGGCCCAGCATTTGGGTAAGT
AGAATCTGTTAGGAATAGTAAAGAGCTTGTTTAGCCCAAATATCCCAAAAACCAGGCTGT
CTTCCTTCTATGATGATTTCATCAAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCAC
GTTTAGGTACTGAGAAGGAGTCTTGGTTGACTTAGGCCTTTCATGCCAGCTACTTTCATT
AAATATGGTGAAGCCAACTTGTTCTTATGGATGACCCTGCAATACCTTTATCTGACAGGT
GAGAGCACAGTAAGAACCATTGCCATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAA
GTCCTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGCCCTGAGACCTTGGGCAGGATC
ATGAATGTCATTGGAGAACCTATTGATGAGAGAGGTCCCATCAAAACCAAACAGTGAGTA
TCCCTCTTGCTGCATCCACACACAAAGAAACGTTTTTCTTGCAGTTTTATACATTAAGGT
GATACCTTCTAGTATAGTAGATTTTTCCTGCAGAGAATACTTAAAATAGTGATATATTCG
ATTATTAAAACCACACAATCCAGTTTCTTCTGAAGAAAATGAAGGATGCAGAAATTCTGA
TTGTAAAAACTGCTACTTAGGACCTAAGTTGATTATTTAAGTGAGCTTTAATACCAGTGG
CTTAGGTTGTGGGGTTTCCAGAACTTAGAGTTTCTTGTATTTCCTGTTGGTGTGTGGAGA
GGTGCTATTAGATTAGGGTTCAGTAAAAGGGAAATCTTTATGATAGTTAAAGTTGTTGGG
AAATGGGATTATTGCTTCCTGAGATAATGAAATCCCCTTCATTGTAGAACATTGGGGAAG
ATGCCAGATGACAATTTGTCTAGAATGTTATATAAGAGGAGGTGAGGCTATGAGTAAAGG
GTTAGACTTGAGAATTGAGAGGAACCTTTCAACATGATGGAGAGACACCAATCTTTTCTG
CCTTTACAGATTTGCTGCTATTCATGCTGAGGCTCCTGAGTTCATGGAGATGAGCGTTGA
GCAGGAAATTCTGGTCACTGGTATCAAGGTTGTGGATCTGCTGGCTCCCTATGCCAAAGG
TGGCAAAATTGGTATGTTAGTGGTGGGTACATATTTTCCAAACCTAATGTGGGAAGAAAA
ACTCCTACTATGTTATGAGTGGGTCCCGAGATCTGTCCCTCGCTGATGAGTAGCTTCTGA
CTTTCGTTCTTCTGAGTTTGCTGAAGCCAGATGCCATTCCTGAGAAGGAAAAAGATGGAA
AGAAAATTTGTTTTGAAGTTTGCTTATTTGGGAACACAGAACACAGAAAGAATATTCTTT
CTTTTCATCCTCTCCCAGGGCTCTTTGGTGGTGCTGGAGTCGGCAAGACGGTACTGATCA
TGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTGG
GTGAGAGGACTCGTGAGGGCAATGACTTATACCATGAAATGATTGAGTCTGGTGTTATCA
ACTTAAAAGATGCTACCTCCAAGGTGAGCCCTGAGCTGGTGTCCGCAAAGTCGTTACATT
AGGAAACTTGGAGTTGAGTGCATTGCTGGCTGAAGCCATGTTTTGTATTTTAGTTTTAGT
GTTCCAGGACCTACAAAGGAAATTTCTGTCAGTGTTTTTCTCCCAAATTCTAATACACTG
ATGCACATTTTCTTTTCTCCTTGACATTAGATTACATTTCCAGGCTGTTTCTGGTAGATA
GTCCCATCATTTGAGGCTGATTTTGGAGGGAGTTGGAGGTGGTTCATATGTCTCAGATAA
CCCTATTTTATGCCTGCCCCTTACTTAGAGTTTATTTACTTCCTACTACAGGAATTTTGG
CTCAGTAATACAAGAACTGTCTTTTGTGTTGTTTTGAACTGCATCTCTAAAAGGGAATAG
AAATTTGCGAACAAAAAGCATTGATACCTTCTGAGAAGGAGGATTTTGGGGGTAGTTTCC
CTTGATTTGGAGACCTTGGGTATATGGCTTCCATACTTCTCTGCCAGGTTCTCTACTTAT
GTATGATTACTGCAGGTAGCGCTGGTGTATGGTCAAATGAATGAACCACCTGGTGCTCGT
GCCCGGGTAGCTCTGACTGGACTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAA
GATGTACTTTTGTTTATCGATAATATCTTTCGCTTCACCCAGGCTGGCTCAGAGGTAAGA
GAGGCTTGAGAGGACCGGGTTCATTTGACCTTTCTATGGAATGATGCAGGTGAGGCTAAA
GATGTAGAGACTAAGACCTTTGTTTTTACTCTTTTTTTTTTTTTTTTTTTTTTAGGTATC
TGCTTTATTAGGCAGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACAT
GGGTACCATGCAGGAAAGAATCACCACAACCAAGAAGGGATCTATCACCTCTGTACAGGT
AAGAACAATTAAATGAATGAAAGTCTCATTTGCATAAAGGCATGTACAGAGACGTATGAA
ACCTCGTTACTTATGCCTCAAAAGGCTTTTAACCCGGTTCGTGAGCTCCCTTACGTAATG
TGTAAAATTGTGTGTGTGCATGTTAAAAACTCTAAAAGATTAAGAAACACTCATCTAAAG
TAATTGAAGGTATACATGCAAATATAGATCACAAAAGTAGTGGTTTCCAGTTGCAGAGGA
GTCTGAAGATGGAAACTGAGCATTAAATATATACTGCACTAATGTACTACAAACTTTCAA
ATGTATATAGATGGTATGTATAGTAGAATTATCTGAAAATGTGTCTGCATTAGAGTAACT
TTCATGATTCATTTTCCTAGTGAACTGTTGTAGTGGTGCAAGGTTTTTTTGCTTTTGTTT
TTTAACTCTAAAAGTGGGTATCACTAAGAGTTAAAATGTAGGATGAAGAACAAAAGGAAT
GACAATGGAAATTGTTTTGTCACAGCTTGGAGGGACCAGATAATCCCTAAGCTCTCAGCA
GCTGTTAGGGGTAAGAAGGCTCTTTTGGGGTGGACAGAATGCTAAGAAGATGAAGTGAGA
TGAAAAGTCAGCAAAGGGGATGGCTTAAGTGGAATACTTGGCTTCCTGCTGCTCCTCATG
GGTTCTTGACTCACTTTAGGCTATCTATGTACCTGCTGATGACTTGACTGACCCTGCCCC
TGCCACTACCTTTGCCCATTTGGATGCCACCACTGTCCTGTCCCGTGCTATTGCCGAGCT
GGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGCATCATGGATCCCAACAT
TGTTGGTACAGAGCATTATGAGGTTGCCCGTGGGGTGCAAAAGATCCTACAGGTGAGTAT
TTCAGGTGAGGTTGGTGGTCATAAAGTCATACAGAGAGAATTGGGGATTATATTAGTACC
AGAACTTGTGGTGATTGTGTCATTTGTTTTGGAGCAAAGAAAGATGAGATCAGGAGTTTT
TAGTGAGTGTTAATGAGGTCTCTTAACAGCACCAGACTAGGAATAAGGAGAAAAAGACAC
TGATCATAGCTGAGGGCCCTCATGACCCCAAGTGTGTAACTTCCCCCTCCGCTAATTTAC
GAAGTGAGGCAAGATACTAAAATGCTTTGTACAAAGCTTAGTGTGAATGTAAGGTGGTAT
TAACCCTTAGGTTTTTGTCCAAATTTAAGGAATGTGAATATTTACTTGGGCTTCTCTTGT
CTTGTCTTCTCATAGGACTACAAATCCCTCCAGGACATCATTGCCATCTTGGGTATGGAT
GAACTTTCTGAGGAAGATAAGTTGACTGTGTCTCGTGCACGGAAAATACAGCGTTTCTTG
TCTCAGCCATTCCAGGTTGCTGAGGTGTTCACAGGCCATTTGGGGAAGTTGGTACCCCTG
AAAGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAGATTTTGGGTATAAAGCTG
AACCAAAAATGAGAGAAGCTGAAATCTCTTGAATGCTCACTGTGCTCTGTTCCCATTCCA
GCAACCATCAAGCAGTTATAGGTAGACTGTGCCTAGTTATATAATTTTTTAAATAATAAA
ATAAGCTATTTCTTTTTCTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTAACACTTGCTG
CCAATCCTCGTCTTTTTGCTGAGGAAGGCTGGCCCTGAGCTAACATCCGTGTCCATCTTC
CTCTACTTTATATGTGGGGCACCTGCCACAGCATGGTTTGCCAAGCAGTGCCATATCCGC
ACACGGGATCCGAACCAGCGAACCCCGGGCCGCCAAAGCGGAAACGTGCGCACTTAACCA
CCACGCCATCGGGCGGCCCTAAAATAAGCTGTTTCTCATCAATTTTCTTTGGAAATACTC
TATATTTACTGCTCAGAGTGAGGCTTGTATTATTACTGGATTCTTAAGTCATCCAGCACT
TACTGAGCGCCTTCAGTGCAAGCTAGTCCTCTAAGTGAATTGCAGCATCCTTGTAAGGAA
GACGATTAGTATCTTGTTATACAAATTTGGAAACTTGGAGCACTGAAAAGTTTAAAATAA
CGGGTCCCAATATCACACAGCAAAGTAGAGGGCAAGAATTTGAACCTAGGCTGTGTGGCT
CCAGACCATTTGTTGTTAATCCATACTGTATCATGTTTTCTAAGTTGGATTTGTGAGGGA
AGTTTGTTAAGAAAAGATTTCTTAGATGACATGAATTCATCACATTCTGACTGGTGGCCT
CAAGTGTGAGTTACGTACACACTGCAGAAAGTTGATGTCCCTCCGCTTCTCACCAGTTGG
GTTTTTTCCCCATATAGGTGACTATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGG
ACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCGTGAGCAGG
TCCTTTCGGCAAACTAGGCATTCGTCCTCCGTGCTGTCCCTCTCCTTGCCCCTACCCCAA
AAATCTCAGTTTTCTCTGTAGGCCACATGAGAGCCTTGACTGAAGACATTGTGTTCTATC
TGAAAAGAGTATTTAAGGTTTCCAATAAAATGTACATCCCTCCGAATCTGTCTATTTTTC
TTGGTCCTGACAACACAGCCAAGCCAAGTTTTTAATAATTGAGTGGCCAAAAGAAGCAGT
AGCACAAAGTAGGCCGTCTGTTTGAAATGGGGTCGTCAAAAAGGAAAAGCCATGGTCTTG
GATTGATGGACAACTGTGGGTCTTGTGAGGGGCTTCCTGTGGAAGATGTGATCTTAATAG
CAGGACCTCAGCTTTGGCCCTTTGATGTCACTTGTTGAAAGCAAATTGATTGTTTTCCCT
CTTAAATAGTTTATATATCACATTCCTACTTGGTTAAAAAGCAAAGGGATTTTTTTACAA
GTGTATTGGGAAAAAGGGGTTGGGTAGGAAAATAACTGCTATTGTAAGACAAAGCAGGGG
TTAATCAGTGAATTAAATGAATTAAATTTTTAGGAAATGATGCATATTCTAAAGGATTAA
TACTGATCTGTGCAAAAATGGAGTCAAAAGGGCCCCCCATCTTACCTAGGCCTTCATTTT
TTCAGAAAGTGTTCCTAACTAGCGTCTCATGTATTTTGGGCAAGCCTGGACTTGTACATG
ATTCCTCGAGGCACTTCAGAGTATGAAATACCAGGAGGCCTGTCCTGAGCTCTAAGATCC
CTTAGGAAAGTTGGGGGAAGAATCTTACAGGGGAACAGCAATTTTCACGGTTGCTGGATT
TGGCCTTCTGAACTGAATAATGGAATTACGTCACTTCCCCTTCATTTTAGCCCATTAGAA
TGTGCAGAGTTAGAAAATACTCAAAAGTACACCCACCATTTCAGTTTGAAACAAGTGCCT
GTTTGAGTACAAGGTCGCTTTTGGTAACCCTGAAAGCATTCTCTGGGCCTAGACCCATCT
CCTACTGCCCTCTGGTGGTAGGACTGGAGACTGCAAGAACTCTGATCTCACCATTTTGAA
ATCCATGAAGGCCATTTGCTGGGATGTGGTTCTTAGCTAATGACTGTTTACAAACCAGCT
GGGGCTTTTGTCCTGAGGAGGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1611..1793, 2038..2212, 2769..2890, 3138..3322, 3855..4013, 4135..4257, 4939..5151, 5535..5736, 6617..6883
1001..1127, 1611..1793, 2038..2212, 2769..2890, 3138..3322, 3855..4013, 4135..4257, 4939..5151, 5535..5736, 6617..6711
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved