Equus_caballus Locus Poly:14:SNORA76
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:14:SNORA76
Equus_caballus
Poly:14:SNORA76
11
SNORND104, SNORA76
1001..1070, 1259..1390
2390
AAACATACGAAGGAAATAAAAGATAAGCAGAGATTGTGATTGCTTACTGTTCCCTCTCC
CGGTAAATCAAGCTCTTACAGGGCAGAGCCACATTCCTATCCGCTAGTGAAAAGTGTGCC
TGGCTCAGAGTATGAACCCAATACTTACAAGCACTTTTCGCTTTCTCTAAGTTAGGCCTT
CTCTCCTTTGGGCTTCCACAGTAGGCTATTCATAGCTCTATTTTAGCATTTATCAAAGTA
CTGCGATCACGTAAGTTTTCCACATCACACAAACCCTTTAGAAACAACTATTTGTTTACC
ACTCAGAATGTGCCAAGCGATTGACATTCATTCATTTAATCCTTACAACTTTTTTAGATA
TTCCTATTTTTCAGAAATTGACGCTCAGAAAGGTTAAGTGATCACGGTCATAGATGGAAT
TCATCACAAATACAGGATTTGGTTGCACATCGGATTACTTTCAAACACAAGCTCTTTCCA
TCAGAAGAGGTTACTTCGAACTCAGGGGCAAGGTTAATTTTGTTCACTTTTATATCCTCA
GCTCCTAGCCTAAGCTCCTGACACAGAATATCTTAAACAAGGTAGGCATTACTTGCGTCC
TGCTGTTTATGAAATTTTGTTCTGTGTACTGGAAAGAAATGCACTAAACTCAAGCCGGCA
ATAGAGATTTGGAAAAACACGCAAGGCACTGTACGACTCTCAGTCGTTCCTAGAGTCCCA
TCTCTATGGTTAGCAATGTGACCGCTCTATAGCCTGGAGGACTCAGAGAGCACGGCCAAT
CATTAGGCCACTTTACAGGCACGTGGCCGGAAGTTCGACTTGCTATTGGTTAATAGCGAT
AAAGCCCGCCCAACCACATCCTGCCTACGCCTTTAAGTAGGAGCCGGGAGCGTCGTCCCG
CCTTTCGGAGACTGTGAAGCCGGAAAGGTGAGGTTGTGGTTCTTCTGGGTCGTGGTGGGT
CGCTCCTCAGGGTTGGAAGCTGGGTGTGGGGCGGGCGGCCAGCGGTGATGACATCCCAAT
CAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTGGAATCTGAGCCGGGCCGCC
GCCGCGGCGGGGAGAGACCGGGGCTGCGGGGGCACATCCGCTCAGCCACCTCTCGTTCTT
GCAGATCCCGGCCGGACTGAGGACGTCGGATATCACTGTTTTCTCAGCCCTTGGACCTTC
CCCCAAAGCTTCTCAATAAAATGGTTTGATCCCATCGCTGGTGTGTTTCTTGTCGTGACG
CGCTGCCTTTGAGCCCCTGCTGCGCCTGCACGTGGCGCCGGGGGTCAGGCTGCGGCGCCA
GAGTACGCGCTTGCGCATAACTGGGGCCGCCTCCCGCTCGCCGGCGGCCCTTTTAACCGC
GAGCGACAAGGCGGCACTGGGTGCCAGGAGCGGGAGGTTTGCCCGGGATTTCCCTGGAAG
CTTTGACTACGATCTCTTGGTTAGTGAGACATGACGTGCAGATTCAGTTAACTGCGGCCC
GGATAGCCTCCGCCGGGAGCGGAGATGAGAATCCGGCTGCGGCCTCGCGTAGTTTAAGGG
CCGTGGTGTACTTCCCAGGAACTGGCTTCGGTCTTGAGCTGCATGAACTTACCTGGCTAA
GGTGCGGTCGCAACCTATTTAGAGAAACTACCATTTAGGCCCAACTGCTTACGTGGATAC
TGTGTGCTAAGCTTGAGGCAAATTAATGTGTCCTTCGCCTAAACAGCTCACAGTAACAGT
AGGTGTGAAGATGATTTCATGCATGCTGGGCACAACATAGGCTCCTACAGAAAGGCAGGA
TCCTTCGTGATCCAGATTCTAGGTGATTAATTTCTCACCTAGGCTTAGGCGAAATGTGCA
TCTGTTTTGAGTACAGGCAGCACTGTTGAAGGGCAAGGATGCACAAGTGCGGTGCCTAAA
CTGCTTTGGCGTTTAATAACTAGAGGGCCCCCCAAGTTAACGGGTCTACTAGGCAATTAA
AGGTGTAAGCTCCAGCTCAAGAGGGGGACTGTCCCCCTTAGGTTTTTTATTGGGGGTTTA
AGACCTTATCCATCTGTTGAGGACGAGGCCTACCTTGGATTCTTAGAAGAGGACTGGCCC
ATTTACCACCCGGGAAATTGAAGCCGCTTTTGGCAGCTGAGGGCCCCAGTGAGAGCCCTG
TACCCATTGTTTATTCTGTCTCTATTATCTAAACAGGATTCAGCAGAAATAACTTGGATG
CTTATCTAGTATTTGATGAGATTATTTATTTTGTGAAACAACACAAGCGATTGTAAATCC
CCACAACTATTTGATGAGTGCAATAGGATACAGTCATGTGTAATCTCTTTACACAGTAGT
GCATCTAGTCCTTTGCTTTTAGTTATTGCACAAAAATTATAAAGACCATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved