Equus_caballus Locus Q6X9Z0_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q6X9Z0_HORSE
Equus_caballus
Q6X9Z0_HORSE
6
SNORD82, SNORD20, SNORA75
1945..2014, 5630..5711, 6269..6405
8530
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGCAGTTGTCACTC
CTGGCAAAAAGGCAGCAGTTCCGCCGGCCAAGAAGACAGTTACACCAGCCAAAGCAGTAG
CAACCCCTGGCAAGAAGGGAGCCACACCAGGCAAAGCATTGGTGGCAACCCCTGGTAAGA
AAGGAGCAGCCACCCCAGCCAAGGGAGCAAAGAATGGCAAGAATGCCAAGAAAGAAGACA
GTGATGAGGAAGATGACGACGACAGTGAAGAGGATGAGGAGGACGATGAAGATGAAGATG
AGGATGAATTTGAGCCAGCAGTGATGAAAGCAGCAGCTGCTGCTGCCCCTGCCTCAGATG
ACGAGGATGATGAGGAGGAGGACGATGACGACGATGAAGACGATGAGGAGGAAGAGGAGG
AGGAGGAGGAGGATGAAGATGGTAAGGAATTCTCTTGGTGGTTTACATTCCTTTTCCTTA
AGATTTTCTTAGAACTATAGTGTTGGTTTTGGGAGAATTCTCTTGAGTTGACTAGGTGGC
TTCTCTTTCAGACTCTGAAGAAGAAGCTATGGAGACCACACCAGCTAAAGGAAAGAAAAC
TGCGAAGGCTGTTCCTGTGAAGGCCAAGAGCACAGCTGAGGATGAAGACGACGACGAGGA
TGAAGACGACGAGGAGGATGAGGAGGAAGATGATGAGGATGAGGAAGATGACGAAGAGGA
GGATGAGGACGACGAGGAGGAGGAAGAGGAAGGTAATCGGGCTAGGTTCTGAAGTACATT
GGCAGTTGTGTTAAAAAAAGGAGGCACTTGAATATTTGTGGCTACTCATGGATGACACAG
ATTGTTTGAACTCTTGTTCAGAGCCTGTCAAAGAAGCACCTGGAAAACGAAAGAAGGAAA
TGGCCAAACAGAAAGCAGCTCCCGAAGCCAAGAAGCAGAAAGTGGAAGGTACCTTGCAGA
ATGGGGGGTGGGTGTGACGCCTCATAGCACAAGTGATGAACAGCAGAGGGACTTAATGCT
GAAACGTGATGTCTCACTAGGACATGCTGATGTGCTGGGTGGAGGAATGTTCATGTTTGT
GCCACTCTTTACAGATAGACTGGATTTGAATTCATTTTTTTGTACAGCCACAGAACCAAC
TACATCTTTCAATCTCTTTGTTGGAAACCTGAACTTCAGCAAATCTGCTCCTGAATTAAA
AACGGGTATCAGTGACCTTTTTGCTAAAAATGATCTTGCTGTTGTGGACGTCAGAATTGG
TGTGTCTAGGTAAGTGAGGGGAGTCATGCTGTAGGTATTCTGCACGTTGTTCCTGGGTCT
GCTGATGCTTTTTCTCTCTTCTTAGAACCTTAGATTGCTGTGTTTAAACAGGAATATGTA
AAAGTACTTTAAGATTAGACATTAACAGATTATCGTTAGGTTATCTAATTGGAAAGCCTC
AAATTGGAATTTCCATAATCTCACTTACTTTTTGATAAAGCACAAAGTAACTTTTAGTAA
GTTATGAGATTTGATGCTTATTCTTAGGAGTCTCTAAAACTGTTAGACTTAGGGAGCCAT
AGTAGTGAGTGCTTTCAGCCAGACAGGATTCTCTTAGTGCCTAAACGGGTTCTTCTGTCA
GCTCCGACTGTCAATTGTTAATGAGCCATGCAGCTCATAGAGACCTCAGGGTGAACTTGA
ATCAGGTCTTGGTGCTTAGGCCTCGCTCTGTAGCCGCAGCTTATAGAGCCTTTCCGTTGG
TGCTGAAGGTGCTCTTTTTCTTAGTCTTTGTTTGTACTATCACGTTAGTGTTGCCAGTTG
CCCAGAATACCTGTTATGTGGCTCTCGGGGTTTTTCTCCACCTATAATTTTGCCTTTTTC
ACCTGGTCGCCTAAAGGAAGTTTGGCTATGTGGATTTCGAATCTGCTGAAGACCTGGAAA
AAGCCTTGGAACTCACCGGTTTAAAAGTCTTTGGCAATGAAATTAAACTAGAAAAACCAA
AGGGAAAAGACAGTAAGAAAGGTATGTAAGGCTTTAGGTAATTGTGATATTGATAGGTAA
CTTGTTAATGGATATGTATCTAGTCTAATGTATACTCAGGAGCTAGTTGGCCGGGGTAAA
TAGTTTAACGTTATCCCTTTTGTTTCTTCATAATGTTGTGAGGATTACGTGAATTAGAAT
GTTAAATGTGTACAGCGGTACCTGGTATTGGCTTGCTGGTCTTAAAAGTTCCAGTGTCAG
GTAAGCAAGAGTAGAACTGGTTAGAAGTACCTCAATTAACGGAGAGGTCTTTCCTCTCTT
TGATCCCTAATTATTCTTTTTGTATCCTTTACCTTTTCTCTTATACTTCTCATGTTGTAG
AGTATGTGATTTTTTTTTTTTTTAATTTAAAAATACTGAGGGCCAGCCTGGTGGCGCAAC
AGTTAAGCGTACGTGTTGCGCTTTGGAGGCCCAGGGTTGGCCGGTTCGGATCCCGGGTGC
GGACATGGCACCGCTTGGCAAGCCATGCTGTGGCAAGGATCCCACATAGAAAGTAGAGGA
AGATGAGCCTGGATGTTAGCTCAGGGCTAATCTTCCTCAAAAAAAAAATTGAGCACCTAC
TGTAGGTTGAGCTCTTCCAAGTATGCAGCACATAGTTTTCTGTCATTGGGACATTAACTT
GTGTTTTGCCACGGCTTTATCTCCATACTAGCAGAGTGCCTTATACATTATAGGATTTCA
AATTATTTCTTGAATGGAACTTTTCCCTTGGTCAGTTTTTGTTGGTCTTTGGGAGAGGGA
TCTTTTAAACCATCCAGTTCATTTTGTGTGTTTTTTATGTAGATCGGGATGCCAGGACAC
TTTTGGCTAAAAATCTGCCTTACAAAGTTACTCAGGATGAATTAAAAGAAGTGTTTGAAG
ATGCTCTGGAGATCAGATTAGTCAGCAAGGATGGAAAGAGTAAAGGGTACGTTAATATGT
CTACTGGAATATTAAGAGTTGCATTAAAATCAGTGCACTTTGATTTATAAAAGAAATGTT
GATCCAGTTTTCCTAGGTATGTGGTTTTGGGCAAAGTAACCTTTAACCTATGCCTTAAAT
TTCCAAATCTGTCATGTGGGAATAGTGTATTTAATTCATGGAGTGGTTTTTAAAGTGAGC
TGACAGAATCTGCCTAGCTTATGTAAATGCCTTATGAGTGATAGCTGTTACGCAGTGAGA
TGGGATTACCAGGAGCGGATTTCCTAGGTATTTGGCAGACTTTGTTTACAACAAAGTTTT
AATTGAAAAGTGGAAGATGGCAGAAACTTAATCTTTCAGTTAGTATACACCAAAGGGTGT
TTTTCTTATACTTAGACCTGAAACAAGGTCATGTTGAGAGTAAAACCTTGATGTTAAAGA
ATTAATATGGTTTTAAAAATCGTGTGAGTTCTTAACGTTTTTTTCTATTGCAGGATTGCT
TATATTGAATTTAAAACAGAAGCTGATGCAGAGAAAACCTTGGAAGAAAAGCAGGGAACA
GAGATAGATGGACGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAGTCAAGAC
TACAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAGAATTTACAGGCTCCCTTCAGGATT
CTAGGATTGATAGAGAAAAATCCGTTGCATCTTTGTACTTCATAAGTTGATTAATTTGCT
GTAGATCAAGCAGATTATACTTCTGTTTGTGATAGTAATTCAGTATCCTGAATAAGAGCT
ATATGAAATCCTTTAGCATTGGAACATAGGTAAATCTAGCTTCCTTTGTATGTACGTTTT
ATACTTTGAATGGCTTTAGATCATGTATGTTTCTAAATTAGAATATTGTTCTAGGAAGAC
ATGGCTTGGTAGTCGGGTTTACACATCTGAACAACAGGAAGGAAAGGAAGCTGGACATAA
TACATAAGTGCTCAATATGTTGAGTGACAGGTGCGATTTCACCTGCCTCAACATTGGCAT
ATTAACTCTCCCAAGCACAGTAGTTCTTAGAAACAAGATACTGCTGTAACTGAGGTTGCA
GTCAGTGTTTCACTGATCTCTTTATTTGCAGGTGAATCAAAAACTCTGGTTTTAAGCAAC
CTCTCCTATAATGCAACTGAAGAAACTCTTCAGGAAGTATTTGAGAAGGCAACTTTTATC
AAAGTGCCCCAGAACCAAAACGGCAAATCTAAAGGGTAAAGATAATTAGTCTCTATGTTG
TCAGTCATGGGCTGTGAATGTCTTGCGTAGATCTAAAAAAAGGTAAAATTGTGTGTTCCT
GGTTGTTAGAATCTGCATCATTTTAGCTACACCATTCAGTATAAATAAAGAGCATCATTT
AAGTCTCTGCTTGAGGAAAAAAGTCTTGGTGGCAATCAAGTATGACAGGAGACCTGTGGT
TGGTAACTTATTCTAAGAATTAACTCTTCATCCTCAGGTATGCATTTATAGAATTTGCTT
CATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAG
CAATCAGGCTGGAGTTGCAAGGACCGAGGGGATCACCTAATGCAAGAAGCCGTAAGTCAC
TGTTCACAGGGTGCTGTGTTTGGGGGTGAGCACTGAGTGCTGGGCTTAAACTTTTTATGT
CGAACCTAGAGATGAACATTTGGTATTTGTTGCTGCTGAGTGAATGATACTGGACATGAT
GACTATGATTATCTGAGAAATTATTGATGAAATCTCAAGAAAATTCCTCTAGATAGTCAA
GTTCTGATCCAGCTGTGTCGGCTCGAAGCAGCAAATTAGCCTGATATCACTGCCCTGTAT
GGTGGTCTTGGCTGCCTGCTTTAGTACTGTCCCGCTTGTTTAGGTTGCTGCTTTTGTTTT
CCGTGAAGGATTTGAGACAGGATTTTAACTTCTCTGGCAATCAGTGCAAACTTGAGAGGG
CAGTGCTCTAAGCCCTTTGCCTTAATTAAGCACTAGTTGGCTAAGTTGCTTTTACCTACT
TTTTCCCACATAGGCATTTAAAGTGAAAGGCTAGCTTCTGCTAAGATGAGTATTCTTGAC
CAGTACTCATCCTGGATAGTAAAGAAATGCAGCATCTGGTCATTATGAATTGTGACTTTA
AAGGTACAATTTTTATTTATCTTCTCCAGAGCCATCCAAAACTCTGTTTGTCAAAGGGCT
GTCTGAGGATACCACAGAAGAGACATTGAAGGAGTCGTTTGACGGCTCTATTCGTGCAAG
AATAGTCACTGACCGGGAGACCGGATCCTCCAAAGGGTAAGATGCAGGAAGTGTACAGTG
CCCGCTCTGTGGCACCTCCCACCTAACTTGTCTTCTCATTGAGCTCCTTTCTGTCAATTG
GTGGCAGTTTATGGATTCGCACGAGAAGAAGAGACAATTCACAGAACTAGCATTATTTTG
CCTTCTGTCTTCGCGGAGGTGTATTCTGCTGTTTTGTGAGACATTCTGGGATTCAAGCTG
TCAGTAAAACCAGTTTCAGCTTTCCATGGGGGACTGCTCACTACTGGGGAATTTCTCAGT
TAAGCAAGGCTACTTTCCGTGGGATCACTACCCAGCATTTGAGGTTAACTGTGGCACTTG
TTCCGTGTGTGTGTGTGCTGTATGATGGGCCCTTTCATTTGGTGTTGTAGGTTTGGTTTT
GTAGACTTCAACAGTGAAGAAGACGCCAAAGCCGCCAAGGAGGCTATGGAAGATGGTGAA
ATTGATGGAAACAAAGTTACTTTGGACTGGGCCAAGCCTAAGGGCGAAGGTGGATTTGGG
GGCCGTGGTGGAGGCAGAGGCGGCTTTGGAGGCCGAGGTGGTGGCAGAGGAGGCCGAGGT
GGATTCGGCGGCAGAGGCGGGGGAGGCTTTGGAGGTAAGGACAACGAGGGGGAAACCTCA
GTGTCTGCGCTGGACACTGCATGGCACATGCACTTCATCCTGTGCAGGGCCAGGGTTCCC
TGCATCAGTCCCCAAGTTGTCATTGATCACTGGGGAGGAGAGGAGGACTGGCAGCCTTGC
ACCCATTCTTTTTCATGAGGATTGGCCCTGAGCTAACATCTGTGCCCATCTTCCTCTATT
TTGTATGTGGGACGCCTGCCACAGCACGGCTTGATGAGTGTTGTGTAGGTCCGTGCCTGG
GATGTGAACTCACAAACTCTGGGCTGCCAAAGTGGAGCACACAAACTTAACCACTACACC
ACTGGGCTAATTCCCTTGCACCTCTCTTAATTGTTGCTTTTTGCAGGGCGAGGAGGCTTC
CGAGGAGGCAGAGGAGGAGGAGGAGACCACAAGCCACAAGGAAAGAAGACGAAGTTTGAA
TAGTTTCTTCTGTCCCTATGTCTTTCCCTCTTCATTTGAAAGAAAGGACTCTGGGGTTTT
TACTCTGTTACCTGATCACTGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACAGTC
CTGTGGTCTACTTGGAAAGCCGTATAGATAACATTTCAAGGGAGATACCCTGTTGGTTTT
GACTGGATATTCGTATAAACTTTTTAAAGAGATGAGTGATAGAGCTAACCCTTATCTATA
AGTTTTGAATTTATATTGTTTCTTCCCTTGTACAAAACCATTTTTTTCCTACGAATAGTT
TTGTTTGTTTTTTTGCGTTGGGGGGGGTTGTAAAGGAAAGCAGAATGTTTTATCATGATT
TTTGCTTCAGCAACTTTGGGACAAATTAAAAGTCCTAAACTCTGGTGCCAGCCTTGTACT
TCCTAGAGTGTTTCTCCTGGAATATCACTGAAGGTGGAGCATGGCAAAGCCAGCCCTGCC
ACTCCAGGTCCACCCCACCCCTGATGGAAATGCTTGATGCCTTGGTTTCAAATATCCCAG
CCACAAGTTTTGGCGAAATGGCCAATGAGGCGACGAGCTGAATTTCTGCAGCCCTGTGTG
TGTTGCAACACTTGAAAGCCTTGTTGGAAGTCTGCTGTGGCTTCTGCTTGGAAAGGGCCT
GAAAAAGTGCTATGCAAAGAGGGGCAGGAGCACATTGATCAGACGTCCTTAGTCGTGCAG
CCAAGAGCATGGACTCTGGAATTGGCAATGACTAACGAATAAAGTTCACGCTGGATGAAT
GGACACATGGGGGCTGGGGAGGAAATGACCAATACTATGGACAGAGTTGCTATTTTTTTT
TTTTTTTTGTAAATCCTCCAGCAGCCTTGGGTTCAACTGACAGGCCTTTGATTTGCACTG
TGGATGGTGCTCAGGCACTGTATCTGGTTTCTTAGACAATCCCTGCTTCCCCACCTCTTA
TAATAAAAGTTAAAGGCCACATGAGAGGTCTAGGTCAAGGGATTTTTAACATTGTGCTAG
GGTTAGTTGAAAAACTGCCCCAGATGGTGCAGAGCTGAGGTTTTTGTACATTGGCAGTGA
AGTCCACAAGCTTGTGGACTGTTAACTGCCTGTTCTAATTAAACTAGTCAAAGTACCAAA
TCAAAATAAAGTGCTGGTAGAATTCTGTAAACTGAGAAGGCGTGTGAAGGATGCAGTGGG
TTGTGTAGTTTCTTTCTGGTTGTGAGTTTGACTAGTGGGGCGAGGATATTTAAGCTTTGT
GCATATCACCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1400, 1511..1711, 1821..1907, 2087..2228, 2836..2960, 3762..3885, 4373..4530, 5011..5134, 5377..5510, 6089..6215, 6590..6813, 7186..7530
1001..1400, 1511..1711, 1821..1907, 2087..2228, 2836..2960, 3762..3885, 4373..4530, 5011..5134, 5377..5510, 6089..6215, 6590..6813, 7186..7259
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved