Equus_caballus Locus Mono:55:SNORA51
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:55:SNORA51
Equus_caballus
Mono:55:SNORA51
19
SNORA51
1001..1132
2132
TGGACAACTGAGAGGAAATGAATACATTCCTAGAAACATACAACCTACCAAGACTGAAT
CACGAAAAACAGAAAATCTGAACAGGACAATTACTAGTAAGGAGACTGAATCAGTAATCA
AAATCTCCCAGCAAAGGAAAGTCAAGGACCTGATGGCTTCACTGGTGAATTCTACCACAC
ATTTGAGGAAGACTTAATACCTGTCCTCCTCAAACCTTTCAAAAAAATTGAAGAGGAAGG
ATCGCTTCTAAACTAATATTCTGAGGCCATGATTACCCTGATACCAAAACCAGACAAGGA
CACTACAAGAAAAGAAAATTACAGGTCAACATCCCTGATGAGCATAGATCCAAAAATCCT
AAAAAAATTAGCAAACTGAATTCAACAGTACATTAAAAGAATAAAACACCATGATCAAGT
GGGATTTATTCCAGGGAGGCAAGGATGGTTCAACACCTGCAAATCAATCAATGTGATACA
CCACCTTAACAAAATGAAGGGTAAAAATTGTATAATCATCTCAATAGATCCAGAAAAAGC
ACTTGACAAAATTCAACATCCATCCATGATAAAAACACTCAACAAACTGTGTATAGAGGA
ACTGCACGTCAATATAATAAAGGCCATATTTGACAAGCCCGCAGTTAACATAATACTCAA
TGGTGAAAAGCAGCAAGCTTTTCCTCTAAGATGAGGAACAAGACAAGGATGACCACTTCT
GCCAGTTTTATCCAACATAGTACTGGAACCTAACCAGAGAGATCAGGCAAGAAAAAGAAA
GAAAAGGCATCCAAATTGGAAAGGAAGAAGTAAAATTGTCTCTATTTGCAGATGACATTA
TATCACATACAGAAAACCCTAAAGACTCCACCAAAAAACTGTTTGAACTAATAAACTAAT
TCAGTAAAGTTGTAGGATACAAAATCAAAATACAAAAAATAGTTGTGTTTCTATACACCA
ACAGTGAGATGTCAGCAGGAGAAATTAAGAAAACAATTCCTGGCCTCCTGGTGCTTACCA
CAGGCTGTGTTCTTCCACTGACTGTATAGAAAGAGGAAGCAGAGTAAACCCACCCCATAT
ACATCTTATCCCAGGCCCTTTGCCTGGTGTCTATTGTGAATGGGGGAACAAGGAAAAAAG
AAGAAGAAAACAATCCCTTTTACAATTTCTTCACAATGAATAAAATATCTAGGAATAAAT
TTAACCAAGGAAGTGAAAGACCTGTACACTGTAAAGTCTAAGACTTTGATGAAAGAAATT
GAAGAAGACCCAAAGAAATGGAAAGATATTCCATGCTCATGGATTGAAAGAATTAATATG
GTTAAAGTATCCATACTACCCAAAGCAATCTACAGATTCAGAGCAATCCCTATTAAAATT
CCAATGGCATTTTTCACATAAATAGAAAATCTTAAAATTGATATGGAACCAGAGTGATGT
CAGCATCATGGCAGAGTGCGCTCTGCCTGTAAATTCTCCCCTTTAAGACACAATGAAAAG
GACATTAATATTCCAACAGAGAACATCCACACAACACAAAAGATGACTGAGACCCATGCA
GCCGTACATTGGAAGGTGGAGGTGCTGGAGGCGCCCCCCTCCCCCCAGGAGGTGGAACAA
GGTAAGAGAAATCTTCTCTTCCTCACTGAAGGGCAGCAACCCAGGGATTGTGCACAGCTC
TGAGGGGAAAGGAGGAAGGGAGTGGCCCTCTTTGGGAACACCATCACTCTCCAAGGTCCC
TCACAGCCTGGGAGAAAGCCCCACACAGATGTGACTAGCTATCATGGGCATGTCTTCATC
AGGCTAACACCCTAGGAGAGCAGATAGCAAGGGCAGAGTAAGAAGCCCCCAAGATCATGG
AGGAGAAAGAAAACGCCCCTCCCCGCTGCCTCATGCCCCCGTTCAGCACCTGGGAGCTGT
GCCACAGGTCACAGTGGGCTCAGAATACACAGCTCTTGACCCCCACCCAGTGGCGACAGG
TGGAAGCAGCGATCAAGTACTACCACAATGTGGAAGCACAAGCCCATACCATATAGCAGT
ATGAAAAAATGTATTAAGTCTCCAGACCAGAAGGAAAATGACAAGTACCCAGAAATCAAT
CCTGAAGCCATAGAAATCTATAATCTAAATGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved