Equus_caballus Locus WDR69
snOPY snoRNA Orthological Gene Database
Equus_caballus WDR69
Equus_caballus
WDR69
6
SNORA25
13057..13167
40431
GATACAGGAATTGCTTCAGTTTGGGAAATTCCGACTTAGGGACTTAGGTCAAATTCCTT
AAAGGAAACTGACAATCTGGCTAGCTGACTCTACCCGTCCACAGTCTTCTTGTTGGAAAC
TAGGCTTGGCAGGCAAAGAACCGATGCTGGCAAGAAATAGAACAGGGCAAAAGAAGGCCT
CGAAAGCCTTAAACACATGGTTGAGAGCACAGGGTTGGGCTTCGGGAATACAGGCTTCTG
ACATATCTGCCTTCTCTTCCGGCCCCCACTCATTAGGCTGCGACCTGGGAGGAGTTCTTC
ACTTTCTCTGTTCCTCAGTTGTCTCGTCCTGGAGATGGAGGTGATATTAAATGGTGCATA
ATTCATACCTCCGTTAGGACTCTACGAGCACAGATGCATAAAGCACTTAGCAGAGTGTAT
GACACAGCGTCAGGAAACGTAGGCTATTACGTTGTCATTTTTCTTTCGTGGGGGCAGGTA
CACGGCATGAGGAGGGGCCGGGCTTGGTAACCCGGAGAGGGATTTTTCTTCCATCTGTCC
ATATTGGAAATCCAGTAGGCTAACCTGGGCGCACTCCAGGTGATGGCCGAGGCCAGCGGT
CCTCGGCCGCGCCTCCGCCCCTTGTGAGGTCACCCTTACTGAGGACACGATGGGACCTAG
TCCCTGCTCACTCCTGGCACCCAGGGGTGCAGATTCGGGCCGCGGGAGCGCTTTTCTGGC
GCCGCGCCCTGGAGTCCCCGCCCGGCCATGGGAACCCCGAGGCAGATGCGGGTGGCGGCG
GGGGCTGGGCGCGCTTACCGCTCGCTCCTTGCTGGGTCTGGGACCGGCGCCTGTGCGCCC
CTGGCCGCCCGCCCAGCAGAAGGCATACCCCTAGCTCGCCCTGCGAACTCCGCGCCCCGG
GAGCCGGCAGAGGCGTCCGCGCATGCGCACGCGTGCCCCGCCGCTGTTTGGCCGTTTCCA
TGGCTACGAAGCCTGTTGGCTGGGGGTCCACCAGCGAGAAAATGAAGCTCAAGAGCCTCC
TGCTCCGGTATTACCCGCCAGGTACCGGCTGGGCCCCCGCCGCCCTCACGTGGGGCCCTG
GAGTCTGGCACTGGGCACGGTCTGGGCTGGAGGAGGGTGCGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGTAGTTTTAGAGTAGGATAAACTTACCTAGTTCCCTTATTGCATGGGGAAAGGAGGA
CAGGGTCACCTTAGAGAATAAGCCAGGTCCCCTGGTCACTCAACTTGTTAAGGACAGAAA
TAGGATCAGAACTCTTGGCTTCTAGTTCAGAGCTCACTTTAAAAATAAGAAGAATATGCG
ATAAAAAGTGTGCAAAACTTGCCACAAAGCAGTAGATGACCAAATATACTGGCCCAGTGA
AAAGTTTGGGCCTCCCAGCAAGAATGAGCGTGGACAGCAACTTTCTCGAGTGTGAAGTTA
ACATTCGTAGTAAAGACACTCATTTTCTCCTTCTTAGAATTCCAATTAAAATAACATGAA
AAAGGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCACGCGCTCCGCTGCAGGCGGCCCAG
TGTTTCGTTGATTTGAATCCTGGGCGCGGACATGGCACTGCTCATCAAACCACGCTGAGG
CAGCGTCCCACATGCCACAACTAGAGGGACCCACAACGAAGAATATACAACTATGTACCG
GGGGGGCTTTGGGGAGAAAAAGGAAAAAAAATAAATAAAATCTTTAAAATAACATGACAA
GGCTCTAGATATGAGCGATAGTATATAGGAAAATTTAAGTTAAGATTAATAGCTTGTTCT
CTTGAAGCATTCCACAACTTTACTTTGGCTATGCTTGCTGGTAGGTGGGGCTGGTTCCCG
TAAGTAGATTGATAAGTGATTGTCTTGCTTTCGGCTCTTTACTGTGGAGTGCAGGTTAAG
AATAGGAGCTCTGAGATCATACTCACTGACTCTTACTATATAAAAATTTTCTAATCTGGG
AGTATGTTTTGATCTGTCAAGCCACGAGTCAGATAGTCTGACTCACTATCTACTGATCCT
TTCCAGCTACTTTCCCACTTGTCTCCTTCCCTTCAGAGTAAACCTCTTTGAAAGAATGTT
GCCCCCAATTTCTCTTCTCCCTGTGTCTTGAACTCCTATCATGTTCTCACCCTCCACTGA
AACTGCTCTTTTCAAGATCTCCAGTGACCTCCAACATTGCTGAATCCACTGGCTGCATCT
CAGTCCTTGTCTGTCTTGACCTGACAGTGGCATTCGAACCATTTGATCACTCTGCCCTCC
TTTGGCTCCCAGGACACATACTCTGTTCTTTCTTCTGCCTCACTGTCACTCCTTCTCAGT
CCATCTTGTTGGCTTCTCTTCTTCTTTTTGATCTTAATGTTGGAGTGTCCCAGAGCTCCA
TCCTTGGACTTCTCTTCTCTGTCTATACTCATTTGCTAGGTGATCTCACATATTCTCAAG
GCTCAAAACCACCCTGAGGAGTCCTGAGTACCTAACTGCCTGCCTAATTCTTTGTTCGGG
TGTCCAATGTGCATCCCACATGGGGCCTCCTGTGGTTTCCCTCGTCTCAGTCAAGGGCGG
CTCCATTCCTCCGCTTGCTCATGCTGGAACCTTGGACTCATCTTTTTCTCCTTTCTTGCA
CACTCCACATTCGGTCCAGTAATAAATCCTGCCAGCTCACCTTCAAAAAGTATACCGAAT
CCGGCAACTTCCTCCCACAAGCACGGCTACTGGTCCTCTTTATTGCTAGAGCTTTCCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCATGATCTCCAAGGCCCTGC
AGGATCTGGCCCAACATTTGCCTCTCTGCCTTCACTCTGCTTCCCCTTCCAGCAATTCTC
TTCTTTTTGGTGTTCCTGGATGGGCCTAGCATGCCCCCATACAGGGTCTTGGCAGTTGCT
GTTCCTTTTGCCTGGAATAGTCATCCCCTGTGCATCTGCATAGCCAGCACTCTCACATGT
TTTAGCTCTTTTCTCAAAAGTAAGTAAAGTGAAACTTCCATTTCCAACTTCTCAAGATAT
TTCATAGCCTCCTTCTCTGCTTTGTCTTGTCTTAGCACTATCTCAATTTAACATACCATC
ATTTTACTTATTTATCTTGCTCAGTCTCCCCCACAAGAAGAAAACCATCATGAGGGCAGG
GACTTTGTCTGTTTTGTTTCCTATATCTCTAGCACCTAGAGTAGAGCCTCGTGCATAAAT
AGACACTCACGTATTTGTTGGATAAATGAGTGAGTTTAATGAGATGATGTGTGTTAAGTA
TAATGCCTGGAAGTCTTCCTGAAATGTGAACGGGTCTGATAGGTGATCTCTGAGGTCTGC
ACCAGCTCTAAAAGTCCAGGGATCTAATAGCAATCTTAGATTCAAGTAAGGCTTTACACT
CATGCTTGTGACCTTTGCCTTAATGATTCTATTATGATGAAATCATATCACTTAGCATCT
TAGACACTTAATTTCTGAATGCCAATCTTTGAGGAGCCATATATTAAATGCAAGTTTCCA
AGGTACTACTGAATAGCAGATGAGTGTTGCAATAACATGATCAAATAGGAAAAAAATCTC
TCATCACTGAATCATTCCCATGCTGCCTTTATCACTTCTGGCTGTAAAGCAATTTGGTTT
CGCCTCCTAATCCTCTAATTTCAGTCCTCCCACTTTCTTTTGAATAATGTATAGGTCAGG
AGCGTTCTCTTGTTGGCATCTCTACTTAAATTCCTGATGACTAAAGGTACCTAGCAGTAA
TATGGCTAATCAGACATGGGCATTCTCTTTTTATCTTGGTCACATTCATTAAGGCATAAG
CTCTTCCAGTGGTGTACAGAGTAGGTGTTGAATACATGCTTTTCCACTGACTCAGTTATG
ACAGTTTTTGTCTTTTATTTACTGTGTGCAGGCCCCTAGTTTTTTGGCCAGAAGAAGGAA
CTAAGTAAACATTAATTAAACCGGTTAATATTCTCAGCACTTTAAAGATTTCTGTTGGTT
GGATATGATCTGAGCAAGGAGTACTCATATCTTTTGAAGCTTAGCCTTTTAGTACATTGT
GGAATTTTGGGGGTAGTGGCTTTTTACCTGAGTGTTTGCGGAATTATTCTTATGGCGTAA
TAATTGCAACCAGGGAAGATCAAGAATTTAAGATACTGTGGGAAACAATCGCTGAAGAAC
AGCGTGTATTCTTGGGAGCATCTTTGTGTATTTTCTGCTTGTATCCTTCACTGCAAACGT
CTCAGCCTCTTGTTCATATTGAAGCTCAGTGAGCATAGGAGGGGTGAGCTTGTTGCCATG
ATGTTTTGTCCCAGTGAAAAAATCAGACATACGTGTTTCCAATTTTGCACTTTATTTTCT
AGATCCATTTGTGTAGTCACCTAACTAATTTTTATCAGTCAACTTAAAGACTTTCAGCAT
TTTTCATTTTGTTAGAAACAAGATAGTTGTGAATAAAGAAAGCACAACTTTGTGAATTTG
TTTAACGCATTTCTTTAGGCTATTAGATTATGCTGTGTGGGCTGTCAAGTGCTAATTCTT
TCCAACCGTTCCCTGAGTTACAGATTATGATTCTATTACTTACTTCTTGTTTTATCATTT
ACTTAACTATTTATTGACTGCCAACTTTCTTCAATAATAAATGGTGCATCTTGAGTACCC
TTATATATAATGCAAAAACTTAAAGTTACAGAGCAGGAGAGAAACAGTCCTTGGTGATAA
TGATGCCTTAAATTGATAGAAACTTTGTATGTTTCAAAGTACTGTATCTTACTTGAGTAC
TCAAATAACCTTATGGGGATCTTGATCTTCGAGAGTTTATATTCTAAGAACGTTGATCCC
TATCATTTTCCTCCATGTTCTTATTTTTCTCTTACTTTTTTTCATTATGAAAGTGATATC
TACTTATAACCAAATTTTGAAAAATACATAAAAGGATAGTTAAGATCACCCTCAATTCAC
TGAAGGTGCGGCGGCCCCTTGTAAGGAGCCACCACCCAAGTCCACCAACAGTAAGTGAGC
ATGCCTGTTTCCTCAACCTTGCTAATATTATTATCAGTCTTTTGTAATCTTTGCTAATCT
GATGGGTAAAAATTGTATCTGTTATTTTATTTTGTATTTCTTATTAATGAAATTGGGAGC
ATTTCATTTTTTTCTGTTTATTGATCATTCTCTTTCTTTGTTTGAAAATTGACTCTTCAT
GACTTTTGTCCGTTTTCTTTTTTAAAATCATTTTTAGAATTCTTTATATTACCTTTTTTA
TGCTTTGTGTTTATAGTTGAAATTTTTTTTGCTGGTTATCATTTGCCTTTAACTTTGTGG
CATCATTTACTATGTAGAAACTTAAAATTTGCTTCAGACAAATCCGTCGGTTTTTTCTTT
TTTAGCTGTTGAGTTTCACATCATGCTTAAAAAGCCAATTACAAGCACCAAGATATAAAT
ATGTTCTATTATTTAACCATTTCATATTTTATTTTTAATATTAAAATCTCTGATCAGCCT
AGAATATATTTTTGTACATTGTGTGGTAGAAATTCAATTTTATTTATTCTTCCAAATCCA
ACTGATTATTATATCATTATTTATTGAATAATCTAGTCTTTCTCCATTGATCTGAAATAC
TACCTTCAAATCATTTTAAAATTTGCATATATAGGTAATTCTATTTTATGGATATAGTTT
TGTATCAGAACCACACTTTATTGTTTTATAGTCTGTTCTACTATTTGGTAAGTTTTCAAA
TTCCAAAAAGTAAAATCTTTATAATTGCTTGAACTCCATAGATTAATTTGACATCTTTGC
AATATTGAGTTTTCTCATCTAGAATTGTGTCTCTCCATTTATCACAATTTTCTTTTATAT
ACAGAAGTACAGCTGGGTCTTACACATTTCTTGTTAATTTTATGTTTAGGTATTCAATGC
AATTCTAAATGTGATCTTTCCTTTAATTGAATCTTCCCTTGCCAATGTATCTATTTAATA
TCTACTTCCAATTCTAGCTTTTTGTATTCTGTTTATCTTTGTAAACCCCGTTAAATCCTT
TCAACAACATGTGGGATATAAGTAGGTTTTTAAACAGATTTTAACAATGTTGTAAGATCT
GTATTTTGCTGGAAAGTTTAATGTGGCACAAGGAGCCTATTTTCACTCTAAGGAAATAAG
AACAGTATTTACAGGCGTTGGCTCTCCAACCACTCTTTTTTTCTTTGTAAGTTTGCTTCT
TAGACTAAAATTTGGCTTCAAGTCTTTGATATAAAAGAATTACTTTTAGGGGGAAAAAAG
CAAAACAAAACTACGTCAAACTAGTCTCTTAATTACAGTCATTTGCCTACTGTGTCATGG
TGTTCTGGGCAGTTTTGTTGAGTCATTAAAAGCATTTAGATCTAGATTTTTCTGTTCTAA
AACGCCATACGTCCTTACGTAACAGCTGCTTGCGTTCCCTGCTTAGGTTGTGCCAACTCA
GTCCAGGGAAACTGTGTTGAGATGAATTCCTTCCAAGATTGTAGTTGTGCAGCTGGGTGA
GTGGTGATGTCCAACACTGAGAAAGAAACTCTGGAGGAGAAGCAGGATTGAAGGGAAAGA
TCCTGATCTTGTTTGAGGTGCAGGTGAGACATCTCCATGTCTGAGTCTCAGAGGAGGTCC
AGCGTGGAGAGTTACAGGTGATAATTGTTGGCATATTGATGGTAATTAAAGCCATGGGTG
TGCGTAAATTTATATAGGGAAAAAGTGTGAAGTGAGAAGGGAAGAAGTCCTAGACTTGAA
CCCTAAAGACCAGCAGTATTTGAGGTCAGGCAGAAGAGGAGGAACCAGTACAGGGGGGTA
AGAAGTAGCAGAGAGGAGAAAAAGATGGAGCGATTGAGAGATTTCGTAAAACCCTATAGA
GGATAGTATTTGAGGAAAGAGGGAGTTGGTCATTTTGTCAATTATTTCTGAAAGGCCACA
TGTTGTAAAGACAGGGAATGTCAATTGCATTATGCAATCTGAGGACACTCATCCAATCAC
CTACCAGTTATTTCACGTATTCAACAAGCCCTGTATGGACATTTCCTGTGTACCAAACTT
CATGGTAGGCATGAGGGATAAAGAGGAGGTGGACCCAGGAGCACACAGTCGAGTGAGTCA
GTCGTTGCTAGAAGAGAAAGTCGAAGGAGTGTGAAGACAGTGGGGAGGCACAAGCCCCGC
TGGGGGAGAAATGGAAGCCAGAGAGGGAAGTTGTAAGTATTGTCCATTTGACTGTGTTGC
TTGTACTTGAACCTGGCCAAGTCATAAGCCTACTGTGCATAAATCAGTATGACTCATTCT
GAAGAGGGTCCTCCTGGGAGTATAGAGAAGCATATGTTTTCTTCTCTTAAAGACATTACA
ATCTCACTGGGGAGAGAAGTCAGATGCGATTATAAGTAATACAAGGTGACCATTAGGCTA
TGTCACAGGGTAGTATTTGCTTCATAGCTAGATAATAAGCACTATTCAATGAGACTTTCT
ACATGCCAGGTGCTTTATATACACATTATTTAATCTCAAGCAGCAAACTGAAGGTATTAT
CCACAGATGAGAAAACTGAGATATAAAGAGATTGCTTTCCTAGTATCATGAAATAAGTAA
GGAGTTGAGCTGGAACTCAAACTTGGATGTGTTTGATGCCAAGTACATGCCTTTTCAACT
CTGCCACATTCTATCTCAATGGTTCAGTGCTTTTGAAAAGTATACAGTGTTTTGTTAGAA
TTTCTTATTTTCTCTTTTACTGGAATACTACTGGAATCGTATCTGTTATATCAAATTACG
GTCTATAGCCATAATTCTCAAATTATAGGGGGACCCCTGGGGGCCCTTGGGTTCTTTCAG
TGGGGCCTCAAGGTCAAATCTCTGCATAATAACAGTAAGGTATCATTTGCTTTTTTCGCT
ATATTGACATTTGTACTAATGGTGCAAAAGCACTGGAGAGTGAAACTGCTGGTGCCTTAC
CAGAAATCAAGGCAGTGGCACCAACTCTAATAGTAGTCATTGTATTCCTCCCTGACACAC
ACTTGCAATAGGAAAAAAGCCCTTCAGTTTCATTTAAGAATGTCCTTGATGATGCAATAA
AGCTTACTAATGTAGTAAAATGCTGACATATGAGGACATGCATGCTGAGTAATGAAACAG
GAAATACTCGTAGGTCACTTCAGCACAGTGATGTACGATAGTTGTCTTAAGGAAAGCACT
TGGGCAATTTTTTGAGTTGAGAGATGAACTAGCTGTTTTTTTCATGGAACACCATTTTTC
CTTGAAAGGCTGACTGAGAAACAAACATGATTTTCAGACTTGGACATTTGGCAGGCATTT
TCTTGAAAATGAGCAAAGCGAGCCTGAAACTTTCAAGAAAAACTATCAGAATTTCTTGCC
AGTGATAAAATTTGAGCTTTCAAGCAAAAATTAGAATTTTGGTGAACTTATATCTACCAC
CATGAGCTTGACAGCTAACTGACAGTAAAAGAGTTTTCTGATGATAGATATTGGTAGTGA
TATTAACAAAGGCGATTCTTTGGACATTGTCCTATGAACTATGTCAACATTTGGAAGATA
TGCATAATTCAGTAAACTGATATTTTTCAAACGTCTTGTGCATGATGTTATAAATCATAT
GTAGGTAAAATATCCTTTGAAAGTGTGAGATAGACCAATGGGTTTTAATGTAACAGAGTA
TGAAGAGTTCATTGATGTGTCTTCAGATTCTATATTGCAATCAATCTTTATGAAAGTACC
ATTTTTTAAGTTTTAATGTAGTATCAAAGACGATTATCCATAATTATCTGAAAAGGCAAT
TAAAATATTCCTTCATTTTTCCAGCTGTATATGACCAGATTTCTTCTTTAGACTTCATCC
AAAGCAACATATAGCAACAGCTTGAATGTGGAAGCAGAGATGAGAATCCAGCTGTCTTTA
AGCCAGATATTAAAGAGATTTGCGAAGCATAAACCAGTGCTACTCTTCTTACAAATTTTT
TGTTTTGGGAAATATAATGGTTTCTATAAAATATATTACTTATGTTAACATAATAATAAA
CTATGTTTATTATTGCTATTTAAATTTGTTTTTTAAAAAAACCTCAATTTTAATATGGAA
AATGTTGCAAAAACAAAAACTCTGGTGTCCTCAATGATTTAGAGACTGTGAAGTGGTCCT
GAGGCCAAAACTTTTGAGACCCACTGGTCCATATTCAAGATCGCTGATTCTATCCTTTAT
CATCTCCACTGTACTATTGAGCCTATTCAAGTTTTTCATTTTGCTTGTTGTATTTTTTCA
GTTCTGTAATTCCCATTGGGTTTGTTTTAATAACTTCTATTTATTTTCTGAGATTTTTCA
TTTGTTTCAAGTGAATTTGTAAATGACTGCTGAAACGTTTTTGTGGCACCTCCTTTAAAA
TCCTTGTCAGATAATTCCAGCATCTCATTCATCTCTGTCTTTGTATTTGTTGATTGTCTT
TCTCTGGTTCTTGGTCTGATGGATGATTTTTTCTTTTACTGTCTGGGTATTGGGGTTCAT
TGATTGTATTTTCTCGTTTCTTGTATCCTGGACATTTTGGTTATTATGTTAGGAGATTCT
TGATCCTATCTAAATCTGTTTTGGCAGGCTGTGCCCATGTTTAGATTTAGCATATATGTT
CTGGTCCACTTTTGTGGGCTTTAATTCCAATGGCAGTTTAGTTTTCTGAGTCCTTGCAAT
GTTATTCTGGTCTGCTTCGTTTTTCTGGTGTTGCTGAGCTTCCTGCTTAGTCCCTGCTGG
TGCCACCTGCGGGGGAAGAAGGTACTTTCACAGTTTGCCTGCTCTCACTGGGTGACCTCC
TTGGGGTGGGGGACAGGCCCTTGGGCCTGGTTATGCCACCGGTGGAAAGGCAGGGAGACA
ATACTGCTTCAGTGCCTGTTTGGTGGAGTGGGGTCTGGGACATCCCAGGACTTCACTGCT
GTCCCTTTTGTGGGTGGATGGGACTGCCCGCTAATGGCTCCATTGTGCAGTGGGGTCTGG
GAGATCCTGGGACTTCGCTGACACTGCTCTAGGCTGATCAGATGGCCCACTGGGGGCCCA
GCTGATAAGCAGGGCTTGAGAAGGTCTGGGGCTTTACTGTTGCAGCTGCTACAGGCAGAT
CAGACTGCTGCTGGGGCCCAGCTTTGCAGTGGGGACAGGGACAGCCCCGAGCTTCCACTG
GTGGGTTGGACGGTCCGCAGGGGCCCTAGTTGTGGAGTAGGGTTTAGGGCTCCTCATGAC
TTTTTTTTGACTTTCCTTTTCCTGGCCCTTCGGCCACAGAAAGCAAGCTTTGTTATTTGT
TTTTGGTTTTAGTTGCCTATGCTTTTTGGTGCTTCCAGGCCCCTCTGGTCCCCAGTTTGG
GGTATATGGGAGATAAGAGAAAACCCAGGGCACTCAGCACGTTGTCATTTCTTAAGTCCT
GAGGTCTCTAGCCAGTCTACCTTCTTCTATGCAACTTTCAATTATTTTAGCATTGTCTGT
TGAATCATTTCAAAGATGTTTGGTTGTATTTAGAGGAAGGACCAGAGAAAAGTGAGTCTA
CACAATCTTGTTTTAAAATCAGATATCACTGCATATGTTTTATGTTGAAAAATGAAGAAA
AATTATGTCAATGTAGGTTAACTTTTGACATAGGTTGTCATTATAAATGTTTTATGATAT
TTGTTTCTTTTTATAGGAATTATGTTGGAATATGAAAAGAGTGGAGAGCTAAAGACCAAA
TCCATAGATTTGCTTGATCTCGGTCCCAGGTAAGTGGGCTATATAATGCAACATGTATTT
CATACCCAGAATTTTTATTGGAAAACCCTAGCGTAAGATGTTGTGTGGATGTGCTGCATA
AACTACAGACAACACATTACTAGAAAAAATTGTCCTTCTGTGCTATATTATTTCCTGTTT
CAGTGAGTTCTACTTGAGTGTCTTGCTGCATGAAGAGAAGGTGGAAGAAGGGTCATCAAT
CTACCATCTTTTTCTTCCTAAACAAGCTGTTCTTCTTTTTAAATAAACTTTTTAATTTAG
GATAGGTTTAGGAAAGTTGTGAAGACTGAGTTTCCAGATACCCCACACCTAGTTTCCCTT
ATTATTAACATCTTAGCTTAGTATGGCACATTTGTCACAATTAATGAACTAGTGTTGATA
CAGTATTATTAACTAAAGACTATATTTCATTCAGTTTTCCTTAGTTGCCTAATTCTCTTT
TCCTCTGCCAAGATCTCATCTAGGACACCATATTGCATTCTGTTGTCACCTCTCCTTAGG
CTCCTGATGACTGTGACAGTTTCTCAAAACTTTCCTTATTTTTGATGACCTTAGCATTTT
TGAGGAGTACTGGTTATAGGATTTTAAGAATATTGCTGCGCCTGTTATTTTCTTAGTTGA
TAAATATCTCCTTGGGCTGACTGCATACATTCCTCTTCATTGATTGTCACAGGGCGGAGT
TGGGAGGACCAAATCTTTGTCTCAGAAGCTTGTGCACCTGGAGGAAATCCCCTTGTGAGA
AATCTTGTGAGATCAGATTGCCTAGAATTCATTCCCTTTAGGGAATCTTATGCAAAATTC
CCCTTCAAGGGACTGATTATACCTGTTCCAGATTATATCTGAGCCCAAGTTCAGATAAGG
TGAAAATATTCTCAGTGGGAGAAAATAGGACAAAAATACCACGATATGTGTTTTAGAGTT
GTGGCCCAGAGAAATAAGCGATTTTTCCATTATCGTCCTTTTACTTTGTCCTGATTAATG
GGGAGGGGAACAGAGAGTGTCAGCAAAGGGACCTCTCCCATAACCAAAATGAAACAGTAA
ACGAGCTGCTCCCAAGTTTTAAAGTAAGCCCAAAAGCCATATGGCTGGTGAGAGCTGCTG
CCACTGGAGAGGTTTAGAATTTAAGGGGACACTTTCTTAGGCTGAGGACAGGGCATGGCT
CGGAGGATCATGGCTTAGATAGAGTCCAAGTCTTATTCCAAGTGCCTGGCATAGAGAAGG
TACTCAATAGGTTTTTTTTTTTTAATCAAAGAATAAACAGTGGCAGAGATAATATCATTG
AATTTCATCTACAACAACCCTTGTTTAATCTGTTTTCAGGGAAGACAAGGCCTAAGATCA
AATCAAGCTTTTCCATTATTTTTGTAAATGGAACATACTACTGATTCACGTGATTATGCC
AGTGTGCAGAAAGTTCCTTTGCTAGATGTAAATCCACTTAGTCAGCAATGATGTATTTGT
ACCTCCTACATGCAAAGCTCTGGGTTAGATTCTGTGAGAGGCTGTAAAGATACTAATCAT
AATTCCTACCCTCCGATGGGCTTATTGTCTAGTTTGAGACACAACTTGTACACAATAGAA
CATCATATGAGTGGTACAGGTAAACTATACAAGAGAATGACTTTCAGCTAAAGAGTCACT
AAAAACACAGATTTTGTGTTTGAAAGTATAGATCCATAGGTCATTTCAAAGAGGGCTTGT
GGGGCTGTGAAACCAGGAGCTCTCAACACCGTGACCAAAGACTGAACTTCTCCATAGGAT
GCTGTAGTCATCCTATGTAGTAAATAAATGTCTCAAAGAAAAAAAAATAAAGTATGAATC
TTATTTATAGTTCTGGTCAAGAATCTGGGAGTTTTCTGCGTGTAAAAACACCTGCAGTAT
ATGTGACATACTGGAGTTACTGTATTGGAAAATAGCAATTAGGATACTGCAGGCTGGGGG
TGTATGGATTAAATATCTGGCTAATTTAGATCTTGGTAGGAAATCTGTTTTGATTTGTAA
TAGTTGTTGGAAACCTTTCCAAGAGGCATTATTATCTTTTCTTTTCCTTTCTTTCTTTTT
GCTGTGGAAGATTTGCTCTGAACTGACATCTGTGCCAGTCTTCTTCTATTTTTTAGTATG
TGGACAGCCAGCACAGCATGGCCACTAACAGAGCAGTGTGGGTCTGCTCCCGGGAACCGA
ACCTGGGCCATCAAAGCAGAACACACTGAACTTAACCACTAGGCCACTGTGGCTGGCCCT
TATCTTTCTAATTCCTATGAGTATAACTCTTTCAGCAACTGAATCTCTTGGAGTTTATTA
AAGTCATCATTATAAACTGTCTCTGATTCATTTCCATTCCAAATATTCACTCCTGTTCTG
ATAGTTTGTATTTCTTGAGAGCTGGGACCATATCTTTTGCACTTGTGGGGCCTCACCTAT
AGTAGATAGTCAGTAACTGTTAGCCAAGTGGATAGTCTCCCAGCTCAGTGCCTTCCACAG
CACTGGACCTCAGGACACGTTTATTTATGAAGAGGAGAAGGATGCTTATCAGAGTTCACA
TTTCTGGGAGCAGATGCTGAGGCAGAGGGAGGTGGGTAAAAGGTTGTTGAGAAGTGACAC
CTGTGACAGACCAGGAGATGAAGCAGGGTCAGGCAGGAGGAGCCATCAACTATGATGATG
ATGATGATGATGATGCAGATTTGACCACAGAATCTCTGCCAGCTCAAAGGGGAGCTCCGG
AGCAAAGCTTGCCAGTTACAGGGGTCCCTTACCAGGCAGTAATGTCCGGGCTCTTGCACT
ACCCTCTTACTCAGCCCTGGGCTAAGGGCCACCAAGAAGAGTGTGCCCTAGGCTCCAGTG
CTGAGGTGGATCCTGGAGGAGCTGAGCTGGAGGCTGTCAGCTAACCCAACACCTCCCTCA
CAGCTGGGCCACGAGTCCTTTCTTGATACGTATTTGTGACATGTTTTGCAAAATAACCCT
ATTTTGGATGCTTTGTGGTATATAGACATTAGTATTTGTCTTGAACTAATATTATTCTGG
ACTAGCAAAATTTACCAGACTTGAATACTGGGGGAAACTTGAATCTACACTTTGCAGACC
ACTTTTCTTTGAGGGAAATAGTGTTATAGCCAATAATAATAATAATAATTCTTTGAATGC
TTATTTTTGGTTAAGTACTTTCTCTTTCCCTAAAAATATTTAAAACCTAACCTTTTTGAA
TCTCATTTTCTTCATTACTAAAATGGTTATGACAAAAGTGTTAAATGAGAGAGTTGTTAC
AGGAGTAGATGAGAGAACATGTGTAAAGCGGAAGGTATAGGAGTACCAGATGTTCATTTA
AAAGAAAAAAAGAAACAGGAAAAAATAAAGAGAAAGAGCTCATGTTCAGAACCAGGATGC
ACTTGGCTTTCTTAGGTAAGCAATCAGATTCTTCGCACATCCATGGGAGAAGTCTCAGCT
AAGGAAAGTTATTCTAGAGAACTCGAGTGGTTTTCATCTGTGCTTGTTATTGATTTGTAT
GATTTTTTTCCCCCAGAAATCTCTTGGTGAAGATGATGTTGTTCTTGACATTTTATAAAC
GTGGTGCTTTGTAAAGCAATGCCATTCTTCATGTCATGAATGTATATGCAATGTTTTGCA
CAGAGAAAAATAACATTTGTGTGTGTGTGTGTGTGAATTTCAGCAGTGATGTCGATGCGT
TAGTGGAAGAGATTCAGAAAGCAGAGCCTCTAATTACAGCTTCACGAAAAGACCAAGTGA
AACTTCTGATACAGAGATTACAGGATAAACTCGGACAGCACAGCAATCACAAATTCTATC
TTTTTAAGGTAATGTGTATTGAAAAAAATACTAGGTAGAAGAATTTCGATGAATTAATTG
ATATCCTGTTAATTCGAGGTAAAATGCAAATCAAGCTTTCTCTTTCCCTCAGTGCCTCAC
ATGTATTTGCTAAGACTGTCTCAAAAATGTTTGTTGAATGAATGGATGAAATTCAAACAT
TTATGTCTTGAGAAGTTAAATGAATAAGTTTAATTCTAGTAAGTTTAGCTCTTCTTTATA
ATGATAAAGTTAAAGGATAACCATTAAGGTGGTAAAGTTAGTGAATAAATAAAAAATTTC
TTCTAGTTGGAGTAATAAGAAGTTGTGTTTTATGGTATATCAATATTTCAAATTTTCTGC
TTCCATGTGAACTAACTGTATTTCAGTAAATGTTTTATTGATAGGGCTTATATAATAATT
TTAATGTAATATAAATACGTTAATTTTTTCCTATAGTTTTTGATGATTAAATTAAAAATA
TAACAAATGTAGTCATTGATTACTTCAAGATCAACTTTTATTTTCTCTTTATTAACAATA
TTTAATAGTTTATTCCAGAATTGCTTCATATTATGCTAATTTTTTTGATTTAAATATAAT
TATAATAAAATATAACAATTATCTATATATTCAGCATATTCTATCTGATACAAAATATCC
AGGCAATCTTTTGTATTAATCTATTCAATTTACTGAAAGAGGACAAGGTGATTCTTATAA
TATTTCTTTTTCCAGTAGGTGGCACTATTTAACTTCAAATATGAGCTAAATAACCAGCGG
GACCTTTTAATCTATCCTCCAAAGGGAACATTTTTAATAGTGAAAGGGGACGCTATTAAT
AGTTACACTCTGGCAGCAGACATAACTGGGACTGTCCCAGCCTAGTCAAGCACTCTATCT
ATAAACAGGCTATCCAATTTAAGTATATTCATTCAATGAATATTAAGCAGTCACTATCTG
CTAGACAATGTAGGGATTGAAAGATTAGACATATCCTGACTTTATCTAAAGGAGCTTCAG
GATTCAAAAAGTGGTAATACATTGTAAAATCTGTATTTGAAACGTATTTAGTACACTTCC
TCTATACACTCTTCATGGAAAACCATGTGCAATATGTAAAAGAAAATATTATAAATGAGT
GCAACTGGGTACCTTATTTAATAGCCACAATTTATCTTAAAGCCAAATTGATGGAAAACA
CAGATTATCTGTAACTACCAAATGTGTTATTGGTCTTAATAATAAGAGGTACAATGTATT
CTTTCTCATTTGTTCAGATATTGGATATTGTCCATTTATTATGTATAATTACGACAAACT
TGGTTGTCTTCATTGGTTTGAAGTTAAAATTAATGAATTAAACTTAACTTTGAGTTTAAA
ACAAATGTTGTTTTCTTTCATTGAAGGTTCTGAGAGCACATATACTGCCATTGACTAACG
TTGCACTTAATAAATCGGGCTCTCGGTAAGGTTCTTTATTTATTTAAAAAAATTTTTTAA
TAGACTTTATTTTTTAGAGAAGTTTTAGGTTCATAGCAAAAGTGAGCAGAAAGTGCAGAG
CTTTCCCATATACTTCCTGCCCCCCCTCCCCCACACCCACAGCCTCCCCCACTATCAACA
TCCTCCACAGAGTTTTACATTTGTTACAGTTGAGGAACCTACATTGAGACATCGTGATCA
CTAAAGGTTCATAGTTTACGTCAGGGTTCACTCTTGGTGTTGTACATCCTGTGGGCTGAC
AGATGTATAATGACATGTATCCACAATTACAGTATCACACAGAGCAGTTTCACTGCCCTA
AGAATGCTCTGTGCTCTGCGTATTTATTTCTATTTCTATTCACTATTTCTAATTTTTAAC
AATCAAGGGATAAAAATTTTTTAAAATAAAAATTGTATATATTTAAGGGATACAATGTGA
TGATTTGATATACATATATGTAATGAAATAATTACTACAGTCAAGCTAATTAGCTTATCT
CCTCACAGTTACCAATTTTTTTGTGATGAAAGCACTTGAAATCTATTCTTTTTGCTTATT
TCCAGTATTCAGTACAGTATTATTAACTATAGTCATCATGCCATACATTAGATTTCTAGA
TTTAATTATCCTACTGAACTTCAATTTTGTACCCTTTAACCAACATCTCCCAATTTCTCC
CACCCCCAAACCCCTGGTAACTGCTGGTCTACTCCCTGCTTCTATGAGTTCAACTTTGTT
TTTTTATGTGCCACATGTAAGTGACATCATACAGTATTTGTCCTTCAGTGTATGGCTTGT
TTCACTTAGCGTGATGTCACCCAGGTTCATCCATGTTGTCACAAATGGCAGGATTTCCTT
CTTTATCATGGCTGAATAATATTCCATTATTATACACCACATTTTTTTTTTTATCCATTC
ATCCCTTGATGGACACTTAAATTGTTCCCATATCTTAGCTATTGTGAACAATTCTGCAAT
GAACTTGACTGCAGAGATCTCTATGAGATCCTGATTTCATTTCCTTTGGATGTAAACCCA
GCTGGGTCATATGGTAGTTCTATTTTTAAATTTTTTGGGGGAACCGTCATATTGTCTTCC
ATAATGACTGTATCAATTTACATTCCCAAAGAAGCTAGGAGGAAAATGGCTTGTCAACCT
TCCTGTTTAGTTGAGTTTAGATATCAGAGTTTGTTTTCACTTTTTATCACACCACTTGAC
ATTCAGACTGGCTTTTCAATTTTGTGCATTTTTTTTTTTTCCGCTGGGAAATATCTTTCC
TAACAGAATATTTAAAAAATAATAAGATACTGTAGCATTTTGAATTAAAATATTAGAGGT
CAATATACTAACTATTCCTGTAGTGCAGCAGTCATGTTAAAGGATTGTTGAATATTAAAC
ATTTCTTGAACATTTACGAGTGTGCCAGTCATTGTTGCGGGTCCTGGGGAGGATGGTCCT
GAGCCAGGACGAGCAAGTACAAAAGAAACCATGCCGTTCTTCAGAGACTAGCAAGAAGGT
GAATCTGGCTGGTCAGGATGTACTTTTGGGAGAAGTTGAGGTCTCAGAGATAGCCAAGGA
TGCCGGCCTTGTACACTGCAGGCAGAAGTTTAAATTTACCTCTAGATTGCTAAGAAGTCA
TTTGAGGAAGGTTAAAAAAATACCTCCAATTTCTGTGCGGAAAATACTTGACTTTTAAGG
GCCATGTGTGAGCCAAGACCCATTAGATGGTTTCACTTATTTAGGCAAAAGATGGAGGCG
ATGGAGCTGGTGAGAAAGGGCCATACGAGGGATGTATTTTGACGTTGTGCTAACAGAATT
TACTAAAAGATTTTGTGTGGGATGTAAGGGAAAGAGGGGAATCAAAGATGATGCTAAGAT
TTTATGGTCTGACTAACTGGAAGAATGATAGTGTTTATTGAGATATATTAGAGTTTCAGA
AAATGTTATGTATTATTAGCATTATTTAGTTATATGATTATTGATATTATAAGAATGATT
GTTGGCAGGATTACTCTTTATTTTATTTAGCAACTCCTTTTTGTGTTTGGGATGAAATTG
GAGAATTTCCAGGCTAAAGGATTTAGATATTGTTCCTAACTGTTTGTTCTACATACACAA
TTTCCATCCTAAAAAGCAAGGTAAATGGGGTTATTATCCTGCAGGTAAATAAAAGTGGTC
TTGATTAAACACTGTTATTATCGCCTTGTGATTTATTTATACTCCTTGTGTTAGCTTTAT
CACAGGAAGCTACGATCGGACATGCAAACTCTGGGACACTGCATCTGGAGAGGAGCTCCA
CACGCTGGAGGGCCACAGGAATGTGGTCTATGCCATAGCGTTCAACAATCCTTACGGGTA
AAAAGACATTCACTCATTCACTTATTCCTTAATTAATCCATTAATTCATTGATTCATCTC
TTCCTCCATCTATCGGGAGAGGAAAGGAAGAAGACATAGAATTAAAATTTATTGAGTGCC
TGATATGTGCTTTGAAAGTCTTTTAAATACCTCCTTCAGTGCTTAGAGGAGCTTTGGGAT
AGGTATTACTGTCCTCGTGTAAAGTCTATAAAGATCAAGCACCCCTCCCAGGATCACACA
GTAGTTAAGGGCAGAGACAGTTCAAGCTTGAGCAAGGCTGACTCTATGCCCTTGGGAATT
CTCGGACAGGCAGCTCCTACTGATGTGACAGCACTGGGCTGATGCTTCTGGAGAATGTGC
ATACATACATAACGTGGTTTGCTTTGTTTAGAAGTTAGTTTACAACCTTACCAGGTAGAA
AAAAATGTGTATAGTAACATGCTAAAAACAGAACCAAATACACTAGAAGGATTTTTAAAG
CAGCCTCTAGCTACCCAATTCAATAGATTAACCAACATTCTCTATCCTTTTGTGCAGCAT
ACTACTGATGCTTATGACTCCCTGAATGCTTGCAGCAACTAGGCTGCCCACTGGGCTGCT
TAACTTCTCTTCTCACTGGTTAGGCTCTAAGCTAATTAAGAGTGAGTTGTATTTGTGCAC
AAACCTGCTTATGTTGGTGGTGCTCTCAATTGTAATTATGTAATTTAATACGTTTTTTCT
GTGAAGACATAGATAAGGTAAATCTTTGAAAAGTTGTTAGTAAGTGACGTTGTAGATGAG
ACCTATGTAAAAATTAGAAAACCTATTGTAAAAATTTAGAAAAATTCGGCACTTGGATTG
TTCTGTGAGTGTGTTTAGGTTCCTTAAGTTCTCATTCCACTTTAAAGAAAAGAAAATTGG
AAATTATGGAGGTTGGATGTGATTTCTGTAAGACAGATAATGAACTCCAATTAGCTGATA
AGGCCTTGGCCTCTTGTCGCAAGATTGGCAGATGGATGTATATATTTCACTAGAAATTTT
TAACGTGTATTTTTTTTGTGATTTCCCCCTTTAACTGACTTTTTCCATTAACTAAGCTGC
TTCAATAAATATGTTTGTGTTCCTGAAGCATTATGATAAGTAGAAAAAACAGTGAATGGT
TTAAAAGTTAAGAAGAGCAAGAGATCATTGTGATTTTTCCTGGTTAAGGATGCTGTGAGA
TTAAAGTGTAGGCATGAAAGATGGAAGGTGGAGAGAGGGGTGATGAGGACACCCTGGGCG
AAGGGACCTTAGCAGCCCAGTGTTTCTGGTGAGACATTGTCAGACACATTCAGCGGCCAG
TCTCTGTGGTGAACATGCCATGTTGAGAAACAGAAGCGGGTGAAGTCAGAGCATTCCGTG
TAGTTTGAATTCTGTTCTGGGGGACTGAGTTGCTATGAAAAGTTTGTGGACATGGGAGTG
ACATAAGGAAAGCGCTATTCCAGGATTGCTCTGGCAGAGAGAAGGGATCAGGGGTTTTGG
GGTGGGAAGAAACAGGAGGCAAGGAGATTAGTTAGGAGGCAGAAGCAATAATACACACAT
GAGATGATGGACACTTAGTCTAGGATAGTGGCAGCAGCAATAGGAGAAATTTTATAAAAA
TGTGGTGCACTTAGGACAGAAATTTTATACCACAATTTGTAAAAACTTATCATCTAGGTT
GCTAATGTCATTACATCTTTTAAAAAATGTAATACACTTTCAAAACACGTTAATTGTGAT
GGCACAAACTTAATTGGTACAATTAAAATGATTAAATATTTCAAGTAAATTACAGAAAAT
TTAACTTTGATGCATGCATTTTTACATTGTAGAGAATGATCATTTTTATAATACTTTATC
GCACCAACTTATGGGAGAGAAAGATTTTATTGAAATTATAAATGACACTGTTTTACTTCT
GATATAATCCCTACTTTAATTGCAATGTTATTTAAAGGATTTTAAAAGTATGTTGTCTAT
AATATAATACCGTCTCCTTTAATAGTCGACTTAACAGACATGACGTTTTTGGATGTCTAT
CTGAGAACTAAGGTCTCTGGGGATGGAGATGTGAGGAACACTCCTCACTTTTTGGTTCCT
CTATTGAATTCTACCAGGTGCCCCTGATGAAGAACCCGCTTGTCCAGTGACATAGTCTGA
TGATTTATGTTTGGGTTAAAGCAACAATTTTCACTACACGTTGGGGCATTGGAGTTTCAG
TGGAGTGAATTTAAGAGAACCACTGAAGACGAAGAGGGAGTGTGTGTGTGTGTGTGTGTG
TGTGTGAAAGAGAGAGAGAGAAACAAGCTTCAACCAGTTTAGTGTTTATTTGTTTTATAC
ATTAGATCAAGAGTAAGCTTTGATTCAATAAAGTAATTTTAAAAATCATTGAAATTAGTA
AATCTTTTATAATGTGGTACCCAATGGATATAGAGAGCCATATGTGATAGAACAGAAATG
GATCAAGAAACAGTAGCAACTTGAGACCAATGTGTTTGAGGGGCAGGAAGGATGAAAATG
AATGGAGGAAACTGATGAAGAACTCATAGGGCTTTCAGTACATCTTGAGCAGAAGTTGAA
AGACATCGGCAGCTGATGGAAAAATGCCTTAGACTGGATGTCAAAGGAGAGCACCAGTGC
AGAGACTGGCTTGTGGAAAACCAGCCTTGTGTGTTAGAAAGCTTTGATGGGGGGATGAGT
ATTCCCCAGGACAAGATGTCCCTGGAGCATCAACAGAAAGGACCTTGCTTCCCTTTGGTA
TTGCAGACCACAGAAATACTATGTGGGTGGCCTGAGAACGGGGGTGAGAAGCAAGATGTT
AGTGTTAGTCTGGACAAATATAAATCCTGAAACTGTGCTGAGCACTTATAATTTGCTTTG
GGATAGATGTTTTGGATCTCAAGACCCCTCACACTTTTGGACAAGGAGCTTGCACTGTAA
ATGATAATCCAATTTGGTGAACATTTTGATGATTTGCTATTTAAAAGACAGATAGGGGTC
AGGGATAAAGGAAAAGATTTTAGTTCCATGACAAAATTCCATTCTATCCTGCTCTTACCT
CTTGGGTGTTGACAGTAGCTTTGCTCAACAATAAACACAGAAGCTCTTGTTTGAAAGGGA
CTGAAGTCTTTATCATATCTCCTCTTTCAACCCTCTTTCTTGTTCAAAGACCTTAAAACT
GGAATAATAAGGATAATATTTTGACAAGGAGATAATATTTTGACAAGGAGACACTCACTG
TCTAATTTTTCAAAACTTTGTCTAGTTATATGGTTAATTGGATTTATATCTTTTCAGTTT
TCTTCTTGTAAATTCTATGTTATCCTTTTCAGTAGACATGCTAATAGAGTTTTTCTATGT
TTATATAACTCATGTTATATATTATTTTCATTTGTTAGTAATTTTCTAAACTAAATCTTT
TACCATATTCATTGTGCTAATTTAAAAGATTTTGTAATCCTAAACATATTCCTTTAATGT
AGAATCTTTAAAATTAAAAGATAAACTGATACCATTAAAAAATTAGACATTTATTTTGTT
ATCCACTGAAACAAATAAAGGATTGCTTAGTGTTTTAAAAGTGAAGTAAATTTCTGAGTA
GAGATCCATATATTAATATCTGGTCTTAATTCAGTGTGTCATATACTGTGATTGGATTTG
ATTTCAAAGTCCACAAAATTTTTTTTCAAATTTTAGTGACAAAATTGCCACTGGGTCCTT
CGATAAGACTTGTAAACTATGGAGTGCAGAAACGGGAAAATGTTACCATACCTTTAGGGG
TCATACAGCAGAAATAGTGAGTATGTTTATTTTATTATATTTTTTACGTTGCTGGTCTTT
TTTAAAAAGCTTTTTCCTTTTTCTTTCAATAGACTTTATTTTTTAGGGTGGTTTTAGGTT
CACAGCGGAATTGAGAGGAAAATGCAGAGAGTTCCCATATACTCTCTGCCTCCCCCCTCC
CCACTCCACACAGTGTGCCCACTATATCCCCCATCACGGTGGTACATTTGTTACAAGTGA
TAAACCAACATTGACACATCATTGTTATTTCTTTTTAGAATTCCAGTATAAAATTAGTGT
GGTTCTACCTTTATAATTAATTTTAAAATCCCATCCAGTATTTTAGATCTATATATTTTA
AGTGCTGGTATTGATATAATTTATAAGCTACTCTAGCTTTAATATCTTGCAGATATCCCG
CATTGACTAAGTAGACACGTAATATGATAAGTATATGAGTAAAACATCCAACCTGACTTT
TTCTTTTTCATTGATTTATCTTTAAAGGACTGCCTCTATAAGGGTTGATGAAGTTCTCAA
AATAGCTTTTAAAGTAACTTTTTTAAATCATGTAAAATACTTAGGCTGATTGTCGTCTTG
ATATCATTAGAACTTAAATTTGCACAAATAGTTTGATACTCTAAGTAGCTCTCACTATTG
GGAAGCCCTTGCTATTGGTCAACTTGGTCAACAATTAGCGAGGTAATTGGTACCCTATGG
AACAAGTGATAGCTTCTTTTTTTTTTTAAAGATTTTATTTTTTTCCTTTTTCTCCCCAAA
GCCCCCCAGTACGTAGTTGTATATTCTTTGTTGTGGGTCCTTCTAGTTGAGGTATGTGGG
ACGCTGCCTCAGCGTGGTTTGATGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACCAAC
GAAACACTGGGCCGCCTGCAGCGGAGCGCACGAACTTAACCACTCGGCCACGGGGCCAGC
CCCAAGTGATAGCTTTTTAAAATAAACAGCCTGCTTATTTTAGGAGTAAAATCTGCTTAT
ATGAATCCTTCAGGTTCATGGTATATTCATCCAGCAGGAGCTCATGCTATGTTCAAGATA
CTTTGCTAGACACTGGGGATATCGCAGTGAAGAATTATAACTGACTCTTTAATGGCACTC
ACTGTGCATGGAGCACTATTCTAAGCCCTTTGCATATAGTAGCTTGGTTGCACCTGATAA
CAACCCTAAGAGGTAGATATTTCCCCATTTTACAGTTGAGGATATTGAGGCATAGAGAGC
TTAAGTAACTTGCTGACGGTCATAAGACAGACATAATCCTCATTCTCATATTGTCACTAT
GTTTCCACATGCCCTTGGAATTTTGAAAGATTTTCTCTATATATAGTTCCTAGGAAGACA
TCCATATTTTTCATGGTCAACATCATCAATCCAATAAATATTTGCTAAATATTGACTGTG
TGAGAAGCTCTGGCCTATGTGCTTGGATTCCAAATAGAATCAGACATAGTTCTTGCCCTC
CAGGGATTTTGCAGTTTGGTAGAGGAGTAGAGGAGTCAATGAATAAGTCCAAAGACATGT
GGTAGGTGTGCTAGAAGTTGGCAGAGTGTTTAGTGAGGGCACAGAGGGGAGCAGTCCAGT
CTCCTTGGTGAGGGGAGGTGTTCAGGAAAGACTTCACAGAGAAGTGGCACATGCATTTTA
GGCAGAGGGAGCCATGCTGGCAAATGCCCAGAGGAGGTGTGCAATAGTGGTACGTGCTTG
AGAACTCAAGTGGCTCTGTGTGGCAGAGCAGTGCTTTCCAACCTTCCCCAGTGATGACAT
GCACAGAATATGCTAATATGGATTTGCAATGCACCCTGGGGAGCTGTCTGCTGCCCACCA
TCAGAGGTGACAGGCAAAGATCCCTGGTGGTGCCCAGCTGCCTGGGTTAAGAGTGTCAGT
GTCTTGGCACACCTGTAATCCGTTCAAAGGCAGGCCACAGCGTGTGCATGATTGAAGTGG
GAGAGGCAGACAAGGCCATTTATAGTTTTATAGAGGGTCTCATAAGCTGTGCTAAGGAAT
TTGGACTTCCTCCTGTAGATAATGCTATAGGTGGAGACTTTTCAGCTGGGAGATGACGTG
GTCAGTTTTGCTCTTTGGGAAGATCATTTTTTTCCTGCAGTGTGAAGGCGAAATGGGAGG
TAGGTAAGATTAGAAGCATGGACCACTTGCGGATCTTGTTGCAGTCCAAGCAAAAATGAT
AAAGGCTTGTCCTGAGGCAGGTGAGGAGAATGTGAGAGAGGTTGGGGATGGAGGAGTAGG
ACTGGATTACCAAGGAGATATGAGACATGAAGGAAAAGGGAATCCAGGATGGTTCCCTGA
TTTCAGGCTTAGGCAACTGGCAGTGCCATTCACCAATTCTGTACACAAAAGAGGAGGAGC
AGGATTGTTTCCTATGATGCCCGTGTCTTGGACAGATGGATAAAAGCTGTGTGATATCCA
AACAGAGGCATCCATTTGGCAGTTGGCTTTTGGGGCTGAACTAAGCAGCGAGGTCTAGGA
AGGAGACATGGTTGTGTGAGTCACTGGCGTCTGGGTGGCAGTAGAAATAACTGATCAGTT
GAAACTGCTCCAAGGAAAAGGTAGAGTATGGGGAGAAGGCTGATGGAATCTTGGGAAGAT
GGGGAAGAGAAACTTTCAAAAGACAAAAAAAAGAGAGATAAGACGTAAGAGAAGAAAAGC
AGAGTGCTGTCAAGGACATCAAGAAGGAAGAAAATATTGAGAACCTCAGGGAGGTTAAGC
GGGATGATTGACCAAGCCTCTTGAATTGGATGTTTAACCAGTGGTTTCAGTAAAGTTGAA
GAGTGAAAGGTGGGCAAACAGGGAGTGACGGTAGACTATTTTTCCAAGGAATTTGGTTGT
ACAGGGAAATGAGGTAGTTAAAAGGGAGATACATAGAGTCGAAGGAGGCTTTGTTTCCAT
GTGGGAAAAGCTCAAGCATATTTATAGGCCACCGGGAAGGATCTAGTCTAGACGGAAGGA
AAAGTTGGGGGGCACATCTCCCCTAGGAGTGCAAGGAAGGGGGTGTCTTAGAATGGATGA
AGAGATCTCTCTGAGACAGCCTGACGGAAAGGAGATTGAGGGCCAGGTGAGGGAGTTCCC
ACGTGATCGAAGAATTTTCTCAGGGAAGTAGTAGGAGGCAAGCTTATCTGCTGAGGAGGA
ATGAGGACGGGAGTAGAGGCAAGAGTGGGGGATGCGAGGATGTGTGCAGCCAGTGGCATG
TTAAACAAAGTAGGGAAAGGTGCTGAGGACGGAAGACATGAATGAACAACACAAGTAATC
TGCTCTGTCAGTTTCTTAAGCTGCCTCAGCAGAGTGATGAGGTAAGGAGGGCAAGTGAGC
AGATAAAATCTCAGCTTGATATAAGTTGTTAGGAGTTTTACGGAGGATGCAGTTGAAAGA
CAGGACTGGGTCTTGAGGATGCTGGCAGGAGTGATGCTCCCAGTTGAATGGGGATGATGG
ACCAGGAGAAAAGGAAAGGATCTCAACGAGGTGGAAGATATCCTGGTTGGGAGAGGTGGT
GTGGTAGGTGGTGCGGTAAGGAAGAGAAAAAGCTGGAATACTGGGAAATTTTAACTATAG
ACTGGTGTCTTGGTAGTGAATGTTCTAGAGAAGATTCAAGGCTGTAAAGATGTCATTCAA
GATATCAAGGTCCAGGGTGTGGCCATTGGAGTGATTATGAAAAGGAGTCCAGGATCATGG
GTCTGGGGGTGTTGGACAGATGGCCCACACATAGGCCTCCTAGGATTTGGAATTGAGACT
GAGCCAATAGCCAAAGTCCTTGGTGAGTGAGGGAGTGTGATTGAAAGGACTGTGATAACA
GCAGCAAGGAAGATGGGAGCCAGAGAGCATGCCTCTCAGAGGTGATGTGCTTCGCTTTTG
TTCTTGTTCTGTGTCTGGAAGCGGCAGGGGGGGGTCAGTGTTCCTGTAAGCCTGAGCTGG
GTGATGAGGGACAATGAGCAGCCTCTTTTCAGGAGGAGAATGCTTCAGGATCCAACCTGC
AAATAACAGGCTACTTGTATTTGGTATTTTGCTGTCTGTTGTGCAAAGAATTAGGCAGAA
TCTAAGGTATTTGCATTTTGAAGCTTTTCTATATGAAATTAACAATTTACAACACCTCTG
TCCTTCTAAAACCTCATCTATTTCATGTAATTCAGGTGTGTTTATCGTTCAATCCTCAAA
GCACATTGGTGGCTACCGGAAGTATGGACACAACGGCCAAACTGTGGGACATTCAGAACG
GAGAGGAAGTGTTCACTTTAGCGGTATGTTAATAATGTCAATAACTTCAAGAGTTTTACA
TTCTCATTAGCCTTTCCTTAGGATAAGCCTATTATTTGTGTTTGTTTTTGTTGGGAATTT
TATTACAAAATTAGCTCTCAGTGAGAAGATGCTTTTGAGTTACTGGTTTCCAGGCTGGAG
TGAGAGAGTGTTCCAGTTGGTCTGCTGGCTACTCCCAGAGACTCAGATGGAAGTGCTGGG
GAAGCCAGATGAGTTTTTATTTTGGTTAGCTTCAGTCTGTCAGCCATACCAACTATACCT
TAAAATCTGTCATTATCTGTCTGGCTAAAAGCAAAATAGGTGGGAGCTGGCACCCTTTGG
AAGAGGCAGAACTGGAGAATCTTGCAAGAAGATTCCTTAAAGGGATGACAGTTAACACTC
TTCTCCTCCATCCTCCAGTCTTAGAAACCTCCTGTACTACCAAGTGGCGAGTGGCCGGAG
TGGAAAGCCCACAGATTAAAAGTTGGTGGTGTATCTCCACAGGGGCCCCTGTCTGTCGCC
CCTACCACACATCCAGCACCTTCCTCTGACCTGCTGTCCTCTGCTTCTTCCCACCCCAGC
CGTAACCACCAAGCAAAAATAGGGCAGGTCTCTGTGGCTATCGGTGGGAACACCTGGATG
GGAAATCTAGTTTTCCTATCCTTTTACGTTATAAATGAGTTAAAAACATAGGACCTCTTT
CCTGGGAGAGCTCTTTTTAAGAAAGTTAAAAAACAGACTGAAAAAAAAGAGAAAAAGCAC
TGTTTTTAACTGACACCAAGGATTTTTTTTGCCTTAGAATGCCTAGCATTATTAATTATT
AATATAAGTATACTCTCTCTGGTCTTCATTCTCATCATTTCTGTTGGTCACTGCTTCTCC
ACTACCTGTTGCTTCAGAGGGATGCCTAAGAGCATTCAAAAGGATGCATCCCGCCCTGCA
CACCCACCCCTGTCTGCTGCCAGAGAATGCATTTGTTTTGTGTGATCAAAATTTTAATAT
TCAGCTACATTTTTTTTTGTCATTTGGAATCAACCAGAAATTTAATCTGTACATGAACTT
TAGTGTTATTTGAAAAGGTAATCATGTTAATTTACTAAAATATTAAGGAAAATGAGGGAT
ATACTCCAAGCAGAATCTACTTTAGAGAGGCACTCCTTCCTGTGGTCTCACAGTTTCATT
CCTCAGCCCTGGTCTGTAACCAGGCCAAGGGCAGGCCAAAGGCCAGACATTTATTAAACA
ATTCACATTAAATTATCGTAAGAATTTCCTTTTTAAAAAGTTGTTAACTGTATTTCATAA
ACTGTTTTCTCTTACCTGTCACCTGTTATTAGCCTATAAAGCAAACAGCCCTCTTTAATG
TTTCCAGAACAATGTGAAAGAAGCGTTCTGATTTCCCAAAACATACCCGCTTCTTTTCTT
TACAAAAACAAAAACAACTTAATTGAGTTAAAACTGACTTGCTTTAAATGTATGTCAAGT
TTGAGTAACCCAAAGGAATTGTGCAACCGTCACCAAAATCTAGTTTTAGACATTTCCATC
ACCCCCAAAAGAAACCTCATGCCCATTTGCAGTCACTCCCCATTCCCACCCCAGCCAACC
ACAAGTCTCCTTCTCCCTGTATAGCTTTGCCTTTTCTGGCATTTTCTTCTAAGCTATGAT
ATTGTACATTTGTAGAACTCGCTTTATCTACAGGTACACATGATGGTATCTGCTCTCTTT
TAGGGACATTCAGCTGAAATCATCTCCTTGTCCTTTGACACCTCAGGAAACAGAATCATC
ACGGGGTCTTTCGATCACACAGTTGTAGTGTGGGATGCTAATACTGGAAGGTATTCTTAA
TTTTAAAGAATTTTTTAACCTGGATCAAAGGATTAAGAAGACGATGTTTGTTACTAGTTT
ATTCTGGTATCTGTTAACTGTGCTCTGGTTTCCGTAGGAATAGGACATACTGAAAATGAA
TTAGTTCGTTCTTTAATGGTATTTCTGATCCAGAAAAAATGTGTGATTTCTTAGAATTCT
GAACAAATAATGCTGAGCAGTAACAAAAAAGGAGAATGTTAGCAATAGCCTGGTTATATA
GCTATTATTTATTCCACGTACTATGTAATCAAATTTCAATGGCTTGTCATTATGGTAGGC
ATGGATATCGTGAATAAATAATATCATGGCTAATTTCCCAAATTTAATTTAGTCCAAGAA
CTTCAATTTCCTTCCTAATTATTTTTGGTCCTAGTTGCTAAGAAGATAACTCAATAAGCC
TATTTGTGTTGTAAAACTCTACTCTTGGACTTGCCTGCATTTTGATAGAGGGGCTGATTA
TCAGGGGTGCTGATCAAGATGAATACAACAGGAAGTAAGAGAGAGGAAGGGCCCTTCAGA
CATTTGATAGGTAGTTTCTGAACTGCCAGGGGTCCACTCATCTGGTGTAAGAATGCTTCC
AGAATTTCAGACTACCTTTATTACTTCTTACCTGTTCTTTTCTGAAGTGTTGTCTTAAGG
AATGTTATTATCTTTGATTGCTTAAAATATGTGTATGTGTGTTGAAATGAAATTAGTAGC
CTAGTTGACTCCTCTTGTGCTATGGTAAGCTGTCTTTGTTCTGTCATCAAAGATGTTATT
TGGTGAAAACTAAAGTTAGACTGTACATTGATGGGCTTGACATCATTGTTTGTGCATATA
TTGGAAGTAAGGCATCTTTCACCAGTTTGAGTCGTTTGCATTTTGTAGGAAGGTGTATAC
CTTAATTGGGCATTGTGCTGAGATTAGCAGTGCCTTATTCAACTGGGACTGCTCTCTGAT
ATTAACTGGCTCTATGGACAAAACCTGCATGGTGAGCTAAAGAAATATCTCTGCTTTTTA
ATTCTTGTGTCTGTACTTGTTACTGTGTCAGATATTCATGACAACACTAACAAATTTCAA
AGGTGCTGTAAAATTAAGATATTAATTCATAAATAATAATTTATTTATGTAATTGATTCA
AATGTATTAAAAGATCCTATCTTAAAAGGCACATTATTTTTCTTTAATGCCCCTCTACTT
ATTTATTAAATTTTGATTAGAGCAAACATCAAGGCATCTCACCACAGTGTCTCCATGCCT
TTGACTTTCTGTTACTAAGAGCTTATGCTCTGAAATTATTATTTGATTATACATCAGATT
ATAATAATCTTAATGTACTTTTCATTTTAGAGCATTGTAGGTTTAGATCAAGCTCATTAT
CATTTGAAGACCTTCATATGAAAAGAGGACACTTCCATTCCAATCAGTGAAGCATGCACT
TTGAGATTTTTTCCTAACATAGTGGCAGATTTATATACTCATTCTGAATGTCTGTCTTCG
GACTTCTCTGTGTCCAAATTGTGCCTTGTTAAATGATTGGCTTTGGCACGGTTATTTAAC
CAGCCATAAGCATGTCATAAAGCCTACTTTTGGCCATCTTTGCACTTTAGACAGGAAGTC
ATAGTCTTCTTCTTCTTTTGTTTAATAGCAGCTGTGGGATGCTATGAATGGAAAATGTGT
GGCAACGTTAACAGGCCATGATGATGAAATACTAGACAGCTGTTTTGATTACACTGGAAA
GCATATTGCAACTGCTTCAGCTGATGGTAGGTAATCTGTTCACACGTTTAAATTATGGAG
AGTTTTGTGCTCTGTTTGATAAACATAGATGATTCTATGCTATATGTCATCTCCCCGATG
GCCAGCTATGATAGAAACTATATCTGCCTCATCTCTATGATGTCTGTCTATGTCATTACA
CTATGTGTCATATTCTTGATAACCACATGTGGTACGATACATAGTCTGCATCATCTCCTT
GACAACCACAATAAAATTATACTAGGTCTTCATCATCTCCGTGATAACTATATATAATGG
TATATTCTGGGTCATCTCCCTGATGGTCATGCATTTTGCTACACTATGTTGACCTCATCA
GCTTGACCACTATCAATGGTACTATAATAAATCTGCATTATCTGCTTTATAACCACATGT
GCTACTCTACTATGTCTAGCTAATCTTTGTGATGAACATATATGGTTCTATGCCATACAT
CATCTTCTTGATTACTGCTTATGATTCTACACTATGTCTGTGTCATCTTATTTACAGCCA
TGGGCTGGTGCTACACTATGTGTGTCTCAGTTCCATGAAGATCACATATGATGCTATAAT
ACATCTATTGTATAGTATTATATCTATTGACCATGTATGCCATTGTATTATGTCTGTCTC
ATCCCCCAGGACCTTTGCTACAGTATATCTGCATCGTCTCCTTGAAAGTGCAGTATTATG
CTGTGCTGTGTTTTCATCCACTCCTTTAAAACCATGTTTGATGCTATGCCATATCTGCAT
CATATCCTTGATAACTACTTATGATGACATTACAATATATATCTTATTTCTTTGATGACA
ACACATCACATTACACTATGTCTACTCCATCTCCTGGTCACCAAGTAAGATACTACATTA
TGTATGCATCATCTTCCAGATGACCAGGTGGACACAATGCTGTCTGCACCATCTTCCTGA
TGACCATGCGTGATATTTCACTATACTCTTATCAACTTCTTAAAAACCATGTATGATGTT
ACATTCTACCTGCATCATCTCCTTGATTGCCACATATGATGTATACTATGTCAGCATCAT
CTCTTTGATAACCATGTATGATGCAGTACTAGGACTCATCTTGCTGACAGATATGTATGA
TGCTACGCTGTGTCTGCACCATCTCATTGAAAGCCACATGGAATGCTGCATGATGTCCGT
ATCATCTCATTGACAACCATCTGCATGGGCATATTACATCTCTTTGAACACCATGTGGGA
TGCGATACTATGATTATGTTTCTCCCTTGATCACATGTATGATACTACACTATTTCAAGG
TTATTTCCTGGACAGTAACCTCTGAATATTTACAGTGTCTGATCTCCTTGATAACTATGT
ATAATGCTATTCTTTCATAATCTCCTTAATAACTAGGTATGATGTTATATATAGGATCAT
CACCTTGATGACAATGTATAACCCTAATCATTGTCTGTGCCATCTCCTTGTTACTGCATA
TGATGCTACAATAGGGCTGCCTCATTTTCTTGATAACTATATGATGCTACACTGTGCGTA
CTTCATCTCCTTAATAACTACTTGTGATGTTTTTATAAGTTTTCTCAATTCTGTCAAACA
CCACATATGATGCAGTACTATGCTTCATTTCTTTGATAACTGCGTAATTCTAAATTATTT
ATACATCACTTCCTTTACAACTATTTATGATGGTATATTGTGGATTATCACCAAGAGGAA
CACATCTGGTGCTATACTGTATCTGTTTGTGTCATCTCCTTGATATCCGTGTACGATGCT
ATAGAATGCATCACCTCTTTGTTACCAGTTTATTGCTATGCTGTGTCTATATAATCTGTT
TGATAGTCTTTCATACTATATTGTGTCATGTCCTTGATAGCCACATACAGTGTTCCACTG
TGTGCCTCATCTCCATAGAGAACACCTGTGATGTTACACCATGTCTGTATTATCTTCCTG
ATGACCACATATGTCACTGCATTGTGTCTACTTCATCTCCCCGATGACTATGCATGATGA
TATTTTGTGTCCACCTGATCTTCCTGATTACTTGCCTCGTGCTACCTTATATCAGATTTT
ACACCTAAAGAACCACCCTTGATGCTGCAATATGTTTCATCACCTCCTCGAAAACCATGT
TGAATGCTACGCCAAATCTGTCTCAGCTCCTTGATGGCCGCTTGATGCTAGAGCATGTTA
CACCTTTTGTTATACCTTTGGTGACAATGTATTACACCACGCCATATCTTAACAGACATT
TAAGAAATTCTCGCAAAAATATACTGCTTTTTCTAGACGTGACCTGTCATTTGTTTGCCT
GTGTTTGCTCCTTGTGACTAACATACTTTTAAGTAGTCACATATCCTTTGTGCTGGAATC
AGTTGTAGAATTTTACTGGTGATTCATTTGAATTCCATAGTCTTTGTTTCATTGTTGTCT
CCCTTTTCAAAATTACATTTACATGCTTATTCTCTTACTCACTAGGACTTTTCAAAGGTG
ATCTTTTAATCACACATACAAGTCCCTTTTATATCCTGGAATATAAACACCCTGAATGCG
GAGAATTTTATTTTTTAAAGTAACTCTTTACTTTTTCATCCTTCTCACAGATCTTGGCTT
TTAAAAATCATCTCTGAACTGTAATTAATCTGCCCTTTTCATTTTAAATGTCATTCTCAT
TTACACAAAAAAATACATTCAACAAATACATATGGAGTACTTACTTTGTGCCAGGAATTG
TTTTAGAAACATTGGATATACCAGTGAACAAAAGAGAGAGGAATCCTTCCCCTGGTGGAG
CTATGTTGTGGAGGGTGAGACAATGAACAATGTCATGCATGTGTTTTATATATAATGTGA
GAATATTAAGAGTTGGTTAGCGCTGGGTGGGGGGGGTGGGGGGCGGGAAACAAGCTAGGC
TGGCAGAGCAGGATGTGGAAGGACGGATGAGAATAAAATATGAGTTCAATTCTTCTAGCT
TTGTTTTCTCTGTCATCTGCTATTTCTCCTAGCAGTGATTCTATTCTTTCCTTGTTCAGT
AAGACATTACTTCAAGAAAATCTTTTTTTCTTTTGGTGTGTTTTGTAAACCTCTTCTCAT
TCTATGCCTTCTAAGAAGTCTTGATGTTTAGACCAATCTTTTTTGTTTATCTCTGGTCTT
TGCTCCTCATTCGCTTCTTAAAACTGGGTCTCATTCAACAGAGTTAGTTACCTGGCAAGC
TACATCTGTTCCTTATATCACCATTTTCTTCCTCATTGGAATTACCCTCTAGGCTGAATG
TTTTTTTCTTTGTGCCTTATTCCTATTTCTAGTTTTAGAAAAAATTACAGTTTCAGGCTG
TGTTATTTCTGTGTTTTACGAAATGTAAAAATGCTTTTGTAAAATTTAGAGTATGACTCT
ATGCAGGATATTTCCTTTTGTCTTATTAAGAAACTCTTAAAACAAGTTGGTCACTTTCCT
TTAAGGCTTTTGCAATCTCCAACTAAGTAGGAGTGTGATATTTTTAATCGCATTAATTCT
AAAATAATTTTGTCTACTTCCTCCTGAAGTTGACGTTTTCAGAAAGGTAAGTAAAAAATT
TGTTGAGATGTTTTTCTTTTCTCTGAATGAAAATTAAGTAACCAAAATTCCCTATCCTTG
CTGATTTTACCTCTATTTGATGCTGTAATTTGCAATAAGAAAGCCTCCTTAGCCTGGCCA
GATAAATTGTAACTTTTTTTCTGACAACAATTTCACTACAGTTCTTTTTCTCCTTCTATG
CTTATTTGACTTCTCCGTTCTTTAATTCTAAAGAAATGTATTTACTTCTTCATCCATCCA
TCCATCATCCATCCATCCGTCATTCATTTACTAAGCGTCTACTATGAGATTGGCACTTCT
GGGCACCGGGGATACAACAGGGAACAAACCGTTCTATTGGCTCTTTCTGTTGAAAACGGT
TTCCAGTGCCTGTTCTTTGTTCATTGAGCAGTGCCCCTGTTCCCTCTTAGTCAGGCCTCT
CACACCTTCTTGTGACTGTATACTCATATTTGGTGTATGGTGATGATTTTGCTGCTTATT
TCATCACCAGCCTCACAAGACTTGTTCTGATTCCCTTTTTTTCCTTTAAAATCCTTTTTC
TTTCTGGATTCCTGCCCCTCCCCCCTTTCTACCTTGGCACTCATTATCTCTTCTAATAAG
CTCAGGACTAGAGAGGTACTCCTTTTCACCATCTTCTCCCACAGTGGGACCAGCTTGCAT
TTAGAATATTAAGTGGCTGGCTCTCACCGCAGGCAAGAAGACAAACTTAGCACAGGGCTT
GTGTGTCAGAGGAATAGATATTTAGATAATTCAAGGCATATGGTTCAAAGTTCTGTGTTT
CAGATGAATTTATATCTATCCTCACTCCTCTCAAAAAGGAACAGCAAGAGTTTTCAGTGC
AGCCACAAGGAAATGTATTAGCAAACTGGAAGGCCATGAAGGGGAAATTTCAAAGGTGAG
TTACTTTCTAATTTGGAGCAGTTTCCTTACTTTCAAAAGTAGACAGCATGCTTAGTATAA
ATAGTTCTATTGGCGCTGAGGGTACTAAGGTTTGTCTAATTATCTCATTCCTTCTGAAAA
TCAGTTACCCACACTTTACTTTTAAGCGTGTCCTCAAATTCAGCATAATAAATGATTTCT
AAAACCTTTCAAAAAGCATAAAACAGCGTTCTCCTCAGCCATCAGCAAGAGATTTAGTTA
GCTGAAAATATTTATTAAAGCTGTTTAAGAAGCTTATGGAGTGCATTTCCCAATTCTAGT
AAACACACAAATTTGTATTATGCAAAAATATGCTGTGCAGCAAGTGTCAAGTGTTCTGTT
AATCAGATGCTACTGAGGAAGTATTTCTTGGAAATATTTAACACTTATCAAAGTTTAAAA
TGACCTGTTTTGAAACAAAGCTGCAGCTAAGGATTTTGTATAAGCTCGTCCCAAAAACTT
GTTCGCAGAGCAGGGCCATCCGGTCAGTGATCTGAGGTTTTAGATGTATCCGTGGAAAAT
TTTAGAGAAGGGTGGGACGTGATGACTCTCACCTCCCTGCTTAGCCCAATTCCTTGGTCT
CATACCTGAGGTCAGATTTGCTCCTTCCTTGTAAAATATCAGCTTGATGGTTTCAGGGGT
CAGAAGGCTCCGCCTGGACCCCGGAACTGCCCACTGCCCTATTCTCTTCTCTCCTGCTCT
GCACCTGCTGCCGGTGGTTTGCTGGCCTATCAGAGCTGGTCTCTGAGACAGTGCAGAGCA
CATCTTCTTTGCAGGCTGGGAGGCCCTAGGGACTGGCAGGAAGAGGGGTGGGGAAGTGTG
GACATGGGAGACAGGCTGAGGAGAGAGCCTGAGCCATGTTCCCAAGTGTCTGACCTAGTA
GTTATTGACAGGGCTAGTGTGTCCCACTCAACAAGTTCACATCTATTTGTGTGTGTGTGA
ATATAAAGAGGACCCAAAGTCTGTATTATTGAATTTTATGTTTGTTAAGTGATATATTGC
TTATTGAATTGCCATCCAGCAATGGCATTTCTCTGGAGTGCAAAGCTAAAGGGTTCATTC
ATTCATTTAGCAAATGCTTTTTGAGTGTTTCCACTGTGCTAGGCACTGGTGACCCAGTGA
TGAAAAAACAGACATGGCCCTGCCCTCATCCAACCTTCAGTTGTAGAGGAGGTGGCCCAA
ATCGTTGTCTTCCGATGGTCTAGAGAGGGTTATAAGCATGATGCCCAAAGGAATGGAAGA
CTAACAGTTTCATTTGCCTGCCGCACAGATACCATTTGATAATGCCTGGCATGTTAGGAG
GCACTCAGAACATATTCGTGGAAAGTGCTGAATTTTGAGTAGCAATAGAAAGCCCCCTCC
TGTAGGCCCTGACTTATATTCTGGCATAGATTGAAGGAGGATCTGTGTGCGTTTGATTAC
AGAAAGTTGGGTTGCAGAGATGGCAGTGGGTTTGGGTATGAAGGAGACCAACTTAATAAG
GCATCTTGAGTCTTGGAAAGAAGCCAAGGGGGGAATACTGAAATTGTCAGGGTGCTTTGG
TCTTTATCCTTAGAATTGTGAGGGGGGAGGCAATTAAGCTTTCTATCTAGATTTTAATTT
TCGTGTGTTAGTCCCTGCAATATTTTTCCCACCGTGGAGGAACTGCTCTATGCAAGACTA
AATACCAGGCTGGGACGGTGACAGGTACTGAGCAATGTCCTCTTTTTGCTAGTTAAAAAT
ATATTGGGAACCATTATGCAAACCTGTGATCATTTTTTCTTTCTCTTTTGTAGATTTCTT
TTAACCCCCAGGGAAACCGTCTTCTAACTGGCAGTTCTGACAAAACGGCGAGAATCTGGG
ATGTTCAGACTGGTCAATGCCTGCAGGTTCTTGAGGGGCACGCTGATGAAATCTTTACGT
GTACTTTTAACTATAAAGGCGACATCATCATTACAGGTAGGGGAGAAATCACCACCACAG
ACTCAGTTTTCCTTTTAAATCAGCTATTAGAGTTTCTAAGCTGAATACCAAAAGGAATTC
ACCCGCACCCCTCACCCTTCTTCCAGGGTCTCTGCTCATCTTGCTGCATTCTACATCCAT
TATTTTAGTTGCATTGCAGAACCGCAGGAGTGAGCTCTGTTACTGACTGTGAGACTTTGT
GAATTTTGAGTTTTTGTTGCTCTGGGGAAAATAAGAATTTAGTAGCCTGCCTTACTGGTT
ACTACATTTCCCTGGGCATCAACCGTCAAATGGTTAATTTTCAGCTGATGTTAGTAAGTT
TTAGTAACTAAAACAAGTCAGGCCCGAGTTCTCCACCGCTGGATTTATAGCCCATTCAAG
GTTTATTCTTGGAGCTAAGTTGTTTTCTCCTTGGGTGTCCCCTGCTAACACATTAATGTT
AGGGGAAAAGAACACATTTTGAGCATTTTTCAACCACTAACAATCTATTGTGAATTAATC
ATATAAGCAACATTTTATAAGAACTGGATTGAGAATAGGTGAATTTAGATTGCGGAAAGT
AGGGGGATGACAAGAATATGGTGTAATGTTAATGTGGTTCCTCTGGAGGAGGCCTTGGCA
GGGAGTGGGGTGCTACCACTGAGGGGGAGGGATGTCCTAAGAGGGCACAAAAGACCAAGC
TCTCAGTGATCCTCATTGTGTCGAGTAGATTTAAAAATTGCTTATCTGGTCTAATAACTT
AAATGTCACACACTCGTGCTTGGCTTTATATATTGGCTGATTAGGTAGCTCCCTAGTCAT
ATAACTTCAGGGGTGCTGAGAATACGCTCCCCTTTTGCCCTAAAATACCTCCCCTTTCTA
CCTAATTATGGATAATTTCTAAAATTTCAGATTACTTTCTTTGGGTTTACGACTTGCAAG
TGTTACTAAAATGTAGATACTCCTAAAATGATACATAATAAGCCATATATTTTATTGTGA
ACACAAAATCAAATCCTTTCCCATGATGAGAAAAGAGGTGGGAGGCTGTGATAGAGGGCA
CAGGATGCTCCTGTAGGGAGCTGCTGCCAAGTAAGGGAGAAGGAACCCAGGGCCGGGTTG
TCAGAGGACCAACCTCTCCTGGTCCATGTGTCTCATGTTAGCCAGCTCTGCAATATCTCT
GCTCTCGACTGCAAAAGACCCTGGAGAGCTTAAGGAGGGAATATTAATTGTCTGTGCCTT
GTTTTAGAGCTGGCACTTAAATTCCTGAGCTCTTTTAAGATATGATTGATTTATTTAGTG
TATCCCAATGCAACAAGGTGCTAAATACTGGCCCACTGGACGACAGAGCTTGTTAGAATG
GGGGGTCATACTTCTGTCTTGCCAGCAGAAAAGCCATCACCTTGTTTGAACCGATCTCGC
CTATTTTCTCGGCAGCCCCCAGTGTGATGAATTGCTTGCATGTCTTAGTGGACTGCCTGA
GCTTGGGTTTAGAATCACAAACTGGAAGAAAACTGGCCATCGTGTTCACAACATTTTTAA
AAACATGAAGTACCTTTTGGTGGAATAATCAGTTTTCACAGGCTTTCCCAATCCTCATAG
CCCCCACACTTCTTATATTGATGTTACGAGTCTGGCCCCTGAGGTTTAGAGAACCAGCAG
GGCCCAGTACTTCTCCACACCAGGGTTGTCATTTCCAAAGAGGGAATGTGAATGGTGCCC
CTTGGGGAGGAGTATATGAAAGCAATTTGGAAGAGTCTCTATCATAGTGATGGGGAGGGT
GGGAAGATGCAAATTTCATATTTAGACGGATGATGAGAAGACTCTATTGACATTTTGAGG
TATTCCAAAGTGGAATGTGCTGCTTCCTCATAAACTAATCACCCAAACCTGGGGATGGTC
AAATTCACTGTATTTCCATTCGTGGTGATGTTCAAGGGGAGGGCAGAGGGAATAAGCAGA
GGGAAATGACTGAAGTGGGGGCTTTCTCAGGTCCTCTCCAATTCTAAGATGCCATCAATC
TTTCTGGTGTGAGGAGGACATGAACTTGCTCACTTAAGGACTGACAGAAATCAGGCAAAA
AAAAGAAAGAAAAAGAAAAAGATTCCCTCTAAAAGAAAAAGATTCACGCTAAAAATGCCT
GAACTTGGCTGCACAGGGGCTCTGAAGCTGGGTGCTGAGAATCTAGCACATTTAGCACAT
TGATAACCGACAATGACCCAGAAAATGTCAACTTGTAAAAAGAGAGAGGTAAGTGAATAA
AATAAAGAAAAAATAACTGTGAAATTTGTTTTATTAGGCAGCAAGGATAATACCTGTAGG
ATATGGCGTTGACTGAAGAAAGCCAGTCGATGAGCAAACTTGCCGGCCATAGTGATTAAG
ATCTGGAGCTTTGCAAATACTAAGCAAGCTGTTTTGATATTTTGTATGTTTTCTCTTTTT
CCTCAAATCACCCGTTTATACACTGTTCTTAACTTCATGGATGTGATCATTAAAACTGAT
GAAGTTATATCATTTCTTGATATTATTTGATGGAGATGACAGGAAACAGCATAATGTTGG
GCAAATGCCACTGGTTATTTCAATTTTGTTTTATTTTTTAATAGCATCATGATACTGATA
AATGAAACCATAGTAATTTAACAATGTGTCTCCTAGATTATACTTTGAAGATTATTATTA
TAATTACTGTTGAATAAAGTTTTGGAGAAAATTCACTGTGAATTATACACCTCTATTTAT
CATGTATGTTTTTAGGGGGACATGTATGTTAGGAATTTAATTAGAAGTTTTACTATTTAG
TTATTTTACTTTTTGCGGCTAAGAATGAGAAAGGCAATTTTGGAATAGAAGATTAATCTT
TCTTCCCTCATATTCAAGAATATATCCACGCCCATCCCTCCAAAAAAAGTTGAGGACCTA
TGATGAATAAAATGAGGGCAGCATATAGCGAAAATAAAATGGCTCTCAATCAACAGCTAA
TATATTCTGGATAAACAGTTGGCTGAAAAAAATGTAGGCAGGTTTATCTATAAGGAAAAG
CTAAGCAGAATAGACTTTCAGGCTATTGAAGTTAAAAATCTGGGTGGAAAACAATTGAGG
TACCAGGGCAAATCATCAAACAGCAACCTTATTGCTGCCGAAATGCTAAAAAATGCTTTG
TAAAAGGCCTTTCTATGTAAAAGGACCACGATGCATATTATGTGAAAAGATAGAGCACAA
GATAAAACCAGTGATGCCTGAATCCAGAGCAAGAGAATGCATGAGAATCTTATGGAATTA
TTTTCTTAGTAATAAAAACAATAGTCAACGTGGCCTGAGTGCTTACTGCGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 11296..11368, 15043..15187, 16586..16644, 18894..19016, 22716..22815, 26975..27082, 28803..28909, 29808..29910, 30571..30685, 35078..35154, 36953..37115, 39397..39431
1001..1040, 11296..11368, 15043..15187, 16586..16644, 18894..19016, 22716..22815, 26975..27082, 28803..28909, 29808..29910, 30571..30685, 35078..35154, 36953..37115, 39397..39428
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved