Equus_caballus Locus C12orf41
snOPY snoRNA Orthological Gene Database
Equus_caballus C12orf41
Equus_caballus
C12orf41
6
SNORA2, SNORA2, SNORA2
7952..8086, 15146..15278, 16577..16713
18088
TTATGTATGTAATTTCCCAGACTCATTAAACACTCAAAAAATGTTTCAGTAAATGAACT
CACGAAAGAAAACTAAAGCCTTTCCGTGTATAAACAGTAAGAGTCAAATGCACAGTGACC
CTCTGGCCTCTATATGTCTGATTTTCTACCCGCTGTGTAGGGGTGGTGGGGTAACTGCAG
CCTGGGACCACAGAGCGGCCAAAAGTGCCCTGAACGGCAGCCACGCTGCAAGGTGCAAAC
AGTCGCATCCGGGGAGCGGCTCTCGCAGCCCGCGCTCCCTTCGGGTCACCCTCCTCGGGG
CGGAGTTGCTGACAGACAGGTCCTCTCAGCCACCCGAGCCGCGCGTTTTCTCAGCGCCCC
GCCCTCCCAGACGTGATAGGTACCTGGCCTCGGCCAATGGTGACACACCACTGTAGGCGC
ATTAGCCAATCAGCGGTTGGGAGCCCAGAAAGGAGCGGGGCCGCGTTAGAAGCGGCTGGC
GCGGCTGGAGAGCTAGCTGCGCGGCGTGGAGGCAGAGGTAAGATGGCGTCGGTGCTTGCT
TTTTCCTTTGCAGTTAAGCTGCTGCTTCGCTGCTTCTATCCGCTTGGAGCTGCTACTGTG
CCTCAGTCTGCGTTGGGGTCGCTCTCCTCCCATAGTCTCCCAGGACCCACCTTCTCCGGG
GCCCGGAGCCTTGGACAAAATGGCGCTTGCATGGGCCGCCGAGGACGGGCAGGGCCAGCC
GAGAGCTTTGAGGCGGGCCGGGACAAAGGCGGCGTACAGGGAGGCGGAGGCGGAGGCGGG
GCGGCGCAGCGGCCGCGCTGGGCTTCCCCCTGGTGTCGCGGCCGTGCGAATCCTTGAGTT
ACTTTCAGCGCGTTGGTGGTCGGGGTGGGGCGGGCATGGAGGGGAAGTTGAGGTGAGCGA
ATCCACTCGTGCCAGAGGGGACCTGGGCGGGAGGTGGGGGGAGCTACGGAGCGTGACTTC
GGTCCGCCCTTTAGCGGCTACCCGCGCACTGCCCGGATATCGTGGAGCAGGAATTTTCGG
GAAGGGTAAGGGCTTTTTGATCTTTTGTGTGACCCTCCAGGTTTTGGTATGAACAGGATT
CGGATCCACGTCTTGCCGACCAATCGGGGGAGGATCACCCCAGTGCCCAGGTCTCAGGAG
CCCCTGTCTTGTTCGTTCACTCATCGCCCATGCTCGCAACCTCGTCTGGAGGGCCAGGAG
TTTTGCATTAAGCATATCCTTGAAGACAAGAATGCGCCCTTCAAGCAGTGTAGTTACATA
TCGACGAAGAATGGAAAAAGATGTCCCAGTGCTGCCCCAAAGCCTGAGAAGAAAGATGGG
TATATATGCATAGATAGTTATGTCGTTTGTACTTTTAAAGTGAGAGGGGGATGTGATATG
ATGTGGGCTTGGGCAGAGCTGCCTGAGTTTTTAGGTGCTGTGCTTGTAAAAATTGGGGAT
ATGGATATATCCTTGGAAAATGAAAAAAATCTTAAAACGGTGGAAAACTGCAAGGAGACT
TCCAGGTGGGGCACTTAGTTCATCTCTTTGGATCTTTTATCTGTAAAATGAAGAGATATT
CTAGGTTAGTCTTAACCCCTGGGAGTCCCTGGCTCTTTTGGCCGTTTCTGAACTTTGCAA
AATTGTGTGTTATGTGTGTTTTTCTGGGAAAGGTTTCATAGCTGTCATCATATAAGCAAA
GATATCCGTGCAGAAACATAACTTGGCTAGATAGATCTGCATATGTCTTTTGGTTTTAAA
ACTGTGTCCCACATCTGATTATATACAATGGATTGATATTGAAGTAAAATGTAGAGTTGC
CTTCCAGAACCACTTTTGAAAGATGAAACTGGATTTCTTTGATTTGTGTGAGATGATGTC
AGCATTTTTATAGTTGGAATGTTTTGTTTGATGGATAGAGCGTTAGATTATGCCACCTGT
ATTAACTTTAGCAATACCCAAATGAGTTGACAGTGGGCCAGTTAAATTACTCTGCCTCAC
TGGCCTTTTTTTTTTTTTTTAAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCC
GGAACACAGTTGTGCATTTTCAGTTGTGGGTCTTTCTAGCTGTGGCATGTGGGGTGCCTC
CTCAGCATGGCCTGACGAGCGATGCCGTGTCTGCGCCCAGGATTCGAACTGGTGAAACCC
TGGGCCGCCGAAGCAGAGTGCGTGAACTTAACCACTGGGCCGCGGGCCGGCCCCCTCACT
GGCCTTTTTAGTTTATAAATGAAGTTAATAGTCATTTTAATTTCCTAAAAATGATCTAAA
GACCGGTGTCTATGAAAATCATCAAACTCTTGAAAGAGGGAACCTATCTGAGTATAAAAC
GTTAATATTTTGTCTCCTTAGGGTGTCGTTCTGTGCTGAACATGCCCGTAGGAATGCTCT
GGCACTTCATGCTCAAGTGAAGAAGACCAATACAGGGCCTATGGGTGAAACACTCTTGTG
CCAGCTGAGCTCATATGCTAAGACAGAGCTGGGGTCTCAGACTCCAGAAAGTAGTCGCAG
TGAAGCCAGTCGAATTCTGGGTAAGGATCATTCTCTCTCCTAGAATGAAAAAGGAGGAAG
AACATTAACCACTTACTTTGGTTTAGCACAGTGCCTTGAACTTACATGGCACTTGATAAT
ACAATATTATTGCTAATTTGTTGGCAATTGGGTCAGAATTGCAGGATTGCTATGTTGTTC
ACCAGTTCTTTTCAGTTTGAAGTAGTGTGTGCTTAGGTTTACTTTCCTGAGTTTAGGACT
GTTTTCTTCATTGCTGTTTTTATACTTATCATCTTTGCTAGGTAGGGTAACTAGGTAACT
TCAGGAAACAATAATTTTGAGTTGCCCTTTTTGTCCTTTTGAGGGCATGGTTAACTCATT
TATGTTATAAATAATCTTACCTGGGTTGTGTTTTTTTAAGCTGTTTTTATTTGCCAGTGC
CTTTGAACTAAGTTTTTTTAAAATTAAGATTTGGGTCGATGTGTTAAGTAATCTAGTTTT
GTGTGGTGGAGTTACAGAGGTGGGAAGTCTTAATGGCTGCTCTCCCTTCCTTGCCTCAGA
TGAAGACAGCTGGAGTGATGGGGAACAGGAACCCATCACTGTGGATCAGACATGGAGAGG
TGATCCTGACAGTGAAGCTGATAGCATAGACAGTGATCAAGAAGATCCCCTAAAGTAAGT
TGTAACTCCACATAAGGCTTTTAAGTATTTTATGTAGTTAGTATGTGGAATGTAGTACTG
CATACCGTTAATAGATCAATAACTTGGGAGGATTGAAGATAGCTTAGCTGTTTGTGAGCA
GTAACAGCTTCTGTATATTGAAGTGTCATGGTTCATCACCACCTTCAAGGCATGATTTGA
TTCTTTTTTAGAAGTCTTCTGATTTGGGAAAATTTTTGGACATCAGATTTTACACTTGAG
CAACTAGGGGAGAAAATAGGAAATTTCTTGGATATAGGAGTTGGGAGGTGGGTTTAGAAA
TGCTTAGGTCAGTTTTTATGTGAATGGGTTCTTGGCTTAAACCTCAAGAATAGTAAAGTG
ATTGTATTTGAATAACTACTTTTTTGCAAAGATACATTTTATGGTTTTTTTTTTTTTCAA
GAAAAATAAAAAGATGTTCAAGAGTTTCCTTTGGTTTCATACCTAAGAGAAACTGATTTA
GAAACCTAGAAGAGAGTAATGAGCCTAAGTGTATCTTACTGAGGTTCTGCTCTTGCCTTA
ACCCACAATCCCCTTAGGATTGTAGAAACATGAAAAATCTTGCCACTCCAAAGTCTCATA
TTTCTGTGTCTTATGGTTTGAGTTTAGTGGGTTGTTTTCTTTCTGACTTCTGTCTCTTGA
CACTTCCCACTGACAGTTAAGGTAGAAGTACTGTATATTGTGAGAGGCGTAATGACTTTC
TAGACTTGACTGTTGGACTTAAATTCTCAGAATAGCATTTTCTTCATTATCTAGGATTCT
GAGTTTATAAGAAGTCATTTAGGGTTACGTTTTCTGAGTAGAATGATTTCATCTGTTTCT
ATTGAGTATTCTCAGCGTGGTCAGGAAGCACTTGTTTGGAAAGTCTCGGACCAAGTAGTT
TGAGAAGGAATGTTTGTTTTCCAGCTGGATTCTCTCACAGTAGTAACTTTATACCAAACA
TAGTCTTTTTTTGTCCCCACTGTGCTGCTAGAAATGCCAGACTTGCTGCTTTGAAGAGGT
GTATGCTCTGTAGGGTCACAAAGACACTGTCTTTTGGTGTGGTAAACACTCAGCTTTAAA
GGTGCAGAAACTTGTTTTTGTCATTAGTAACCCAGAGTGGATCAGTCTAGGGGACACATT
CATGCTAATCTAACTTACGGGAGAGTGCTGTATAAACCAAAATACCAGTTAATTTTATGA
GAAGCATAAATGTTAAAAGGAATACGTAATTGATGTCAATTTCTCCTAAAAGGAACATTC
AAAGAGGAAACTAAAGACCCAGATATGTTCAACTATTAGGCATCTAAATATCAGACTTTC
CTTAGTTCTCCCAGTGAGATTATCCAAAAAAATTATGGCTCGCTAAAATATATGCATTTT
TAGGGATTTAAAATGGAGTTGTTAAGTGTCTGCTTATAATACTTAGTTTATTAATCTGAT
TACATACTGCTATCTTGTTATATTTAATACAAGTGTTTATTTAATGAAATTCTTTTAATT
AAGAATTTTCATCTTTGGTGCCAGTGTTTTTGTTATCACTAGGACCACTTTTTGAATCGT
TAACAATTTACAGCATATATCTTCACTTGTTTCAGGCAGGGTGCTTTTTGTATTGTTTAT
GATGATGTCATTAGAGATTTTATTCTAACAAGAATTACTATTGGCATAGTGTTTTCCCCC
TTTGTAGGTATTTATGTGTGATTTCCCTCAAAGTAACCATTTACTTAATTGCCTTGTAAA
AAGTAATCTTTAAAAGCTCATTTATAGCAGCATCCAGCACTGGTGAAGTTTTAGCTTAAG
AGTAATTGTTAAATCTTTCTTTGTCTTTTTAAGTTTTATCATATGACCTCTACAAGCATC
CAGAGCCTGTTTTGGTAAAGATCAATTCAACTTAGTGAGTCTTCTTCATTGTTATCAAAA
TAAAGAAAGTTGGGAGAATGCCCTTTAATAAGAGACACTATTTAATGGAGTATAAGGTGA
CTCTTTTTTGAACATGAATTCTAATAATAAAACCTTGACTTATATTTGTGCACATCAGGG
CAAGGGGAGTTAATGCATGATTTTAATAACTAGCTGTGAATGTCTGGAGCATCTCTCTTT
AAATAAATGACCCATTTGTCCCATAAACTAGGCATTCATATTAGTCAGGGCGCTCACACA
TACCCCTTCTCCCTTCTTATCCCCCAAATGATTTGTAGTAAATTCTGATTATAGTGGCTT
CCCATTTATAAATTCTAGTCCTTAGACCATTGGTTAAATTCTCTTCTGACAGGATACAAT
AAAATTAATTTCATTTTAATAAACTTGATATTAGGTTAAGGCTTCAGTATTTTAGAGTTT
CAGACATCTTAATGCAGATATCGCCATTTTCCTGAAAATGGAACGTAGTCACCTTGTTTG
GACATTAGATATTTTTAAAACTTTCACATTTTTTGATAGTCTTAGATTTGTCGTTTCTGT
AAATTGCTGGTTTTATTCTTTTTTTTTTTGGTGAGGAAGATTGGCCCTGAGCTAACATCT
GTTGCCAATCTTCCTCTTTTTGTTTGAGCTAAACATCTGTGCCATTCTTCCTCTATATAT
GGGATGCCCCCACAGCATGGCTTAATGAGCAGTGAGTAGGTCCATAGCCGGGATCCAAAC
CTGTGAACCCTGGGCCACTGAAACGGTGTGCGAACTTAATCACTATGCTACTGGCCTGGC
CCCTGTCTTTACTTCTTTTTAAACATAATGCAAATAACTAGGAAACGTAATGAAACATTT
CCTCTTCGCCATTATTGTAAGATCATATATTAGTATCCATTCTTGGAGATTTTCTTTTTT
GTTTTGTTTTTTAATAAGAAAATTTGAATACTAAAATGGCTGTGTGAAAATATTCCTGTT
TAATAAGGTGATTATCTCAGCACTGATTACTTGTTAAATAACAAATTTAGGTCTAACCTC
TACCTTTTTCTCCTTTTAAGCTTGGGTTTTATTATTGCGCTTTTTTTTTCTTTGCTGAAT
TCTCTATTTTATTCCAGACATGCTGGTGTCTATACAGCAGAAGAAGTGGCCCTGATTATG
CGTGAAAAGCTAATTCGTTTGCAGTCTTTGTACATTGATCAGTTTAAACGACTTCAGCAT
CTGCTCAAAGAGAAGAAACGACGTTACTTACATAATCGCAAAGTGGAACATGAAGCTCTA
GGCAAGTTTTATGCCAAGTCCAACAAGCTGTTGTGGGTTGAATTTGGTAGTAGTTAGACT
TATTTCTGTCTTGGTGCCTTGAGTGGAGGAGAATTTGGTTTTGAAACTGGCTATCTTATG
GCCACAGATTTCCCTATTTACTTCTTGTTAATTTGGAAAAGCATCCTTGACTGGTTGCTC
AGTGAATAGCATCTTGACTGTTGTGACTCTCCAGGTAGTAGTCTTCTGACTGGCCCAGAG
GGACTTTTGGCCAAAGAACGAGAGAACTTAAAGCGTCTAAAATGTCTTCGGAGGTATCGT
CAGCGCTATGGAGTGGAAGCCTTACTACATAGGCAGCTGAAGGAACGCAGAATGCTGGCA
ACAGATGGTGCCGCCCAACAGGTAATTTGTGTGCATACCTCTAAGGTGTATACCTTTGCT
TTATTTAGGAAGTTAGGGTACTCGTCAAAACACTGTTGCACAGTCTTAGCTCTGAAATCT
GACTTACTGGACATGGGGTATGTTGAAAAGAGCACTTATCTGGAAGTCCAGGGACATGGG
TTCTAGCCTCAGTTCCCTTCTGACTAGTTATTTGCCTGCACTGATAACTTCTCTGCGCTT
CTGTTCTCATCTGCAAATTGAGGGATTACCAGAGATTTCTAAATTCTTTGGTTTGTTAAT
TTTTCCGTTCAGAAATGGACACAGGGTTGACCTAAGTTGCTTGGGAATCTGGTTTTAGAA
GATGGGAAGAAAGGTAGACTAATAGGAGCAATGGATGTCAGAGGTAAGGTTGATAGGAAG
CAGAGTTCAGTGATCGTTCTTAAGTTTGTTTCTCAAGTCTGACTTGAGAATACCATTTTT
TATCTCTATTTGTTGAGGCTCCATGTAAGATTAAAATTTAAAAGAGTTCTCTTAAAAGAT
GAAGTGGTTTGAAAACCATTAGGCTATATCACACTTTTCTAATATAGAGAGGTGTATTTT
TTTTTTCAGATTGTATTTTTCCTTTTTCTCCCCAAAGCCCCCTGGTACATAGTTGTGTAT
TTTTAGTTGTGGGTCCTTCTAGTTGTGGCACGTGGGACACTGCCTCAGCATGGCTTGATG
AGCGGTGCAATGTCCGTGCCCAGGATCCGAACCGGTGAAACCCTGTGCCGCCGAAGTGGA
GTGAGTGAAGTCAACAACTGGGCTGCGGGGCTGGCCCCCATGACAGGTGTATTTTGAGTT
AGGGTTGACTCATTATTTGGACATGAGGTTTTAAATTATTTTTCCTTTGGCATAGTATTG
GTGAATAAATTTGTTAAATGTTGAAGTTTCTGGTCTTTAAGGATATACCTTTCTTATGTA
TTGTAACTTGAGTATTCTCATAGATAAGTGGTTGTATATTCGTTTGTGGGTTTGTTTGTT
TTGATTTATCTGTTTTCTCCATTTTAGGCCCATACCACTCGTTCCAGTCAGAGATGCTTG
GCCTTTGTGGATGATGTTCGTTGTTCGAATCAGTCTCTTCCAATGACCAGACACTGCCTT
ACCCGTATCTTTTTACTCTGTTCAGTTTGCTAGCTAGACTGAAAGCTAGTGGGCTTCTCT
GTGTTTGCTTCATCGAAGGTCTTTGTTTTCCTTTGGCCCTGAATCAAGGCCAGCAGTTTG
CTGAAGCTGTTGGTTTCAAGCAGGAGCCTAAAGAAATGTCTTTCTATGGTCTGTTGACCA
TTTCAGAACTTGAAATGTAGTGGTCAATTCATTAGAAAGAAACATCTGAGTCATTGGTGA
TAGATGTGGGCTAATCTTTATTCGTAGTCGGTTTATACTGGGATTCCAAAATACAGAGAT
CCCTCATTTAACTTGTTCATTAGAATTGTAATACTGTTAAATCCAGTTAATAGCAATAAA
ATCACTGGGTTTTCCATCAAAAATAATGGGACGGTTCTAAACTGTGAGCTTCCTTCAAGT
ATTATCCTTTTGTGTGGTTAGGGCTCTAACTTGTAGTTGTTAGACCTAATTCAGATTGAA
AACTTACTGTTTCCGAAAATGGATTGATTCCTCCCCAATTAATTTGCCTTTGAACCATTG
TAGCATCTCTTAATTTTGCTATGGGACTACATTTACTATTGGGCTGCAAAACTTTTTGGG
TTGTTTATTGGATTGTGAAAGTGCAGTTTTCTTACGGACATTGAAAACGTTAACTTTCAC
GGTAAAAACACTTGTTAAATATGATGATCCTCACTATATGAAAGGCATAAATCTTGCTGG
ATTTCATTTGCCTAGCAAGAGATGTAAAGTATTCGGAAAGTAAAATGTATTTTCTTTAAT
ATGAAGAGGAGAACCTTTTCTTGGTGTTTTGAAAGGAAAACTGATTTTTTTCTATTCTAT
TTATTAAATATTTTACCAATTTATTAATTATTGCAATAAATATGTGATAAAGGATTACTG
TCCTTAATATAGAAAATGCTTGTGCAAAGTAATTAAAAACTAAAGATAAATGCTCAAAAT
ATAATTGGGCAAAAGCTGTCTGTGGAGAGATTAAAAATAGAAGGGACTGAGCCAGCCTTG
ATGGCCTAGTGGTTAAAGTTTGGCACTCACTGCTTTGGTTGCCTGGGTTTGGTTCCCTGG
CACAGAACCACACCACTCACCTGTCAGTCGCTGTGCTGTGGTGGTGGATCACATAGAAGA
ACTAGAAGGACTTAGAACTAGAATACATGACTATGTACTGGGGCTTGGGGAGGGGAACGA
AAAACTAGAAGTGGCTGATAGTTGAAAAGTTTATCTTCACTCCAAATAAATGAAATAGGA
AATAAAACAAGGAAATTTTTTTAAGTCTATAAATTTGATACTTGTATACATATGATATTT
AATGAGTGTGAATTTCAAAAGTTGGTGAGGGTATGGTGAAGTGGGCTCTTCTCAACACTG
CCAGTGGGAATATAAAGTGATGCAAGCTTTTTAGAAAGCAGTTAGACTATATTCATATTC
TTTGGTAATGTCACCTCTGGGAATTTATTTTACGGAGATAATCAAATGAAGATTAATATT
TTTTAATGAAATTCCTCCAATTGGAGACAGCTTTAAAATTTTCAGAGAGGAATAGAAAAG
AATTGTGATACAACATAATGTGGAATATGTTCAAGCATTAAACATTTAACAAAATTTACG
GATGACATAGGAAGATGTTTGATGGTGACAAAAATAGGATATGGAATTCTGTGGAGTATG
TTTTAACTACGTGGAACAAAATACTGGGAGAGAATGTAATAGAGCTGTGACTTTATGGAT
GGTGGAGTTATGAATGTCTCTTTTTCCTCTGCTTTATAGAACTTTTGAGGTTTTCTTCAG
TGAGCTTGAATTACTTTATAAGGCAAAACCCCCAATTTATAGATATTAAAGACTATTTTA
GACTTTTCTTATAGTACTATACTCAATATATGAGAATATTAATATTTTAAAAAGCGAAGT
CGGAAATGAAATGTATTTGAAAAGAGAAAGGAAGTAGTTTTTCTTTTATGCTCTTTTCCT
TTCCACTCCGTAGTTGCCTAAGTCACTTACCCTTCCTTAAGTCCTTATCCCAGAGAAAGA
TGCGACTGCCATTGGTGACCTGTTAACTCTTTACTCTGGTCTAATGGAGACAGCACTGGA
CTGAAAGTGAAGGACCCAGACGCTAGTTGTAGGTCAACCATTCCCTTCTCTTTGTCTCTT
TTGTCCTCATTTGAAAGGAAAGGGGGTGGCAGAGGATGGGGGGGAGGGTTTTTCTAAGAT
ATTGTGGTATTAAATTAATAAGAGACTTGTTGAAGTCCTTTGAATTCTATGAAAAAGTTT
CTATTAAAACATTTAATGGATTAACACTTTAAATATTAATAACTTAAATATGTTTGGGCT
TCTTACTCTTACGCTCGTTAGAGATTGTTTAGATTTTCTTAAGCACAGAGACTGCAAATC
TGATTATTCCCATTAGATTCATGTTTGGTCATTTGGTCTTTCATTTTCATTCAATATGTA
TTTGTTTATTTTGTACTATTTACTGTTTTTAGAGTAGTGGTTCTCAAATGGGGGCCATTT
TGTCCCGTTTGGCAATGTGTGGAGACATTTTTGCTTGTCTCATAACTGAGGGTGGAGGTG
CTAACTGGCAGCTAGTGGGTAGAAGGCCGGAATGCTGCTAAACATCCTGACATGCATAGG
ACAGCCCATAATGTCAGTAGTGTCAAGGTTGTGAAACCCTGCCTTAGAGTTTAGCAGTTT
CCAAGAATTGATTGGAAGAAATGGCTTTATTCAAGAAGTTTTATTTGGTTTAAAAATTAT
AATGTACATTATAGTTTTTAATTTTTAAAAATTACCTTAAAATTTTGGAGATAGAAAGTA
CCCATAATTCCATAATCCTGGGTCCAGTCAGTTTATAGAAAATTGTGCTTTCTGGTTTAA
AAATAAGCCCAAATTTGAGATAGTAGTTGTCTATTAATCTAGGGAAAATAACCATGTAGT
TAAGATTTCAAGAAATGGTAACACTCGAATAAAATGTATTTTGTAGAGTAACTTGAACTG
AAATTTTGTTATTTTATCTAATCATGATTTCAATTTTGATTCATCCTGCAGAGCTTTGCC
CACTTGGAAATATAGCCCTTGTCTGCTTCTACCCTTAACAGAAGTTGTTAGAGCTCCTGG
AGCGTTCCTGGAGTATTTCCTTCCCTGGGCCCTTATAAGCAAAATTATCTCCTTCCTTTT
CTCTTTGGGATCCTAACAGAACTCCTCTGCACTAACACCACCTCCCCCTAAAAAACGGGA
GGAGGAATGGAGATTTATTTTTATTTTCTGTCAGAATGTGATACCTAGTTACTATTATTA
GAGCTTCTATTTTCCCCAGTCCCCTGCTACCTTAAACAAATTTATTATGTAAACAGTTTA
GAAACAAGGTTCAAAAAGTTTTTGCTAACTTTTTACCAGTCTGCTTAAGAGAATAGAAAC
AAGATTGTATGTCTTGCCTCTTGGAGGAGAAGGGTTGGTAGGGGGCTCCTGCAAGCTTTT
TGCATTTGCGGTGACATGTTTCTTCTGAATAGGTGTAGATTCCTAGGATTGTTAATTGCT
GTTTACTTAGTGCTGTGTTTTCAAATATTTTGTGTTTGACCCTCATAAGGGAGAACAAGT
TAGCGTCTCTATTTTAAATAGCTAGGATTCTGAAACAGGTTGGGGACTAGTTTTAAGTTT
CTGATAGAGGTACGATTAGATGCTAGTGAATTTAGACCTTATTTTGAGAAATAACTTTAA
AAATTGCTCACTGCATTTGGTTCTGCATCAAATGTAACCAATTACCTCGTGTAGTCCAGA
CTTTGAGTTTTACGTGGCAGACAACTCTTCTCTTTTGTACCTCCGATAGATCCATTTTAT
TTCCCTTGACCGTTTTTCTACAGATATTTGTCAGGACACGAATCAGGTTCTCTTCAAATG
CTGCCAGGGGTCTGAAGAGGTACCCTGCAACAAACCGGTTCCTGTAAGCCTCTCTGAGGA
TCCCTGCTGCCCACTGCATTTCCAGTTGCCTCCTCAGATGTATAAGCCCGAGCAGGTACT
GTCTGTGCCAGACGATCTGGAAGCCGGCCCCATGGATCTGTACTTGAGTGCTGCTGAGCT
TCAGCCCACTGAGAGTTTACCTCTGGAGTTCAGTGATGTAAGTTAGAGAAGCTCTGCTCT
GGTTGGCCCTTGAGGCAAGGCCTTATTTATTAATGGTAAGAATAGGTTAGTTTTGTGGTC
AGGAGAGTTGATAAAAGTTTTTGAAATGATATATGTACGGTTATATTTCTATGTTAACAT
GTTGACTTAGAGACAGTTTAAATTTGCAGAAGTTTTTCTTTTTCTGTGGGAATAAGGGAA
ATTGTAAACTAAGAGAAATTGGAAAGTCAAGATTATGGTTGCATTTTGTGTAGCCAGGAA
ATGTGGTACCATCCGCAAGGTGAGTGATTCGCTAGAATCTTAATAATACAAACAAATTCT
GATATCTGTTCTTGACAGTGTAAACTTGTGCTTTGACCCTGTAGTAAGGGTTTTCATTTT
CAGATTAATGAGTCTCCTAAGAAACGACTCTAAACTTAACTCTGGCTGTGTTTCACTTTT
GATATGTTATTATGGAGTCTCTTGTGAACAGACTAGAACAACAGTGATCTCCCTAAGTAT
TTACTTTACCACCTTTTAAGTATGTACACTACCTTTTTCAGCTTGTTCCTTGATTGGTCC
CAGCCCATAAACTCATCTCTGATTTCATTTGTTTTCCTAATTAGCACTACCCTACTATTT
GACTGTAGGGATCAATTGACATTCCATCTGTCTTGGCACTTTGCTTAATCTTTAACCTTC
TGGATGAGGGTCTTCATTATTTATTCTGAAGATAAATCTTCTGAATTTCATAATAAAAGT
GTCTTGTATATAACTATGACATGTTTGAAGTGACAAATCTAAATGGAAAATTCAGTATAG
GTTGCAAGATTGTTTGCTAAGGGTAGAAGCAAGGCTTGGGTGGCCTCAGGAATATTGCTC
ATTAAAAAAGATATATCCAGACAGAGTTATAGCTGAAAAAGTGGCATTAAGAATAAACTG
ATTTCGGGGCCAGCCCAGTGGCGCAGCGGTTAATTGCGCATATTCCGCTTTGGCGGCCTG
GGGTTCGCTGGTTCGTATCCCGGGTATGGACATGGCACTGCTTGGCAAACCATGCTATGG
TAGGCATCCCACTTATAAAGTAGAGGAAGATGGGCTTGGATGTTAGCTCAGGGCCAGTCT
TCCTCAGCAAAATGAGGAGGATTGGCAGCAGTTAGCTCAGCGCTAATCTTCCTCCAAAAA
AAGAATAAACTGATTCCAATTTTTTTTTTGTATTCTCTCCACTTTTTTCTTTTGGTTATA
TACTGTCTATAGTCTTATTAAACTTTTGATTTTCATTTCTTCATTATAATAAAATTAGAA
TTTTTATTGTAATCTTGATTATATTTGCTTTTTAAAAAGTTTCTTTCACACAGATTGTAG
AATATGAGAACTAGACAGGGACCTTCGAGATTATATACTCCAGTGCTTTCCCAAACTTTT
CCAATGTGATTTTGTTGAAGAGAATAAATGAATAGATAGTCCTGGAATGATAAAGACAGA
TTTTTGTCCACTTCCCTTTATTTTACATGTGAAGAAACCCCAGAAAAGTGCTATTTTTTT
AACTTAGTTAATGCTTAGAGCCACTGCATAGGATCTAAAAAATAACCTCTAAGCACTACA
TAGCCAAACTTTCTTCAGATTTTAATGTATATATATACAGAAACTAGCATGTGTGTTTTA
TGTAGATGTACTAGGTTACTAACTTTTATTTTGTCTGTTAATTTCTAGAAGCATTTCTCT
TGCTCTTTAGAGATAACACAAAATATTAGATATTATAAGATGTGGTCGTAGGTGAAAACT
GACATTTAAGGAATCTTAATTAAAAAATATTTAAAAATATATTTTCAAATCTGTTAATCC
TTATTTGTGGCATGAATGTATGAGAAGGAACCTTATTTTTGAGGATCCAGTGGGTTTTTA
AGATGGACCTTTGTTGTTAGAGGTTTAAAAATGATGAACAATCAGATGTTAGTACTTGAT
CATCTATTATGTTCATATTAATGTACTTTTGATAAACCACATTGGTTATTAAAAAGTATA
GTTTTATTCTTAATCTTTGGAGGTAAAAATTCTCCAGAAAATGTTGAAAGAAAATCCAGT
TTTAGAAAGTTTTTGTCTTCCCACAAATTCTGGATATATTTATTATTGGGAAATTTTGTT
GGGAAAAAATCATTTCTTAATTATATGAGTTTCACCAAGCAGTCTTAACTTGTTACTTAT
GTTCTGCCTTAGATATCATTTCTTGTTAAGTTCTGGTAACTTATGGGAGCACCAGGTATC
TGATATTAGTATGGGTAAAAATTCAGCCTTTCATTCTGGATATTACACTTGCCTGTTTTC
TGTGCTTTGATCCAAGGATGTTTTGGCAAGGAACAATGTAGTACCTTAATCCTGTTACTT
TGACTTTGCTTGCTTTTTGTGTGTGTGTGGTTTTTGAGCTTTCTTTTTGAGATCAGAACA
AAATGTGGATTCTGTCTTTGTGTTCTCATGCTTATGTCTTTAAATATGCTTGTTATGATA
GGCATTTCTGCTGATCCTTTTTTCCTTTCTTATTTTAGGTTCCTTTTCTCAATTTTAATT
CCTGTAACAGACAACACTGAATATGTGTGAAAAGCCTTTTCAGTCTCTATTTTCCTTTAA
AAACATTTCTATACCATTGTTATCTTGAGACTTGGAAAGCTTTTGCCTCACTACTTAAAT
GGGTTCTTCTAAATTTCAAGTTAATTGCTTGTATAATTAATAGTTGTGCATAGTAAAAGA
ATTGGAGAAAGCAGTTCATAGTCTTAATCATGTGAGAACTCTAGTTTCTGTGGATAGTAC
AGAAGTTTCTACCACATATGAAATGGACTATAGGTAGCTGACTATCCTATGTTTCTGCCT
AAATAGAGCAGCTTTAAATCCAGTATGTTCTTTAACTATATTCTTTTCTTTACCTTAATT
ATTGTGAAGATGTGATTCTCCTTTTTGGTGATTAACACCAAAGAAAGGTAAAGCGTTTCA
CACTCTTAGACTTATTTAAAAGCATAGAACTAAGCTTCTCCTGAAGCTCAATTGCTGGAA
ACATGGAGCCTCTGTAAAGTGTATCGGGCATAGGGGAGTACAAACCCTTGGGTATTTTTC
ACTCTTGGGAAGGAGAGTTTAGCAGTAGACTCTTAGAAAGTGATGCCCTGAAAGTCATTT
TGACACATTGAGCTCTTGCAATGCTTTGGGCCCTGAATCAAGACCAGTGGTTTGCTGTAG
CTGTTGGTTTCAAACAGGAGCCAAGAGCAATGTCTTCCTGTGGTCTGTTGGCCATTCAGT
ACCCCAGTGGAATGGCCAGTTCAATTGGAAGAAACATAGACTGTAGAATATAATGTCTTT
TTTTAAGAGAGCAATTGGACTGTGTTAGGTTTAAGAACCCAAAATAGTATTTCTTAGCCA
TTCAGAGGGACTTTGAATTTTTTGTCCTTTATCTCCTTTTTTCCTCTGTCTCTCTTGCTC
ACTGGCTTGCTTTGTGGCTGTTAGGACGTTAATCAAGCAGTCTCATATTGTCCAGTCTTT
TAAGGCAATATTTCATTTTAATTTGTAATTATACTGATTGTCCATATTAGATTTACCACT
GATGAACTTAGATGTTCACTACAGTTAGTCTTAGAGGGAATATGCTTTTAATAAATATTT
CTTTATTATGGTAAAATATTTGTAATAATATTTATCATTATAACCATTTTTAAATGTACA
ATTCAGTGATGTTAAGTATATTCATAATATCATGCGACCATTATCATTCTGTTTCTAGAA
CTTTTCCGTCAGCCCAAAAAGAGACTCTAGACTCTGTACCAATTAAACTATAACTCTCAC
TTCCCCTCTCCCCCCAGCCCCTGGTGGCTACTATTAGTACTTTCTGTCTCTAAGTTTTCC
TACTTAAAAAATATACTTTTTTAAGCTGCTATAGTGGTCTGTGCTTTATACTCAGCAGCA
AGAAAAAATTCTTGGTGCTTTTGGATCGTATCCCATTTGTTGGACATTCTAAAAAAATCT
CATTTTGATTAAAAGTAGGCAAGGGATGAGGGAAGTATGGGAGAATTGCTTTGAGGTTTG
CTGAAAAATATGCCAGTTTTAGCTTATTGTTCCCTTGGTATTGCTGATAGGCTTTTTCTT
TCTTTTCCTAGGACTTGGATGTTGTGGGTGACGGTATGCAGTGCCCTCCTTCACCCTTAC
TTTTTGATCCGTCACTAACCCTTGAAGATCATTCAGTCAAAGAAATTGCTGAAGGCCCAG
TGAATATTTTGGCAAGTGAAGAACAACCCCAGCCAGGCTTCCCTCATGTAGTGACCCAGC
CAGGCAGAGTATTCCCTGTTGGTTCTGGCTAGCATGTACTCCCAGGGAGTGGGATTGTCA
TCACAATTAGACTGTAAAGGTGCCTCCAGGTGGCACTTCTCCTGGTGGACCCTTAGAGAG
AACACCCTAATGGCCCTGGTTCACATATATCTCAGAGAGCAGGACACAAATTTGTTTAGT
TAACTAGAAAATGTTGAGATGAGGAATCTAGGTAAATTGTTCGTTAAAAAAGGGTGAGTT
CAGCACTTGTTTCCATCATAGAGTAAGGACAAGTTATATGATTTGGCTTCTTTTCTGAGA
CTTGGGGTGGGATACCGGTGGCCCTGACTGAAGACCAGCAGTTATGCTATAGCTGTTGGT
TTCGAGCAGAGGCCCAAAGGACTGTCTTCCCATGATCTGTTGGCTGTTCTGGAACCTCAG
CAGAGAGTGGCTATTTCATTTGGAAGAAACATCCCACAGCTCTCCCTCCTGTTGGGAGTG
CCTCAGGAATGCTGCAAGCAGTAACTTCTGACTCCAAGGGTCAGGGATAGTTAAGTATGG
GGATGAGCAGCGACCCAGCATTATTTTATGTCTGTTGTCTTGTTCTTACTGCTCCTGTAC
ATGGGCATTGATAAGTCAGATTCATGCTTCAGCCCACAGTGAGTGGATTTGTCCCCCTAA
GTGACTTTGTTTTAACAGGGCCAGATGCAGATGGCTGGAGATGGGTGCAGATCGCAGGGA
TCTCGAAATTCTGAGAAAGCCTCTGTATCGCTGCCTCAGAGTGGAGTGGCTGCTGCAGAT
GGGAAGCCAGAACCCACTTCTATCAGTTGATAGTTTGTTTTGGGAACCATTTGACTTTGG
AGGATTTGAATTTCCCATTCTTTAAACCAGTATTTGTGACTATCTCTCACTAAAGGACAA
CCCAGACTACCTTGTTTTTCCCCTGGGTTATTGTGTGCTATAGTCAAACAAACCAAATAC
TGGGGGAAGGGACCGATAGTGTCTAAAAGTTGTGGGTGTCTTCCCATGCTGGGCAGGGAA
GCTCTAGAGAGAGAGGTGATTCCTGTCAGAGCTGCTGGGATTGGGAGTATTTGGGACTGT
GCCTAAGGGGAGAGACATCTTTGTAATGGGATTTCCTAGGTCTTGGAACAAATCCGCATA
GGTGTTTAGCTGGGAGCTGTGTACCCTTGGGATATTGATGGTCTCAATATCCAGTTATCT
CTATCTGACAGTCTGCAGTTTAGCCTTTTCTCGCCTCTCACCTAATTGGTTAATCTGAAC
CTCTCCCCCCAATGAACTCTGACCTATAACCTCTAAGAAAATAGCCCACAGGACTGGGCC
CTCCTTAACCATCCATCTTGCTTCTAACTTATGTAAATATCTGTAGTGGCTATCTTATGT
AATATTAAAATAAAAAATTATTGTATATAGTTTCTATTAAATGTTAAAATGTTATGAAAA
TGTAAAACAATCACTTGAATGCATGTTTTGTTTGTGTTTGAGAGTATATATCTATTTTTT
TGGGTCCTCAGGAAGCTATCTCTGATGGGAAAGGGAAAACAGGACAGATACACTTCCATT
CCAAGGAGTAAATACATTTTCAGTCACCTATTTTGGTTTTGGATTAGAAGATAAGATAAA
AACCTATAAGAAGTAAATGGAAAAGGGTGGGACTTCCTTATTAAAGCCTACCAGTTCCAA
ATATCTTCTTTCTACCTTCCTCTCTGTGCCCCCTACTCCTACTCCCATTTCTTTCTTACT
GTTAATGCCTGATTATCATCTCAAAATTCTCAAGTGCTAGCAATATATATATATATGTAA
AACGTCCAGAGAAATTGGGCCTGATGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1318, 2361..2539, 3059..3173, 6197..6364, 6578..6740, 7767..7863, 11723..11976, 16091..16210, 16938..17088
1068..1318, 2361..2539, 3059..3173, 6197..6364, 6578..6740, 7767..7863, 11723..11976, 16091..16156
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved