Equus_caballus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Equus_caballus GNB2L1
Equus_caballus
GNB2L1
14
SNORD95, SNORD96
1462..1529, 2782..2860
6775
caggtgccgactgtcttgttcgcagcaggtgctcccgcagccgcgcgcgtttactgccc
ggcattgctccggggcgcgcccgaacttccccgtaactcgctcagtctccgcagcgccac
gcgcgaaggcgtcgttccacagacgagagcctagggccaacacggcctgcaagcggagga
ctgagcggtacgagggctcgccctttattccgcgcggccgccagcggcgcctgtcaccct
gatctggccgctccctctcagacacccgcgggcgctgccggcccagcctctcgggcgggg
agctcgcgcgctcccggcctcccggcccggggccccgcacgcggaggcacgtcctcccgg
gccgctccgtccctgagggcgctccgcgcagcccacaggccgccttctctcccgtccccc
gccggccttccgctccggcactcagggcgcctccgtccggcccggcgaagcccctccggg
cacggcgtgcctcggccggtgtcaggcagaagcctcgggagggacggcagcgctgcgcgg
cgtcggtcctggctgaggacttcacccgggcgctgtgtactggaaaagccgcaggccgtc
tttcccgccgcggacccagccactcgcggctgcggctcggagccacgctcgccctcagtg
gccggagctccggcggaaggcgggcgcgcgctgcgccgcgtagggccgcggcagccggcc
gagcctatgggagcgcgccggcacggccccgcctccgcttcgtggacgtcgcgctgcaat
caacgtttgaggggccgtttcgagccctcgggcgtgttgatttcggaatgtatttgtaca
gcgctgcccagttctgttgcgtggcggaggggaccctgtggtcgtgttatttcgcctcgt
cctaggcaagacacggcagcgccatcttgagcgggagtgacccataggggtcgccatttt
gctcgagcgggcggctatatccggttccggttggaggcggtctctctttttctcggcggg
gccgcggcggcagcggccgtggtgctggtgtctgactatccggttccatcctcgtcgctg
cggcgacacccgcactcgccgccgccatgaccgaacagatgacccttcgtggcaccctca
agggccacaacggctgggtaacccagatcgctaccaccccgcagttcccagacatgatac
tgtcggcctcgcgaggtagggctgaggtgtggggcggaggatcggggaagaagggagttg
cgcgcgccgcgggctgggctagtggcgcgcgagttggcgacccggaaaactccgtccggg
gctgagtggggcacgcgcacccttgcctatcccacagcccaggcgagcccgtggctgccg
ggagggtggcggcgtgggcccctttgctctctgcccgtctgcgtgcaggtggggctcggc
gtgggccagaagccgggcgggcgcggcggtgatgcacccaacatgccatctgagcgcccg
tgctgagacccagaggctgtttctgagccgccgcccgccgtcgcggcggggccgtggggg
cgccggtctgcctcagccctcctgccccgctcttccttctcgggctggtgcaccgactgc
gtctgcgccacagcgttcggtggccagaggctgggatcgcctgggacttaagagcttgct
gagtggtgcacgtgtcagtgacggcgtccgagtgcggcgtgtggagcgactttctaaact
gagcgctctggcggccctcggcactggtcgccacagctgctgcttgtgcagcagacctca
gatgagtctcgaaatagatgtcgaattggtcaggatgtcagaaaggggcatccaagagct
tgggtgaagttctgttcaccttaaattctcatggtaccgcttaggtctactcgcctgttt
gttcttttttttgtttttgttttgaggaagattagccctgagctaacatccatgcccatc
tcactctactttgtatgtgggatgctgccacagcatggcttgagcggtgggtaggtctac
acccaggatctgaacctgcgaagcagagtgtgcaccttaaccgctgggccatctggtcag
ccctgcctcttattcctgagcagtgagtcacgtggccttggctagttactgctcacaaag
cctgcatttccccttcccacctaagtgtccttaacttgtcttgtaaatccactggtgatt
tggaggcatcctggattagcccgtaggtgagcaagtgggctgcaaggttcctcactggct
ttccttttctgttttacctttccttagacaagaccatcatcatgtggaagctgaccaggg
atgagaccaactacggcatcccacagcgtgctcttcgaggtcactcccactttgttagtg
acgtggtgatctcttcagatggccagtttgccctctcaggctcctgggatggaacgcttc
gcctctgggatctcacaacgcaagtagctgctcacttagctctagggccttggggaaaac
cggggcagaaatgaggtagctgttgggaagtggttttctagcggtgaccaggtccgctga
gggcactgtaaggtgcagaatacctggagaagtggttggcgtggtttggcctccctcctt
gttgctcttgaggagtgatgtagcattcttgagcagtggtctggtgagcagttttgtcag
ataactgcacttgggaacaggtgacagtttgaaccttttttatcttgggagttcagtctt
cggatgatcgggtataatggaggatcctggtgatgatagaccacattgtcagccaatccc
cacgtgggaatgaggacatgtcctgcaattctgaagggattctctgtcattgttctcagc
caaacccctactgtgatcagagccatgactagggtttcgtgagtaatgcagctctgctgg
gacaggaaaaaggccagggaaacagtctgactggaagaatgtttgcaaactctggagagt
gaccaagtcctcctcctcaggggcaccaccacacgccgatttgtgggccataccaaggat
gtgctgagtgtggcattctcctctgacaaccggcagattgtctctggctcccgagataaa
accatcaagctatggaatactctgggtgtatgcaaatacactgtccaggtaaagtgaagg
cacatgcagagagcacgttgaaggttctcttccactttccttaaccttggccttatgtgg
tgatttcaagcctcatctggaatctaaaggggttgtgttgatcttcaaggtttgggttct
agggatatgaatgcaaggctgtcaacatgtatcccatgtaacttaggggaggggtggggg
tctagagttttatgagacaagacagttttgccttgtgtcctttctgttctctgtaggatg
agagccactcggagtgggtgtcttgtgtccgcttctcacccaacagtagcaatcccatca
ttgtctcctgtggctgggacaagctagtcaaggtgagtttggagcaggggtgtgggcctt
taccagccggaatatgttcctgctgcctcccaggtggtcagaggccagaggctccaactt
tgaaagctttgtccctcagttgacatttttcctcttgctgttttctcaatacaggccatt
agtgtttgacattttgtttgaagtagctaattgatgaacccagagtcccttgtaaggcaa
aacacatagcatttgttacctgttttatttctaacgactttcaagtggccaagacaaatt
ctttaacctttttgttactgatagaataaaaaaatggctaccctatccaggaatgctttt
aaaaagtgtgccatgccttttccattaagcttgagctctcctgaccctggctgatccatt
agctgggttctttacctatgaccccctaaatttaggtgtggaatttggcaaactgcaagc
tgaagaccaatcacatcggccacacaggctacctgaacactgtcactgtctctccggatg
gatccctctgtgcttctggaggcaaggtattcagaggccaggagcctcctgctcaatggg
ggacagtgtcttagaaaggatacttaacacaatagcattccaataagtgtttctaaagat
cactttctgaaaatgacgtagatgaggcatagtgtttcagggacaggagtttcttctgta
aagcttgtttcttgaagctggcgagcttatgatcctgttttttcagaactcagtggtata
tttagaagttgtcagagacttttggtggggttggtgaggtcatgtattgaaggaaaggtt
aacagagataagtattggtacttgagttgtcagcttttggcaagttcagcatacgagagg
gaagttaacaactaagacagaatcttgacacaggtggggttcacatctggaagagatcgc
gtcaccctgacccaccttccctgtttgctcaggatggccaggccatgctttgggatttaa
atgaaggcaagcacctttacacactagatggtggggacatcatcaacgccttgtgcttca
gtcccaatcgctactggctctgtgctgccacaggccccagcatcaagatctgggtgagtg
tgggctacagttggaaccaagtacctagctgcactctgccagacgtggcattgtgatttc
ccaagtgtgtcatctgactcactgctgggatttgagcttcctgaacaactgctagctgtc
agactgtccttggagactcaggagaagcgggttaaaagttgctgagattggaatttgcaa
tgatgggaaagctttgccttcttgaaagggatgaccgattgtaacaacttaacccacact
cggcaaaattgacattttggtctggataattctttgtgggggtgaggggtgggtaggtgt
attttagaatggataggagcatccctggcctctgctccccactagattcctgtagcaaac
tccctttcccttagtgacaaccaaaaatgcctctaggcattgccagatgtccttgagggg
atgaaaaatcgttctctgttgagaatcaccgagtgcaaagcggcttttgaaaggggacat
gcttgtcttgaggtttaagtgtcagtggcattaaagtgtaaagtgttgcgtgtccttact
cacgttttgtctttcccaggacttggagggcaagatcattgtagatgaactgaagcaaga
agttatcagtaccagcagcaaggcagagccaccccagtgcacttctcttgcctggtctgc
tgatggccaggtaagagtgtctgtctttgggtgcctcagcttctaccttctgtctctcct
ttctgttcttagtgtgtcttgtgtgccaatgacaagatgagccaagttgatttgggagga
cctagttagctgtgccagtgaacatataatatgtcttcttgcatcggaaggaagattgat
ctggagggcagtggttatctgtcttcgattaacaccctgcctgatttgaccagtttataa
atgtatgaatccttactaccaactgttgctagcataatcgcccacaattgggtagagcga
ggatcttaaaagtatctttgttacatcagtgggactgtagagtttcatggctctgacctg
acttacgctgtcgtttgtcccttgcagactctgtttgctggctacacggacaacctggtg
agagtgtggcaggtgaccatcggcacccgctagaaatacatggcaagctttagaaataaa
aaactgtgttttaactttgagaaagtgtctttctgtgatgagccaaaaaagctacttcct
gtgctgtgctgcttataggttaaaaagtctcttcagttaagatactgacaaactggaagc
aaggtggtgaaaaaaatgggcaggtaaacaagacttaggggagaagagatgtcatagact
ccctgtagggtttgggtggcatcagatgtgacatggaacttatacagggtaggttcccca
acttgcttcatcacaatgtcctatatttcagatacagattcttagggcttcccttaaatt
gttcttgagtgaattcttccagttcttgagtgattattccaaagtggttgcagttggttt
aggttcttgggtccaactcttaacacagaagaaagaactgaaaaaacatgcattttgtaa
tgccttgaaaggtaagattataattcagacaacattctgaaactcgccaggttagcattg
tctacatcaaattggggctttggttaaaaatggagaattttttttaaaaccctttagggc
aagggaactctcaccagaagaattgctgcttaataacagcaacttttgactccttccata
atgggaaattaaaaactgtagaatagtctgcaggcattcataaataggatcacagctggc
tttttctcacggagtggctaaatgacaagcacagtgtattggagtggcctatacgtaccc
tcctttttctcctccaactcaacagtggtattgaggcctctccctggcttcagcttcaac
tttgtgggacttgaactagatagaatcacacataaaaaagactttggaaatgtagtgttc
ctaggtcctggacttgagagccatgagtgtagtgattgttgggaaaactgtcctaaatcc
tcacagcagtgatagaaaggaagtggaaaatgattttaagtagattctgaagggcatggc
aataaagttggtaggatagtcaaataaggggagaagggtaggatttgtacctcaat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1214, 2307..2478, 3020..3167, 3416..3511, 3935..4045, 4472..4612, 5179..5289, 5667..5775
1106..1214, 2307..2478, 3020..3167, 3416..3511, 3935..4045, 4472..4612, 5179..5289, 5667..5732
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved