Equus_caballus Locus Poly:5:SNORD113
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:5:SNORD113
Equus_caballus
Poly:5:SNORD113
24
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 1987..2061, 2954..3025, 4841..4912, 7067..7138, 8041..8112, 9018..9092, 9645..9714, 12191..12264, 13135..13204, 14064..14140, 14976..15049, 15954..16025, 16929..17000, 17909..17982, 18806..18882, 19775..19849, 20726..20797, 21686..21760, 22555..22629, 23492..23559, 24466..24537, 25633..25704, 26613..26687, 28104..28175, 30010..30083, 30982..31053, 32717..32790, 33691..33767, 34685..34759, 35878..35949, 36864..36938, 38144..38218
39218
ATCTAGTGTCCAAAAAGAAATATGATATGAAATATGTTGACTAATCAATAATGTATAAC
ATTGAGATTAACAGAAGTGGTATTGTCTATGTGGGAACTGATTGTATAGAAAGATGGTGG
GGATATTCAAGGATCTTGCTCTTGGTTTTTTTGTGAATCATGGATTTATTTTATTATTAT
CAAAGAATTAATGATTTAATCAATACAAATATAGACATAAATGAAGAAAAAGAGGCCCAA
ACATGGACCAGTGATGCTGACTGGTGGTGTATGTGTCTTGGTTGATGAAAACAAGTGAAT
TCCCAGACAAAACTCAATTAGTCCTGACCCTCTTTTGAAAATGATCCTATAGACGTCAAA
AATATACAAAGGTTACGTTTTTATTTTGGAGTCATAGATTTATATTTATTATTATTAATG
GATCAATGATAGAACAATTAAAGAAAGATAAATAAAGGAAGAGAAAGTGAAGCATTGTCC
AGTTATGCACATACGTGATGAGACAAAATACATTATTAATAAAAATTGAAAAATTGATGT
CTATTAAGAAATAAATGGATCAAGGGTGTTACGTGTTTGGCTGAGGATCACGTAGACATG
GATAATTAAGAGTCAGTTTTATTATTTTGGATTAGTTTCAAGTTTGAGGTTATTTCCTTT
AATAGAAAACATACACATATATAATGAAAAATTAATAAATACCTTAAAAACTGAGTAAAT
GAAGCATGGAAAGGAAGGATCAATGTAGATCAGGTCTTAATTTATTTTATCAACTGCTGT
GCTCTGTACTCCTCAGAATGGACACACTTGAGGTGACTTAAGCATCTTCCACGATCTTGA
GCTCTGTGGTCGCATCTATGCATTAGGAATGTGGAACCGATGTGAGTAATAGTCAAAGGT
CTTGTGTTGATTTGGGTGGTTTGCTTAAGAGCATTCACTGTACGATTAGTGTGAATTATA
AACAATTTATAAATGAATGAAGAGAGAAAGTGTGCTGATTTTGGACCAATGATGATAACT
GGTGGCGTTTGAGTCATGGATGATAAATAAAATGTGTCTGAAACTCTGAGGTCCAACAAA
AAGAAATCTAGTGCATTTTCTCTGTTTGAAAGGATCCTATAGACAGAAGTCAGGTATATT
CCACGATCTTGTTTTGGTCTTTGTGTTCATTTATGTATTTTCAATCTATTATTATAATTG
GAGCAGTGAAATACATGGTCTATAAACAAATATATAAATAAATAAAGATGAGTGAGGTGA
AGTATTGTCCAACTATAAAAATATGTGGTGAGGCAAGGAATACTATTAATACATTTGAAA
ACAGTGGAGTCTAAAGAGAAGTAAATGGTACATGACTGTTAAATCTTTGGCTAACGATGA
TATAGACAATAATAAGTAATAATCAATGTTTACTTTCTGGGTCAAGGACAAGTTCTAATT
GTTCATTTCCTTAAGAGAAAAGGAAATAAATATACTCTAAATTAATGATTGCCTAAATCA
CTGAAAAATGAAATGCAGAAGCAAGGATCAGTGGAGATTAGTTCTCAATTTTGTATCATC
TGCTCTCCTCTGTACTCCTCAGAATGGATGCCCTTGAGCTGATTTAAGCATCTTCCATGG
TCAGGAGTTCTGTGGTTGCACCTGTGTGTTAGGAGCATGGACAACAATGTGAGTGATATC
AACGTTCTTGTTTTGGATTGAGTGGTTTTTTTCAAAAAATAATTACTCTATTATTAAAAA
GTGTTAAATATAATCAAAGAAGCCCAAACGTGCCAATGTTAAATGTCTGATCTGAAACAG
TATCATGATTAATCCATATATGAAACACTGAGTTCGGTTAATGAAAGTGTTTTGTCTCAG
TGGAATTGATTGTGTAGGTGGATGTCACCGATATTCAAGGATCATATTTGTGATTTATGT
TTATTTCTATATTAGTGAATTACTCAATAACCAAATGTAGATGACAATAGAGAAAAGGAG
CCAATCCTGGACCAATGATGACCACTGGTGGCGTATGAGTCCTATGCGATGAATACCACG
TGTCTGGAACTCTGAGGTCCAACACAAAACAAATCCATCCCATGGAGTTGAAATAGTCCT
TTACAGATGTCAGGATATACAAGGGTCTTGTTTTTGGTCTTTGTTTTCATTCATTTTTAT
TCCATGAATATCATTGGATCAGTGAATATATCAATAAATGTGTTACAAATAAATACAATG
GGGTAAAGCATTGTCCAATTATAAAAATATGTGTTGAGGTAGCAAATACTATTAATATAC
ATTGCAAAAACTGAAGATGAATGAAAATAAATGGCACAAGTATGTTGTCCCTTTTGCTAA
GTATGATAGAGACAGTAATGAGTAATTGATATAGTCTATCAGTGGCTATATCAAAAGTAT
TCGGTCACTTAAGAGAAAATAAAATAGACATGATCACGACTTGCTAATTACCTACATCAC
TTAGTAAATAAAGGTGGAATTAAGGACCTGTGGCGGTAACGTCTCAACGTTTTTTTGTTC
TGCTCTGCTTTGTGCGTCACAGAATGGATATATTCCAGCTGATTTAAGCGTCCTCCCTGG
TCAGGAGCTCTGTCGTTGCATCTCTGTTTGAGCAGCAAGGAGACCAACGTGAGTAATAGT
CAATGTTGTTCTTGGTTTGACTGTTTTTTAAAAAATGTTTTCACTGTGTTGTTAAACAGT
ATTAAATATGATCAAAGAAAGTGAGACATGCCAGTGTTATAAGATTAATATCAAGCGTTA
TGTTGACTGGTCCATATATTGAAAAGCTAAGCTCAGTTAATGGAAGGAATTTGGTCTCAG
TGGAAATGATTGTATAGATGGATGTTAGAGACAGTCAAAAATCTTATTCTTGTTTTTCTT
GGTGATTTATATGTATTTATTAATGAATTAATCAATAAACAAATGTAGGTGGCAATAGAA
AAGAAGGGCAATCCTGGACCAAGAATGATGACTGGCGGTGTGTGAGTCCTATATGATGAA
TATGTGTCTAGAACTCTGAGGTCCAACACAAATGGAATCTAGTCCATTGTCCTTTTAAGA
AGGGAACCTATGGACAGATGTCAGGAATACACAAGGATCTTGTTCTTGGTCTTTGAGTTC
ATGCAGTTTAAAAATATTATTATAAGAGAATCAATGGCAGAACAAATAAATTTATAAATG
AATAAAGATGAAGAGAGTGAAGCTTTGTTCATTAGTAAAATATGTCATAAGGAAAATGAA
TATCAATGTAAACTGGAATGTTTAAAAAAAGGACCAAGTGCATCATGTGTTTGGCCGAGG
GTGACACAGACAGTGACATGTCAGTGCTCTCACTCAGGTATTTTCTGAATTTATTTTATT
AAGAGAAAAAGAAATAAATCTTACCCTAGATGAATAAATGCCCCAATGACTATGCAGATA
AATGGTGGAAAATGTGGAAGAATGAAGAAAATGTCTGAATCTTCTATCATATTGTCTGTT
TGCATTTTTCAGAATGAATGCATTGAGCTGATTTCAGTATCTGCTGAGATTAAGATTGTT
ATGTTACCTTTATGTTAGGAAAGAGACCAAGGTGAATAATAGTCAAAGACTTTACATTGG
TTTGAGTGATTTAAGAGCATTCCTGGTATTATTAAAAAGTGATAAAAATAATAAAAAAGT
TAACTACAGTCCACTGAGCAGTATGATGTGAAATATTATATTGATAAGTTGATAATATGC
AACATTGAGGTTGATTAATGAAAGAGATATAATCTAAGTGGTACATGATTCTATAGACAG
AAGTTAGGTTTATTCAAGGATTTTTTTCTTGTGATTTTATGTCAGGTATTTATTTTGATT
ATTAATGATTTAATTGTTACAAATGAAGAAAAAGAGGCCCAGAAGTGGACCAGTGACGAC
CACTGCTGCGTAGGAGTCATATATGGTGAATATTATGTGTCTGTGACTCTTAAATCCACA
TGAAACAAAATCTAGTCTATCTTTTGTTGTAAATGACCCCAGGGGTCAGTGTTAGGAATA
TACAAAGATCATATTCTTATTTTGGGTTCATAGATTTAGATTTATTTTCATTAATGAATC
AGTAATCGAACCGTTAAAAAATAAAAAAACGGATCAAGAAAAGAGGGTGAAGCATTGACC
AACTAGGAACGCATGTTGTGAGGCAAGAAATGTTATGAATAAAATGAAAAACATTCATGC
TCATTAAGCAATAAATGGAATAAGCATTTTGCTTTTTTGCCTAAGAGCCGTATGGACACT
GATAAGTCAAGGTCAATATTATTGTTCTGGGTCAGTCTCAAAGTTAAGAGTTTCTTTTGT
CAAGAGAAAAAATACTACATTATAAAAATTAATGAACGCCTAAAGGAATAAATGAAATGT
GGAAAATAAAGGTCAGTGGAGATAAGGTCTGAAATTGTTTATCGTCTGCTCTGTGCTCCT
TAGACTGGGTGCCGTCAAGCTGATTTAAAGATTCGTCTGTGGTCACAAGGTCTCGTTGCA
TTCGTGTGTTAGGAGACCGTGTGAGTAAAAGTCAAAATTTTGGTATTTGTTCAATACTTT
GTTTAAGGGATTGTTGAAAACTGTGAAATATAATCCATGAATCCAAATAACCCACTGAGA
AATATGGGATTTATATGAAGCATTATGTTGTATAATGCATAAAGTAAAAATTGAGAATAA
TTAATGAGAGAGATATTGACATCAGAATGATTCTAAATATATTAGGAATTTCTAGGCTCT
TCGTAGGTTTCTGTGAATAATGACTTTTAAAATTATAATTACTGAATTATTAATTGATCA
GAATTAATGTAGAAATGAGTGAAGGAAAAGAGGCACAACATTGGCTCGATGATGACTGCT
GGTGGCGTAGGAGTCGGATCCGATGAATACGTGTCTGGAACTCTGAGGTCCAACAGAAAT
GGAATCTGGTCCATTGTCCCAGTTTGAAGTGATCCTGTAGACAGAGGTCAGGAATATACA
GAGATTCTTGTTTTGGTCCTTATGTCAATGCATTTTCTCCCTATTTTTATAATTGAATCA
ATGAAATAATCAACATGCAAATGTATAAATAAATAAAAATGAAGAATGTGAAGCCCTGTC
AAATTATAATGTGGTTAGGCAAAAATTACTATAATATAGTAATCTGTTAATGTGTATTGA
AAAGACTGATATGCATTAGGAAAGAAATGGCCTAAGGGTGTTAGTTCTTTGGCTAATGAT
GATATAGACAGCATTAAGTAATGGTCAATGTTCATATTCTGTGTCAGGTGCAAGATTGAT
ATTGTTTGTTTACTTAATAAAAAATAAAATATCCATTACCCAAATCACAACTTACCTAAA
TGACTGACTAAATGAAAGGTGGAATGCAAAGCCCCATGAACATAATGTCTCAGTCCTTTT
TATCATCTGCCCTGTCTTGTGCTCCTTAGAATGGTCGCATTCAAGCTGATTTGAGCACTC
CGCCCTGGTCAGGAGCTTTCTGGTTGCATCTATGCATTAAGATCATGGAGAGCAATGTGA
GTAATGGTCAAAGTTCTTGTCTTGGGCTTGTGGTTTTTTAAAAGGTTTACACTGGATTAT
AAAAAAAAGTGTGAAATATAATCAGTGATCGCAAATCATGGCCAAATAATTAAAATGAGG
TTGGGGCCGGCGCCATGGCCGAGTGGGTAAGTTGGCATGCTCCGCTTCAGTGGCCCAGGG
TTTCGCTGGTTCGGATCCTGGGCGTGGACGTGGCACTGCTCATCAGGCCATGCTGAGGTG
GCATCCCACATGCCACAACTAGAAGGACCCACAACTAAATAAAATATACAACTGTATACT
TGGGGATTTAGGGAGAAAAAGCAGAAACAAAAAAACAGATTGGCAATATTGTTAGCTCAG
GTGCCAATCTTAAAAATGAGGTTAATATGAATTATGATGTTAATTAATCTATATGGAAAA
CATTGAGGTCAATTAATGAAATATATTGTCAGTGGAAAGTAATTCTATAGACAAACGTTA
GAGATATTCAAGGCTCTTGTTTTGAGTTTTTGTTTTCCTTGGGTATTTATTTTATTATTA
GTGAATTGATGAATTAATCAATAAAAACATGTAGACATGAATGAATATAATGAGGGCCAA
ACCTGCGTCAAAGATAAAGACTGGTGGCCTGAGTCTTGGATGATGAACACTGCAGGTCTG
GAATGCTGAGGTCCAACGCAACAGAAATCTAGTCCTTTCCCCCCATTTGAAGTGATCCCG
TAGAGAGGCGTCAGGCATTTATGGGGATCGTGTTTTTGGTCTTTGTGTACCTGATCATTT
AAAAATATTATTATGGCCAGGTTAATAAACAAATATATTACTGAATACAACAGAAGAGGG
TGAAGCAGTTTTTCGTTGCTAAAATATATAACAAATTAAAATAATATTAATATAAATTGG
AATGGAAAATAAAAGATTCAAGTGTATATGTTTTTGAGGAAGAATGATATAGACAGTGAT
AAGTAATAGTTACCAAGTGGGTCAGTAATAACTCTGACATTTGATTTATTAAGGGAAAAA
ATAAATATTACCATAAATTAATAAATGCTAAAATTACTATGCAATGCATAGTGGCATATA
TAGATCAATAAGGAGAATATCTCAATATTTTTATCACCCCATCTGCTTGTTACTCTTCAG
AACAGACGGTTGAGCTGATTTCAGCTTCTGCTGTGCTCAAGATTGTCATGCTCCCTCTGG
GTGTGGAAAGAGACTAAGGTGAACAATGGTCAAAGTTGTCTTGGAATGGGAATTTGTTTA
AGGGTACTCATGATATTATGATAAAGTATTAAATAATCAAAAAGTTAACCATGGCCCAAT
GATAAATATAATAAGAAACATTATATTGGTTAATCGATAATGTGCAAGATTGAGGTTGAT
TAATGGAAGAGATATAGCCTTTTTGGGAAATGATTCTGTAAATTGATGTCAGGGATATTG
AAGGATCTTCGGTTTTTGTGAACTATGTATTATTTTTATTATTACCAATGAATCAATGAT
TTAATCAATACAAATGTAGAAATGAACAAAGAAAAGAAACACAATCATGGACTGGTGATG
AACACTGGTGCTGTGGGTATCATGGGCCATGAAAATATGTCTGAAACTTTGAGGTCCAAC
ACAGAACATAATTTGGTCTGATCCCTCTGTTGAAATTGTTGTCTATACAGAGATGTCAGG
AATATAAAAAGATCCTATACTGATTTTATAGGCATAGATTTGTTATTATTAATAGATGAA
TGATTGAACCATTAAGCAAATATAAATAAATATTTAAGGAAAATAGGGTGAAGCATTGTC
CGAATATGAACATATGTGGTGAGGCAAAAGATATTGTTAATGAAAATTGAAGACAATGAT
GCCCACTAAGAAATAAATGGAACAAAGGGTCACCTGTTTGACCAAGGTTATATAGACATG
CATAAGTAAGAGTCAATTTAATTGTTCTGCTTCAGACTAAAGATTTTTTCCTTTTAATAA
GATAAAATATATATGTATATAAAGAAAAAATAATAAATACTTAATGCTGAGTAAATGAAA
TGTGGAAAGCAAGCATCGATGCAGATTACATCTCAATTTATTTTTATCATCTACTCTGTT
CTGTACTTTTCAGCATAAACGTACGAGAGATGCTTTAGCATCTTCCGTTGACGTGAGCTA
TGTGGTTGCCTCTCTATAATAGGAGGATGGAGATTAATGTGAGTAATAGTTGAAGTTCTT
CTCTCAGTTTGTGGGTTTTTTTCAATGGTAATTCACTGTGTCATCAAAAAGTGTGAAATA
TAATTAAGGAAGGCAGCTATATCTCAGTGTTATGGGATATATGAAACATTGGTTAATGCT
TGTATGAAAAACTGAGAGAATTAACGAGAGATACATTGATGTGAGAATAATTCTGTATAC
AGATTCGGAATATAAAGACTCTTCTTGGTTTTTTTGAATTGTACTCCTTAAAAATTATTA
GTGAATTAATGATTTATTCAATAATCAAAGAGACATATATGTAGAAAAAGAGGGACAATA
TTGGATCGATGATGACTACTGGTGGCGTATGGGTCATATGTGATGAATATGTGTCTGGAA
CTCTGAGGTCCAACATAAAATTAATCTAGTTGTTTCCTACTGTTTGAAGGCATCCTGTAG
ACAGATGTCAGGAATAAATGAGGGGCTTATTTTTGATCTTTGTGTTTGTGCATTTTCTTT
CTATTATTATAATGGGATAAATGTGAGAATCTATAAATAAATATTTTATAAATAAATACA
GATGAATGGAGTAAAGCATGGTCCAATTATAAAAATATGTAGTGAGGCAAGGGATACTAT
TAATAGATTATGAAAACCCTGAAGTTCAATTAGAAACGAATAGTACAACACTGTTATCTC
TTAGGGTAAGGATGACGTAGGCGGTGTAAGTCATAGACAGTGTTCATATTCTGGCTCAAT
GGCAAGATCAAAGTCGTTTGTTTTCTTAAAAGACTAAATATATATCAAATTAATGATTGC
TTGATTAACTATATGAATGTTGAAGTGGGGATCTTTGGAGAGAATGGCTCAATCGTTTTC
ATCATCTCCTTTGCTTTACACTCCTCAGAACCGCCACCCTGGACCGGATTTAAGGACTCT
TGATCACCAGCTCTAGGTGCATCTGTTTTTTAGGAGCCTGGAGACCTGTGTAAGCATAAT
CAAATTTCTTGTCTCAGTTTGGGTGGTTTGTCTAAGGGTATTCACTGTTTTAATAAAATG
TTTGTAATATAAACAATCAAGGCCATCTTTATTCTGTTGATAAATATATTAATATGAACC
ATTATGTTGATTAATGCATACATGAAAACTCATAATAAATACGACACAGATGTAATGATG
TGAGAATGGTTCTAGAGACAGATCAGAGATATCAAGGCCTTGTTGGGTTTTGCGAATCAG
AGAGTTTTAAAATTATAATTAGTAATTAATGAACTAATCAGTAAACTATAGAAATGAATG
AAGAGAAAGTGATCTTTCTGGATCAATGATGATAACTGCCGGCGTATGAGTCATGGATGA
TGAGTAATACATGTCTGGAACTCTGAGGTCCAACACAAAAGAAATGTGGTCTTTCTCTTC
ATGCATTTTCGTTCTGTTATTAGGATTGAGCCAATGAAAGAATCAATCAATAAATATATG
GATCAATGGAGAGAAAGTCTCAATCTTTTTATCACCTTTTCTGTTTGGTACTTTTCAGAA
TAGAAGCTGAAAGATTTCATTGTGATCTATTGTGATCAAGCTTGTCATGTTCCTTTATTG
TAGGAAAGAGACCAAGGTGAGTCATGGTTAAAGTTCTTCTCTTGGTTTGGGTCATTAGTT
TAAGGGTTTTCGTGGTATTGTTAACAAGTAATCAACATTGTCAAAAAGTTAACTATGGCC
CAATGATAAATATGATATGAAACATTATGTTGATTAGTTGATAATATGTAGCTTCGATAT
TTATAAATGAAAGAGATATCTATTTTGGCAATGATTCTATAGAGGAAAGTTAGGGATACT
CAGTTATCTTTGTTTTTTGTTAATTGTATATTTTATCATCATCAGTGAAGTAATAATTTA
ATTGCTACAAATATATAAATGAATGACCTAAAAGTGGACCTCTCATGAACCCACCATGAC
GCCTGGTGGCAGATGTCATAGGTGATGAACATGTGTCTGGAACCCTGAGGTCCAACACAA
TACATACTGTATTTTCTCTGTTTATTTGAGTCTGTTGACATATGTTAGGAATGTATAAAG
ATCATGTTCTTATTTTGGGTTAATAGATTTGTATTTTTTATTATTATTAGAATAATGATA
GAAACATTGAATAAATAGAAATAATAGATTAAGAAGAAAAGGGGAGTTCTGTCTAACTAT
GAACATACATGGTGAGGCAAGAAATATTAATGAAAACTGCAAACACTGGTGCCCATTAAG
TAATAAGTGGATCAAGGGTGTCACCTCTTTGGCCAAGGATCATACAGACATGAATAACTG
AGAGTCACTTTTATTGTTCTGGGTCAGTCTTAAGTTTGAAGTTGATCTTTTTGTTAAGAG
GAAAAACTTAGGTTATGAAAAATTTATGAACTCCTGAATGACTGAGTAAATGAAATTTGG
AAAGGAAGAATCAATGGGGATAAAAGTTTGGGGTTTTTCTGTCATTGATTGTGCTTCGTA
CTTCCCAAAATGGACACATTTGAGCTGATGGAGCCTTAGCCCATGGTGGCAAGCTGTATG
ATTGCACCTCTCCGCCGGAAGCTCAGAGATCAAGGTGAGTAATAGTCCAAATTCTTGTCT
TGGTTTTAGTGATTTCTTTTTTCAGTGTATTCAGTGTATTATTCAAAAGTTCCATATAGA
GTCATAGAAGACCAACTGTAGCTCAGTGATAAATACTGAATTTTATGAAACATTATATTG
ATTAATGCATAAATGAAAAACAGCCTAAATTTTAAAAAGTGATATGTTAAAGTGAGAATG
ATTCTATATACAGCTTAGAGATGTCATGACTCTTTTTGTTTTTGTGTGAATAATAGAGTT
TTAAAATTATCGTTCGTGAGTTAATGAATTAGTCAATAAACAACGTAGACGCGAATGCAG
AAAAGGAAGGACCGTATTGGGCCACTGGCGACTACTGGCGGCAGTGAGTTGTGTATGATG
AGCGCGTGTCTGGCACTCTGTGGTCCACAGAAGTGGGATCTGCTCCATTGTCCTATTTGA
AGTGACTCTATAGACAGAGGTCGGGAATATACAAAATCTTATTTTTGGTTATTTTTTTTT
TCATTTATTTATTTTCGGATGTACATCATAATATATTTCGAATTCTGTGTAGATTACATC
ATGTTCACCACCTGTTATTTTTGGTCTTTATGTTCATGCATGTTCTACTTTTATATAATT
GGATTGATAAAATACTCAATAAACACAAATAAACAAAGATGAAAGCAGTGAAATATATTG
TCCAATTATAAAAATATGTGGTTAGGCAAGGAATAGTATTAATATATATTTAAAACACTG
ATAATGTGCAAGATTGAGGACTGTTAATGGAAGAGATATAGTCTATTTGGGAAATTATTC
TGTAGACTGATATTAAAATATTCAAAGATCTTGTTCTTTTTCAAAAAATTTAGTTTATTT
TTATTGATATGCAATGACATATTATATTAGTTTCAGGTGTACAACATAATGATTTGATAT
ATGTATATATAGCCTAATGATCACCACAATAAGTCTAGTAAAATCTGTCACCATACATCG
TTACAAACATTTATTTTCTTGTGATGAGAGCTTTTAAGATTTACTCTTTTCTGAACTTTC
AAATATGCAATACAGTATTATTAACTATACTTCCCATGCTGTGCATTATTTCCCTGTGAC
TTATTTATTTTCTAACTGGAAGTTTGTACCTTTTGATCCCTTCAACCATTTTGCCCACCC
CCAACCCCCAGCTCTGTTCTCTGTATCTATGAACTCTGTGTTTTCTTTCTTTCTTTTTTA
GATTCCACACATAAGTGAGAGCATACAGTCTCACTTAAGTCTGTGTGACTTACTTCACTT
AGCATAATGCCCTCAAGGTCCATCTGTGTTGTCTCAAATGGCAAGATTTCCTTCTTTTTT
ATGGCTGAATAATATTCCATTGTACAAATATACCACTTCTTTATTCATCCATCAGTGGAC
ACTTGTTATTTCCATATCTTGGCTATTGTAAATAATGCTGCAGTGAACGTGGGGGTGCAT
ATTTTTTTGAGTTAGTGTCTTCGTTTTTTCAGACAAATACCCAGAGGTGGAATTGCTGGA
TCATATGGTAGTTGTATTTTTAATTTTTGGAGGAACCTCCATACTATTTTCCATAGTGGC
TGCACCAAATTGTATTCCAACCAACAGTGCACAAGGCTCCCCTTTTCTCCGCATCCTTGC
CAATGCTTCTTGCTTTTTGTCTTTTTGGTAATAGCAATTCCGACAGGTTTAGGTGATGTC
TCATTGTGGTTTTGATTTGTATTTCCATGATTATTAGTGATGTTGAGCACCTTTTCATGT
ACCTGTTCGCCATCTGTATGTCTTCTGTTCTTGAGTTTTTGTGAACCATGTATTTTTAAA
ATTATTATCAATGAACTAATGATTTGATTAATACAAATGTAGAAATTAACAAAGAAAAGG
AGTGTCAAATGTGGATCGGCGATGATGACTGATGGTGTAGGAGTCAGGGACAATGAAAAT
ATGTGTCTGAAACTCCGGGGTCCAGTGCAGAATATAACTAGTCTATTCCTTCTGCTGGAA
TTGTTTCTGTAGAGAGATGTTAGGAATGTAAAGAGGTCATATTCTTATGTTGACAGAATC
ATTAACCAAATATAAATACGTATATAAAAAAGATGATGGTGAAGCCTCATCTGTCTATTA
ACATATGTGATGAGGAAAATATATTATTAATACAAATTTAAAGCACTGATGCCCATTAAG
AAATAAGTAGATCAAGAAATCACCTCTTTGACCAAAGTCAGCTAAACACAGATGAATACA
GATTATTTTAATTATCCAGTGTCAGTCTCAAGATGGAATTTTTTCCTTTTTAAGATAAAA
ATTATATATTAAAAAATAATAACTAACTAAATACTGAGTAAATGAAACATGGAAAGCAAG
CATCAGTGGAGATTTGGTATCCGTTTTATCATCTGCTCTTCTGTATTCTCTTCAGAGCGA
AAACGCTCAAGATGATGTGAGCATCTTCCGTGGTCACAAACTCTATAGTTGTGACTTTAT
AATAGGAGCCTGGAGAACAATGTGAGTAATAGTTGAAGTTCTTGCCTTGGTTTCAGTGTT
TTGGTTGCTTTTAAGATTATTCACTGTATTACTAAAAAGTATGGAATATAAGCTAAGAAG
GCAACTGTATCTCAGTGTTAAATATGGGATATATGAAACATTCTATTGGTTAATGCACAT
ATGGAAAACTGAAGGTTAATTAATGAAAGATCCATTGCTTGAGAATATCTGTCTTCATTT
TAAGGGCATCAAGGCTCTTCTTGGTTTTTGTGAACAACCGGGTTTTAAAATTGTTGGTGA
ATTAATGGTCTAATCAGTATACAAATAGAATGTAGTGAGAACAAAGAGGTAATATTGGAT
CGATGATGACTACTGGTGGCGTACGAGTCGTAGATGATGAATACGTGTCTGGAACTGAGG
TCCAACATAAAGTTAATCTAGTCCATTCCCCTTGTTTGCAGGTGAGAAATATACCAAGAT
CTTGTTTTTGGTGTTAGTGTTCCTGCATTTTCACCTATTATTATAATTGGATAAATGAGA
GGATCTACAACATATAAATAAAAAATACGAAGCATTGTCCAATTATAAAAATATGTGATG
AGGCAAGAAATAGTATTTATATATTATGAAAACCATGAAGTTCAATTAGAAACAAATAGC
ATATGATTGTTACCTGTATGGTGGAGAATGACGTAGACAGGATAAGTTATAGAAAATGCT
CCTAGTCTCAGTCACTGGTAAAATCGAACTTCATTTTCTTAAGGGAAAAAAGCATATACA
CCAAATTAATGATTGCCTAAATGACTGACTACATGAGAGGTGAAAGGCAAGGATCAATGG
AGGGAATCTCTCAACCTTTTGTATCATCTGCTCTGCCCTCTACTCCTTAGAATGGACACA
TTGGACCTGACTTAAGGATTCTTCCTTGATCATGAGCCCTAGGGTTGCATCTCTGTTTTA
GGAGTCTGGAGACCACTGTGAGTGATAATCAAATCTCTTGTCTTGGTTTGGGTGGTTTTT
TTAAAGGATATTCATTGTATTGATAAAAAGTGTGAAATATACTCAAAGACAGTTAACTGT
GTCCTAGTGAGAAATATGGGATTAACAAGAAGCATTGTATTGCTTAATGCTTATATGAAA
AACTGGTAGTAAATATGACAGATATAATGACGTGAGGATGCTCCCAAATACCTATTAGAG
CTACTAAGGCCTTCTTGGGTTTTTGTGAATCACAGAGTTTTCAAAGTGTAATTAGTGAAT
TAATGAATTAATCAATAAACAATATAGAATGAATGAAGAGAGGCTGCCGGCATATGAGTC
ATAGATGATAAATAATATGTGTCTGGAACTCTGAGTTCCCACAGTAAAGAAATGTGGTCC
TTCTCTTTATGCATTTTCATTCTTTAGTTGGATCACTGAAACAGCAGTGAGGAAATCTAT
AAAAAATAAAGTTGAATTGTTGAAGCATCGTCGAATTTTTACAATATGTGGGGAGGCCAG
ATATGCTATTAATATAATTTGAAAACTCTGAAGTCCAAAGAGAAATAAATGGAATATGAC
TATAACCTCTTTGGCTAGGATGAGATAGACAGGATTAATTGTAGATGGTGTTTATGTTCT
GGGTCACTGGGAAGTTCAAAGTAGTTCTTAAAAGAGAGTGAAATAAATATGCTCCAATAA
TGATCGGCTAAATGACTGACTAAATGAACGATGTAAAGGGAGGCTGGAGAGAATGGAGAG
ACTATCTCAACCTTTGCATCACCGTTTCTGCTTGATATTCTTCAGAATGGAGGTTCTAGT
TGATTTCAGGTTCTGCTCCGATCAAGATTGTTTGTTGCCTCCACGTTAGGAGAGAGACCA
AGGTGAGTAGTAATCAGAGATTTTGTCATAGTTTGGTCATTTGTTTAAGGATATTCACAG
TTTTATTAAAAATTAGTAAATATAATCAAAAAGTAAATTGTGGCCCAATGACAAATGATA
TGAAACATTATGTTGATTGGTTCGTAGTATTTAACATTGAGATTGATTAATGGGAGAGAG
ACAATCTATGTTGGCAATTACTATATAGATAGAAGTTGGGGATATTCAAGTTGTTGGTTC
TTCAGTTTTTGTTAATCGTGTTTATTTCAGTTATCAGTGAATTAATGATTTATCAATACA
GATGTAGAAATGAATGAAGAAAAAGTGGACCTCTGATGGACCATGATACCTACTGGTGGT
AGATGAGTTGCAGCCACTGAATAATATATGTCTGGAGCTCTGAGGTCCAAGTCTATACAT
ACTCTGTTATCTGTTTGTTTGATCCTACGGACAGGTGTTAGGAGACATCATGTTTTTACT
TTGAGTTCATAGATTTAGTTTAATTATTATAAATGGATTAATGATAGAACCATTTAAAGA
TATGTAAATAACAGATAAATATAAAAGTGTAAATCACTGTCCAACTGTGAACACATGGTA
AGGCAAGAAATATTAATAAAAATTGCAAATACTGATGCTCGTTAAGAAATAAATGGATCC
GAGGATGTCACCTCTTTGGCCAAGGATCATATAGACATTAATTGAGTCAATTTCATTGTT
CTGGGTCAATCTCAAGTTTGAGGTTGTTCTTTTTCTTAAGAGAAAAAATATCTACATTAT
GAAAATTTATAAATTCCTAAATGACTGGGTAGATGAAATATGGAAAGGAAGAGTCAATGG
GGATGAAAAGTTTTATTATTTTTTTTATCATCGATTGTACCTTGTACTTCCCAAAATGGA
CGCGTCTGAGTTGATGAAGATTTATTCCATGGTGGCGAGCTGTATGATTGCGTCTCTGTG
CCAGAAGCTTAGAGATCAATGTAACAAAGTTCTTGTCTCGGTATCAGTGACTTTTTTCAG
CGAGTTCAGTGTATTATTCCAAAGTTCCACATAGAATCACAGAAGGCTGACTGTAGCTCA
GTGATAAATACTGAATTTTATAGAACATTACATTGATTGATGCATAAATGAATAACAGCC
TAACTTTAAAAAAGAGATATATTGATATGGGAATGATTCTATATACAGCTTAAGGATATC
GTGACTTTTCTTGGATTTTTGTGAAAAATAAGGTTTTAAAATTATTATTAGTGACTTAAT
AAATTAGTCAGTAAACATTGTGGAAATGAACAGAGAAAAAGAGGGGCCATATTTTGGATC
AGTGATGACTGCTGGTGGCATATGAGTCGTATACGATGAATACGTGTCTGGAACTCTCAG
GTCCAACAGAAGTGGAATCTGGTCCATTGTCCTGTTTGAGGTGATTCCATAGACAGAGGT
CAGGAATATACAAGGATCTTGTTTTTGATCTTTATGTTCATGCATTTTCGTTCTGTTTTT
ATAATTGGATCAATAAAATGATCGACCAAACACACATGCAAATAAAGATGGTGGTGAAAT
ACTGTCCAATTATACAAATATATGGTTAGACAAGGAATAGTATTAATGTCTATTTTAAAA
ACTGAAATCTATAAGGGACTATACGGTACAAGGGTGTTATTCTTTGACTAAGGACAATGT
GGTTATTAAATGTTAGTCAATGTTCATCTTCTCTATCAGTGACTAGATTGATAGTGTTCA
TTTACTTATGAGAAAATAAAATATACATTATTCCAATTCACTGCTTAATAATTGACTGAC
TAAATGAAAGGTGGAACGCAAGGACCAATGAACAGAATGTGTCAATCGTTTTTTCACTTG
CTCTGCCCTGTACTCCTCAGAATGGACGCGGAAGCTGATTTAGCCTCTCTCAGATCCAGG
CGCTCTATGGTTGCATCTGTGTAATAGGAGGACGGAGATTAATGTGAGTAACAATTGAAG
TTATTTTCTTGCTTAGGTGTTGCTTTTTTAAGGTAATTCACTGCATTATTAAAAAGTATA
AAATATGACTCAAGGAGGCAGTGTATCTCAGTGATAAATATGGGATATAGGAACCATTAT
ACTGATTAATCTTTCGGTGGAAAAGTGGAGATAATTAATCAAAGAGGTACATTGATGTTT
GAATAATCTATGTAAAGATTAGGGACATAAAACTCTGGAGGTTTTGTAAATTATAGCATT
TAAAATTATTTGTGAATTAATGATTTAATTAATAAGCAATTAAAATGAATCTAGAAAAAG
GAATGATATTGGATCGATGCTGACTACTGGTGGCGTACGAGTTGTATACGATGACTACGT
ATCTGGACCTCTGAGGTCCAACACAAAAGAAATCTAGTCCATTCCCATTGTTGGGGATCC
TATGACAGATCGCAGAAATATATCAGGATCTTCTTTTTGGTCTTAGTGTTCATGCATTTG
AGTTCAATTCTTATAATTGGATAAATTAGAGATTCTATAAATACATACATAAAGTAAGTG
AAGAAGAATGGAGTGAAGCATTGTCTAATTATAAAAATATGCAGTGAGGCCAAAATACTA
TTAATATATTATGAAAATCCGAAAGTTCAATTAGAAATAATTGGTACATGGCTGTATGGC
TAAAGATGGCATAGTATAAATCATAGACAATGTTCAAATTCTGGGTCAGTGGCAAAATTA
AAGTTATTCATTTTCTTAAGAGAAAAAAATATTTACACCAAATTAATGATTGCCCAAACT
ACTGACTAAATGAAAGGTTAAAAGCAATGATCAATGGAGAGAATGTCTCAACTATTTTTA
TCATCTGCTCTGCTCTGCACTCCTCAGAAGAGACACACTGCGCCTGTTTAAGGATTCCTC
CTTGTCGTGAGCCCTAGGGTTGCATCTCTGTTTTAGGAGCCTGGAGACCAGTGTGAGTGA
TAATCAAACTTCTTGCCTTGGTTTGGGTGGTTTGTCTAAGGGTACTCATTGTACTGATAA
AAAGTATAAAAGATACTCAAAGACAGCCAACTGTGTCCTGGTGAGAAATAGGTGATTAAC
AAGAAACATTATATTGATTAATGCTTATATGAAAAACTGATAATAAATATGACAGAGATA
TAAAGATGTGAGAATGGTTCCACATACGTATTAGAGCTATCAAGGTCCTTTTGAGTTTTT
CTGAATCATAGAATTTTAAAAGTGTAATTTGTGAATTAATGAATTAATCAAAATAATATA
GAAACGAATGAAGAGAAAGTCATCTTTTCTGGATCGATGATGACAACTGCCAGCGCTTGA
GTCATGATGATGAATGATATGTGTCTGGAACTCTGAGGTCCAATATAAAAGAGATGAGGC
CTTTCTCTTCATGCGTTTTCATTCTTTATTATAATTGGATCAACGAAATATCAATGAGGA
AATATATATATTAAAAACAGCTGAATTGTAGAAGTGTTGTCCAATTTTAAAAATATTTGG
GGAGGCCAGAAATACTATCAATATAATTTGAAAACACTGAAGTCCAAAGAGAAATAAATG
GTACGTGACTGCAACCTCTTTGGCTCAGGATGACATAGACAGGATAAATTGTAGGCAGTG
TTTATGTTCTGGGTCAGTGGAAGTGTGAAGTAGTTCATTTTCTTAAGGGAAAATGAAATA
TACTCCAAATAAGGATTGCCTAAATGAAAGATGTAAGGTGAGACTCAGTGGAAGACTGTC
TCAGTTTTTGTCATCTGCTCTGCTCTATACTCTGCAGAAGGGACACACTGAAGCTGATTG
TAATACTCTTCCAAGGGCGTGAACTCTCTCAATGCGTCTCTGTGCTAGGAGCATGTGGAC
CAACGTGAGTAACGGTCAAAGTTCTTGTCTTACTTTGAGTGCTTTGTTTAAGGCTATTCA
CTGTATTACTCAAAAACATTAAATATAATCAAAGAAGGCAAAATATGCCAGTGTTAAATG
TCAGGTTGATATGAGGCATAATGTTAACTAATCTATGAATGTAACCCTTAGGTCAGTTAA
TGAAAGCGATTTAGTCTCTGTGTAATATTACAGACAGAGATATTAGGAATGTTGAGGCAT
TGTATTCTTATTTGTTTAATTTATGTGTGTTTCTTAATGAATTCATCAATATTTATGAGA
ATGAAAAAAAGCAAGAAGGCTAATAATGGACCAATGATGACGATCGGTGGCGTTTCTGAG
TCATACACTATGAATACTATGTGTCTGAAACTCTGAGGGCTGATACAAAGATACTCTAGT
CCTTTTCTTGCTTGTGTAGGGACCCTATATATAGGTGTCAATAAGATATAAGGACTTTGT
TCTCGCTCTTTGTGTTCATGAGTTTTAATAATTAATTTGTAAAAGTGGGAATGGTAGAAT
AAATTAACAAACGTATAAATGAATAAAGGTGGAGAGGTTGAAGCATTGTTCTTTGGTAAA
TATGTAGTAAGCTAAAACAACGTTAATATCGTTAAAATGGATATAAAAGGACCAAGTGTA
TTACATCTTTTCCTAAGGTTGATACGGACGATGAAATTTAGCAATCAGTTATTGACTGAT
TCAGTTGCAAGTTTGAACTTTATTTTTAAGGTAGAAATGAATACATTCCCATAAGCTAAT
AAATACTTAAATGACCGTGTATATGAATGGTGGAAAGTATGGATCACTAGAGAGAAAGTC
TTAACCTTTTTATCACTTTCTCTGCTTGGTACTCCTCAGAACAGATGCTCGAGCTGATTT
CATCTTCTATCGTGATCAAGATTGTCATGTTCCCTTTGTGTTAGGAAAGATACTAAGGTG
AGTAATGATCAAAAATTTTATCTTGGTTTGTGTCAATTTTTTAAGTGTATTCATGGTGTT
ATTAAAAAGTGATGAATATAATAAAAAAGTTAACTATGGCCTAATGATAAATATGATATG
AAACATTATTTTGATTCATTTAATATATGTAACATTGAGATTGATTAATTAAAGCTGTAA
TCTATGTTGGCAGTGATTCTATAGTAGAAGTTAGGAATATTCAAGTATCTTCTTCTTCAG
TTTTGTGAACCTTGTGTTTATTTTATTATTTTCAATGAATTAATTATTTAATTGATAGAA
GTGTAGAAATGGATGAAGAAAAAGTAGGCCTCTTTTGGACCAATGATGACGACTAATGGC
GGATAAGTCGTGGACGATGAATAATACGTGTCTGGATATCTGAGGTCCTCACAGTACGTT
GGCTATTCCTTCTGCTGTGTTTGATCTTGTAGACTGATGTAAGGAATATGCAAAGATCAT
GTACCTATTTTGAGTTCATAGATTTAGATTTGTTGTTATTAATGGAGCAATGGTAGACCA
TTAAAGAAATATAAACAGTATGTAAAGAAAAAAGGGTGAAGCATTATTCAACTATGAACA
TATAAGGAAAGGCAAGAAATATTAATAAAATTGAAAACACTGATGCCCATTTAGAAATAA
GTGGATCAGAGGTCTACATCCTTGGCTAATTATCATATAGACATAAATAAGTAAGAGTCA
ATTTATTTATTCTGAGTCAGTTTCAAGTTTGGGGTGGTTCCTTTGATTAAGAGAAAAAAC
ATTTACATTATGAAAAGTTTATGAATACCTAAATAAGTGAGTATAATGTCCTAACTTTTT
TTTAATCATTGACTGTGCTTTTTCTTCTCAGAATGGACACACTCAGGCTGAGTAAGCAGT
ATTCCATGGTGTCGAGTTCATGATTGCACCTTTGCGTTAGGAGCACAGAGACCAATGTGA
GTAATAGTTACGTTTCTTGTTCTGGTTTCAGCAAGTGTCTTTTAGGGTGTTCAGTGGATT
TTTTTAAGTGCTATATAGAGTCTGGTGGCCAACTATAGCTCAGTGATAACTATTGAATTA
ATATGAAACATTATGTGGATCACCATATAAATGAAATTTAAGGTAATTAATGGAAAGATA
TATCGATGTGAGAATGATTCTATATACAGATGAAGGATACCATGACTCTTCCTGGACTTT
TGTGAAAAATAGGGTTTTAAAATTATTATTGGTTATTTAATGAATTAGTCAATAAACAAT
GTAGAAAAGAAAAAGAGGGACGATATTGGCTCGATGATGACTGCTGGTGGCGTATGAGTC
GGATCCGATGAATACGTGTCTGGAACTCTGAGGTCCAACAGAAGTGGAATCTGGTCCATT
CCCATTGTTTGAAGGCATCCTTTAGAGAGATGTCAGGAATATACAAGGATCTTGTTTTTC
ATTTTCATTCTATCTTTATAATTGGATAAATGGATCTGTAAATAAATATGTAAATATAGA
TGAATGGAGTAAAGCATGGTCCAATTATAAAAATATGTGGTGAGGCTAGAAAAACACTAT
GGATATATTATGAAAACCCTGAATTTCAATTAGAAATAAATAGTACATGACTGTTACCTT
ATGGATTAGGATGATATAGATAGTAAATTCATAAATAATATTCAGATTCTGGGTCAGTTG
CAGGATTAATGTTCTTTTTCTTAAGGGAAAAAATATATATGCCCAATTAGTGATTTCCCA
AACTGCTAAGTGAAAGGGGAAACACAAGGACCAGTGGAGAGAAAGTCTCAACCATTTTTG
TCTGTTGCTCTGTCCTGTACTCCTCAGAGTGGACGCCCTGGACCTGATTTAAGGATTCTT
TCCGGATCACAAGCCCTAGGGCTGCATCCCAGTTCTAGGAGCCTAGAGAGCAAGGTGAGT
GATAATCAAACTTCTTGTCTTGGTTTGGGTGGTTCGTTTAAGAGTATTTGCTGTATTGGC
AAAAAGTATCAAATAGAATCTAAGAAAGCCACCTGTGCCCTTGTGACAAATGTGGGATTA
ATACGAAGTATCACGTTGATTAAAGCTTTTAAGAAAACTGAGGATAATGACAATGATATA
TTGATGCGGGAATGATTCTTGGTAGATATGAGAGTTGTCAACGTTTTGTTGAGCTCTTTT
GAATCATAGAGTTTTAAAATTGTAGTTGAATTAATGAATTAATCAATGAACAGTATAGAA
CTGAATGAGGAGAAAGTGGTCTTTTCTGGATCAATGATGATAACTGCCAGCGCATGAGTC
ACAGATGATGAATAATATGTGTCTGGAACTCTGAGGTCCAAAAGAGAAGACATGTGGTCT
TTCTCTTCATGTATTTCCATTTTTATTATAATTGGATCAATGAAATATCAATGAAGAAAT
ATATTAAAAAATAGAGTCGAATTGTAGAAGCATTGTCCAATTTTAAAATTATGTGGGGAG
GCCAGAAATACTGTTACATAATTTGAAAGCACTGAAGTCCAAAGGGAAATAAATGGTACA
TGACTGTGACCTCTTTGGCTAAGGATGATACAGACAAGATAAATTATAGACAGTGTTTAT
GTTCTGGGTCAGTGGGAAGTTTAAAGTAGTACATTTCCTTAAGAGAAAATGAAATCTACT
CCAAATCAGGATTGCCTAAATGGAAGACGTGAAGCAAGGATCAATGGAGGAATGTCTCAT
TTTTTATCACTTGCTCTGTACTCCTCAGAATGGATGACTTGAGCTGATTCTAACGTTCTT
CCAAGATCGCCAGCTCTCTGAATGCATCTCTGTTGTAGGAGCATGGAGACCACTGTGAGT
AATGGTCAGAGTTCTTGTATGAGTTTGAATGATTTGTTGAAAGCTATTCACTGTATTATT
CAAAAGTATTAAATGTGATCAGAAAAGGTGAAACATGCTTGATACGAGGCATTGTGTCGA
CTGATCCATAAATGTAACACTGAGGCCAGCTAATGCAAGAGATTTAGTCTCTATGGGATT
TGTAGATATATTAGGAATGTTGAAGGATTGTTTTCTTATTTTTCAAATCTATATGTATTT
CTTTATTAATTAATCAATAAATGTTTATGAGAGTGAAAATAAAGAGTGCCAGTCATGGAT
CAATGATGATGACTGGTGATGTATTAGTCACATGCAATGAGTACTACGTGTCTGGAACTC
TGAGGCCCAACCCCAAAGTTATCTAGTCCATTCCTCATGTGTCAGGAATATACATAGATT
TCTTTTCTTTGTTTTTGTGTTCGTGAATTTTAATAATATTTATAAAGTATCTATGATGGA
ATAAATAAGAAATGTACAAAGGGATGAAGATGATGAAGCATATTCTTTGGTTAATATGTA
GTCAGGTAAAAGAAAATTAATATACATTAGAATGGGTCATAAATGGACCAAGTGTGTTAC
CTCTTTCATGGAGGTTGATAAAGACAATGAAATGTAATGGTCAGTTATTGCCTGAGTCAG
TTACAGGTTTGAGTTTATTTTATTAAGGTAAAAATAAATAAATATGACCATAAGTTAATA
AATGCCTAAATGAGTGTACAAATTAATGGTGGAAACTGAATCAGTGGAGAGAAAGCCTTA
ATGTTTGTATTGACTTCTCTGCTTGGTACTCTTCAGAACAGATAATCAGATTGATTTCAT
CTACTGCTGTGGTCAAGATTGTTACGTTGGCATCATGTCAGTGAGTAATAGTCAAAGTGA
GTAATAGTCAAAGGTCTTGTCGTGCTTTGGGTCATTTGGTTAAAGATATCCGTGGTATTA
TTAAAAAGTATTAAATATAATGAAAAAGTTAACTATTGCCCAATGATAAATATGATATGA
AACATTATGTTAATTGATAATATATAGCTTTGAGATTGATTAACGAAAGACATGCAGCTG
ATGTTGGCAATGATTCTATAGATAGAACTTAGGGATATTCAAGTATCTTGTTTTTCACTT
TTTGTGAGTCATGTATTTATTTTTTCATTGTCATTGAATTAGTGAATTAATCAATACAAA
TGTAAATGAATGAAGAATAAATGGGCTTCTAATGGACCAGTGATGACAACTGGTTGTCTA
GGATGATGAATGATTTGTGTCTGGAGCTCTTAAGGTCCAACAGAGATACCTAGTGTATTC
TCTCTGTTATATTTGACACCATAGACAAATGTTAGGAATATACAAAGATCATGTTATTGT
TTCGGGTTCATAGATTTATATTTATTATTATTAATGGATATATAGAAATCTAAAGAAATA
TGAAGGCTAGATCAAGAATAAAGTTAAAGCCTTGTGCAACTGTGATCCTATGTGGTGAGG
CAAAAAAAATTATTAATAAAAATTGAAAACACTGAAGCTCATTAAGAAATAAACTGATCC
CAAGGGTGTTATCTGTTTGGCTAAGGATTGTATATATATGGATAATTGAGTAAATTTTAT
CGTTCTGGGTCATTCTCAAGTTTGAGGCTGTCCTTTTGTTAAGAGAAAATAATATCTACA
TTCCAAAAGAATTTTAAATACCTAAGTTACTCAGTAAATAATGTGGAAATGAAGGACCAA
TGAGTATAAGTTCTCAATTTTGTTATCTTCAGCTGTGCTTTGTACTTCTCAGAATGGACA
CAGTTGAGCTGATGAAGCAGTATCCTTGGTGGCAAGCTCTATGATGGCATCTGTGTGTTA
GAAGCAGAGACCAATCTGAGTAATAGCCGTTCTAGTCTGGGTTTCAGTGATTTTTTTCAG
GATATTCAGTGTATTTCTAAAAAGTGCCATATAGAATTGAAGAAGGCTGATTGTAGCCCA
TTCATAAATATTGAATTAATATGAAACATTATACTGATTAATGCGTAAGTGACATTTAGG
ATTATTAATGAAAGAGGTATATTGATGTGAGAATCATTCTAGACAAATTAGGGATATCAA
TGCCTTTTTGGGGTTTTGTGAATCATAGAGTTTTAAAATTATACATAGTGAATTAATGAA
TTAGCCAATAAACAATGTAGAAATAAATGAAGAAGAGGCACAATATTGGCTCGATGATGA
CTGCTGGTGGCATATGAGTCGTATACTATGACTACGTGTCTGGAACTCTTAGGTCCAACA
GAACAAGAAATCGGGTCCATTCCCATTGTTTGTAGAGATCCTGTAGGCAAATGTCAGAAT
ATACAAGGATCTTGGTTTTGTTTTTATGTTCATGCATTTTTTTCTATTTTTATAATTGGA
TCAATGAAATAATAAATATCCAAATAAATAAAGATGAAGGTGGTGAAATATTGTCTAGTT
ATAAAAATATCGGATTAGGCAATAAACTCTATTGATTTTTATAGATGAATTGATTCTGTA
GAGAGATGTCAAGATCAATGCAAATCAATACACAGATCATATTTTTGTATTGATTTCATA
GATGTAGATATGTTATAATTAATGGAATAATGATAGAAATACTAAGCAAATACAAATAAA
AGAGGAACAGGGTGAAGTATTGCCTAACTATGAATGTATGTGGTAAAGCAAAAGATGTTA
TTAATGAAATTGAAAACATTGATCCTATTAAGAAATAAATGGATCAAAGTATCACCCCTT
TGCTTAAGAATCATTTGGACATTGACTAGTAAGAATCAATTGTATTATTTTGGGTCAGTC
TTAAGACGAAGTTTTTCAGTATGTAGGGTTAAATGTATATATAGATAAAAGAATAAATAT
CTTTCTGAGGTGATGAAATGCGGAAAGTGAGGATCAATGGTGATTAGGTCTCAATTTTTG
TATCATCTGCTCTGCACTCCTCAGAACAGACGCACTTGTGCTGACTTAGCATCTCTCATG
GTCACGAGCCTCTATATTACAGGAGAACGGAGATTAATGTGAGTAACAGTCGATGTTATT
TTCTTGATTGTGTTGTTTTTTTAAGATAATTCACTGCATTATTAAAAAATGCAAAATATA
ATTAAAGAAGGCAATGTATCTCAGTGATAAATATGGGATACATGAAACATTGTGTCGATT
AATCCATCTGTGGAAACTGAGGATAATTAATCAAAGAGATAAATTGATGTGCGGATAATC
TGTGTACAGATCAGGAACATAAAAGCTCTTCTTGAGTTCTGGTGAATCATAGTGTTCAGA
AATTTTTATTAGTGAATTAGTGAATTAGCCAATAAGCAATGTAGAAATAAATGAAGAAGA
AGAGAGAGAACATTGGATTGATGGTGACTTCTGGTGGCGTATGACTCGTATATGATGAAT
ACGTGTCTGGAACTCTGAGGTCCAGCACAAAAGAAATCTGGTCCATTCCCATTGTTTGTA
GGGATCCTATAGGCAAATGTCAGGAATATACTAGGATCTTGTTTTTGGTCTTAGTGTTCA
TACATTTTCATTCTGTTATTATAATTGGATAAATGAGAGGCTCTATAAATAAATATGAAT
GGAGTGTAGCATTGTCCAATTATAAAGATATGTGATTATGCAAGAAATAATATTAATATA
CTATGAAAACCCTGAAGTTTAATTAGTGGTAAATGGCACATGACTGTTCCTTGTATGGCT
AAGGCTGACATAGACAGTCTAAGCTATCCACACTTTTCATAACCTGGGTCAGTGATGAGG
TCAAAGTTACTTGTTTTCTTAAGAGAAAAAAATATTTATACCACATTAGTGATATTGCCT
TACTAAATGAAAGGTGAAAAGCAGGGATCAGTGGAAAGAATATCTCACTTTTTTATCATC
CTCTCTGCCCCTGTAGTCCTCAGAACGGACGCATTGGACCTGATTTAAGAATTCATCCTT
GATCCTGAGACCTAGGATTGCATTTCTGTTACGGGAATCTGGAGACCAATGTGAGAAATA
ATCCAAGTTCTTGTCTTGGTTCTGATGTTTTATTTAAGGGCATTAATTGTATTAATAAAA
GTGTGAAATTTAATCAAAATAGGTGACTTGTATCTTGGCAACAATTATGAGATTAACATG
AAGTATTATTTTGATTAATATATATACATATATATGAAAAACTGAGGATAGTTAATGACA
GATCTTTTGTTGTGAGAATGATTCGAGTTACGTCTTAGGGATATGATAGCCTTGTTGGGG
TTTTTTGAATAATAGAATTTTAAAATTATAATTAGTGAATTAATGAATTAATCAATAAAC
AATGTAGTAATGAATAAAGAGAGAGTGTGCTTCTGGATCAACGACGATAGCTGCGGGCAT
ATGAGTCATGGATGATGAGTGATGCGTGTCTGGAACCATGAGGTCCAACACAGAAGAATT
GTGGTCTTTCTCTTCATGCAAAGAGTGTCTCATTTTATTCTCACCTGCCCTGCTCTGTAC
TGCTCAGAATGGAACCACCTGAGGTGAATTAAGCGTCTTCCATGGTCACGAGCTCTCTGC
TTGCGTCTCTGTTGTAGGAGCATGGAGACCATTGTGAGTACATGAATGTTTTAGTGTGTG
GTTTCTCTAAGAGTATTCACTGTATTATTCAAAATAGTAAATATAATCAAATATGGCACA
ATATGCCAGTGTTAAATATCAGATTGATATGAAACACTATATTGATTAATCCATAAATGT
AACCTTAAGGTCAGTTTTTGAAACAGAGTTAGTCTCTTTGGAAAAGATTGTAGAGACAGA
TATTAAGAATATTGAAGGATCTTATTTTTTAATTTACTTGTTTTTACTAATGAATTAGTC
AATAAATAATGCCTATGCGAAAGAAAGGAAAGAGGGCTAATCATGGGTCGCTGATGTTGG
CTATGGCAGGTGAGTTGTGGCTGATGCATGATACATGTCAGGATGCTGAGGTCCAGCGTA
ACACCTAGTGCGTTCTCTCTATTCATTTACTCCATAGACAGATGTTAAGGATATTCCCAG
GGTAGGTATTGGGTTCATAGATTTAGATTTATTATTATTAATTATAGAACATTAAAGAAA
TATAAATAATGCATAAAGATAAAAGGGTGAAGCATTGTCCATCTCTGAACATATGTGGTG
AGGCAAGAAATATTATTAATAAAATTGAAAACTGAAACTCATTAAGGAATAAATGGATCA
AGAATTTCGCCTCTGACTAAGGATCATATAAATACGTATAATTTCATCAATTTTATTGTT
GTGCATCTGTGCCAAGGCTGCTGCTGTTCATTTTGTTAAGATAAAAACATCAACACTATG
AACAATTTATAAATACCTAAATGAGTGAGTAAATGAAATGTAGAAATCAAGGATCAGTGT
GGATAAGAACTGAAATTTTTTTCTCATCGACTGTGCTTTATCCTTCTCGGAACGGACACA
GTCGAGCTGATTTGAGGAGTGTTCCATGATGGCAAGCGCTGTGACTGTATCTCCATGTTA
GGAAGAAAAAGACGAGTGTGAGTAACCAGTTCTTGTATGGAGTCAGTGATTTTTTTCAGG
ATATTCAGTGTATTACTAAAAATGATCATCTATAGTAAAGACGGTCAACTGTAACCCAGT
TCATAAAGATTGACTTGATATGAAACATAAAAACATAGGAGATTTTTAAAAGAGAGATAT
ATCAATGTGAAAATAATTCTATACACAGAATAGGGGATTCAGGGCTGTTCTTGGCTTTTG
TGAATAATTGAGCTTTAAAATTCTTAGTAATGAATTAATGAATTACTCAATAAATGACGT
AGAAAAGAAAAAGAGGGACAATATTGGATCAATGATGACTGCTGGTGGCGTATGAGTTGG
ATGCGATGAATACGTGTCTGGAACTCTGAGGTCCAACAGAAATGGAATCTGGTCCATTGT
CCTGTTTGAGGGGTTTCTCATAGACACGGGTTAGGAATATACAAGGATCTTGTTTTGGCC
TTTATGTTCATGCGTTTTCTATTGTTATTATAATTAGTTCAATGAAATAATAAAGAAATA
TATAAATAGGTAAAGTTGAAGGTGGTGAAACTTTGCCCAATTATAAAAATATGTGGTTAG
GCAAGAGCTATTATTAATATATATTGGAAGCAAATACCTATTAGGAATATATGTACAAGG
ATGTTATTCTTTTACTAAAGATGGTATAGTTATTAGTAAGTCATAATCGATATTCATGTT
CTCTGTCAGTTGCAAGATCAATATTGGTCCTTTAGTTAAGAGAAAATAAAATATAAATTA
TCCCAATTCACTATCTTAACTAAATGACTAAATGAGAGGTGGAATGCGATGACCAGTGAC
ATAATGTCTCAACCTTTTTGATCGTTGGCTCTGTCTTGTGCTCCTTAGAACGTTGCACAC
AGCTGATGTGGGCGCTCCTCCATGGTCCCAAGCTGTTTGCACCTGTGCGTTAAGAGCGTG
GAGAACAATGTGAGTAATAGTCAACGTTCTTGTCTTGGTTTTGTAATTTTTAAAAACAGT
TTTCACTGCTCTGTTAAAAAGTATGAAATAGTCAATCATCACTGAACATGCTACGAAAGA
AAAATGATGTTAATATGAAGTATTATGTTAATTAATCTTTGTAGAAAATTCTGAGGTCAT
TAATGAAAGATACGTATTGTCTGTGGGAAGTACTTCTGTGGACAAATGTTGGAGATATTC
AAGGATCTTGTTTTGAGTTTTTGTGACCTCTAGGTATTTATTTTATTATTATTAGTGAAT
TGACTAAAATATGGAGACATGATTGAAGATGAGGGCCAAATCTGGATTAATGAGGACAAC
TCTTAGCATCTGAGTCTTGGATGATGAGCGTTACAGGTCTGGAATGCCGAGATCAAACAC
AAAAGAAATCTAGTCCTTTCCTCCGTTTGAAGTGATCCCATAGACAGATGTCAGGCATAT
AAAAGCATCGTGGTCTTGGTGTTTGTGTAACTCGTCATTTCAAAATATTATTATAAAGAA
TCAATAGCTGGATTAATAAATATATGAATAAGTAAATATGAAGAGGGCGAAACACTGGTC
ATTGTTAAAATATATAATAAACATGATAATATACATTGGAATGGAAAATGAAACCATCAA
GCGTATATATCTTTGAGTGAGAATGATAGTGACAAGTAATGGTTAAAATTTTAACACTTG
ATTTCTTAAGAGAAAAATCAGTAAATATTGCTGTAAATTAATAAAGGCCTAAATGACTAT
GCAGATGAAGGTGGTACTTGTGAATCAATGGAGAGGAAATCTTGACATTGTTATCGCTTT
GTCTGCTTGTTACTCTTCAGAATGGACTCTGGAACTGATTTCAGCTTTTGCTGTCGTCAA
GATTGTCATGCTGCCTCTGTGTATGGAAGGAGACCAAGGTGAGTAATGGGCCAAGCTATT
GTCTGGGATGGGTTAGTTGTTTAAGGGTATTTATAGTATTATTAAAAAGTATTAAATTAA
TTAAAAAGTTTGCCATGACCCACTGATAAATATGAAATCTTATGTTGATTAGTTGATAAT
GTTTAGGATTGAGGTCTATTAATGAAAGAGATATAGTCTATCTGGGAAATGATTCTGTAA
ACTGTTAGGGATACTCAAGAATCTTGCTCTTGAGTTTTTATGAACCATGTATTATTTTTA
TTATTGTCAATGAATTCATGATTTAATCAATACAAATATAGAAATAAACAAAGAAAAATA
GATAAAATTATGGACTAGTGATGATGACTGGTGGCGTAGGAGTCAGGGACGATGAGAATA
TGTGTCTGAAACTCTGAGATCCGGCACGGAACATAAGCAGTCTATTCCTTCAGTTGGAAT
TGTTTCTATAGAGATACGTCAGGAATATACAAAGATCACATTCTTGTATTAATTTCATGG
GCGGATATTTGTTATTATTAGTGGAATAATAGAAGTATTAAATATATAAAAAAGAATAGG
GTGAAGCATTGTTCACTTAATGAATGTATGTTATAAGGCAAAGGAAATTATTAATAACAT
TGAAAACATTGATGCCTATTAAGAAATTAATGGATCGAGAGGTCATCTCTGTGCTAAGGA
TCATATAGACACTGATAAGGAAGAGTCCATTTTTTTCCTGGGTCAATTTTAAGACTGAGT
TTTTCTTTTTGTTAGGATAAAAAAGAGATATTAAGAAAAAGTAATAAATACCTAAATACT
GAGTTGATGAAATGCAGAAAGCAAGGATCAATGGTGATTAGGTCTCAATTGTTTTATCAT
CTCCTCTGCTCCGTAGCCCTCGGAACGGACGCACTCAAGCTAATTTAGCGTCTTCCATGG
CAGGAGCTCCACGTTTGCGTCTGTGTAACAGGAGGACGGAGATTAATGTGAGTAATAGTT
GAAATTACTTTCTTGGTTTCAGTGTTGTTTTTTTTAAGGTTATTCATTAAAAAGTGCAAA
ACCTATTTAAAGAATGCAATTTATCTCAGTGATGAATATGGAATATAGTTAACGTTCTAT
TGATTAGTATATATGTATAATATAATGTATAATGAGGATAATTAGTGAGAGATATTGTTG
TGAGAATAATTCTATATATAGATTAGGGACATAAAAACTCTTTTTGGGTTTTTGAATCAT
AGCATTTAGAAATTATTATTAGTGAAATTATTGTTTAATCAACAAAGCCATAGAAATTAA
TGCAGAAAAAGAAGGACAGTATTGGATCAGTGATTACCACTGATGGTGTTTGTGTCATAT
ACGATGAATACGTGTCTGGAACTCTGAGGTCCAACATGAAGGAAATCTAGGTCCTTACCT
CTCTTTGATTGACCCTTTAAACTGATGTCAGAAATGTACAAGGAAAAATAATATGATAAT
TTGGAATGGACAATAAATGGATCCCATGTATTTTGTTCTGTGTCTTTGACGAAAGGATAA
TAATGGAACATTATAAGGAACAGTCAGTTCTTACTGTGAGTCAGTTTCAACTTTGACATT
TGATTTCTGAAGGAAAAAATTAATGTAATTTAATAAATACCTGAATGACTATATAAATGA
ATGGGGTAATCTATGGATCAGTGAATAGGATGTCTGAATTTTTTTATCGTCTGCCCTGCT
CTGCTCTTTATTCCTCAGAATGGATGCACTCAAGCTTCTTTAAGCATGTTCCATGGCCAT
GATCTTTATGTTTGCACCTGTGTGTTAGTAGCATGAAGACCAATGTGAGTAATATTCGAA
GCTCTCATGTTGGCTTGAGTGGTTCAAAGAAGGCCAATCATACCAATGTTTAATATCAGA
TTGATATGAAGCATTGCATTGATTAACCCATAAAGAAACAGACACTGAGTTCAGTTAATG
AAAAGGATAGAGACTCTTTGTAAATGATGCTATTGGTGAATATTAGGGATATTGAAGGAT
CTTGTTTTTTTTTTATGTGTATTTCTTCATGAATAAATTAACCAATAAAGAAATGTAGAT
GAGAATGGACAGAAAGAAGGCCAATCAGGGGCCAGTGATGACGACTGGTGGTGAAGAATG
TCAGCGTGGAGCTCTGAGGGCCAACACAGACAGACTCTAGTCCATTCCCCAGATTTTAAA
TGATACTATAGACAGATTTCAGGATTATATAGTGATCTTGTTCTTGGTCTTTGTGTTCAT
GAATTTTAAATATATGATTATAAAAGAACCAACGGCAGAATAAATTAGCAAATGTATAAA
TGAATAAAGATGAAGAGGGTGTAGCATTGTTCATTACTGAAATACGTAGTCAGGAGAATG
AATATTGATAGACACTGGAATGATACTAAAGGGACCGGGTGTGTTAAGTATTGGACTAAG
GATGATATGGACAGTGAGAGGGAGTAGTCAGTTATTGCCCTGACTCAGTTACAAGTTTTA
AGTTTATTTCGTAAAGAGAAAAACCGATTTTATCTTAAATTTATAAATACTTAAATGACT
GTGTAAATGGGGTATGGAAATTATAGATCAATGGAGAGAGCGTCTCAATCTTTTTAACAT
CTTTTCTGTGTGATACTCTAAAAACAACGCACCCAGCTGATTTAAGCCTTGTTCCATGAT
CAAAATCGTTATGTTGCCTCTGTTTCAGAAAGACACCAAGGTTAGTAATAGTCAAGGTTC
TTGTCTTGGTTTCAGTCATTTGCTTAAGGTATTCATGGTAATATTAAAAAGTATTAAGTA
TAATACACAAGTTATCTATGGCCATTGGTTAATACGGTAAGAAGCATGATATTAATTAAT
TGATAACGTGCAACATTGAAGTCACTTAATGAAAAAGATACAGTGTATTAGGAAAGATTC
CTATCCAGGGGTGTTAGGGATTTTCAAGGATCTTGTTCTCGCATTTTTGTGACTCACGTA
TATTTTAGTATTATTAGTGAATTAGTGATTTACTTGATGCAAATTTAGAAATGAATGAAG
AAGAAGAGGGCCTCACATAGACCAGTGGTGACTACTGGTGGCATATAAGTCATAGACATG
AATAATATGTGTCTGGAAGTCTGAGGTCCAACACAAACCATAAGTAGCCTGTTTTTTCTG
TTGGAAATGATCCTATAGACAGAAATCAGAAATGTACAAAGCTCATATTTTTACTTTGGA
TTCATAAATATAGATTTATTAATACTAATGGATCAGTGATAGAATAATTAAACAAATAAA
AATAAACAGGTAAAGAGGAGGATTAGGCGTTGACCAACTATGAACATATGAGAGGAGGCA
AAAAATATCATTAATGAAAGTTTAAAACACCGATGCCCGTGAAGGTATAAATGGATCAAG
AATTGTACCTCTTTGGTTTAGGATCATATAGACTCTGATAAGTAAAAGTCAATTTTATTG
TACTGGATCAGTTGCAAGTTTCAGGCTGTCCTTTTGTTAAGAGAAAAAAATATATACATA
ATGAAAAATGATTAAATACCTAAAGGCTTGAGTAAATGAAATGCAGAAAGCGAGAATCGT
AGAGGATATGGTCTCAATTTTTGAAAATCATTTGCTCTGTGTTGTACTGCTTAGAGTGGA
CGCAATCGATGATTTAAGCATCTTCCATGGTCACGAGCTCTCTGTTTACATCTATTTGTT
AGAAGGACAGAGACCACGTGAGTAATAGTCAAAGTTCTTTTCTTGGATTGGGTGGTTTGT
TTAAGGCTATTCAGTATACTGTTAACATTGTAAAATATAATCAAAGATAGCCAATTGTGA
TAAAAATGGGATTGGTGTGAAGCATCGTTTATAATGTGCATCTCTGAAAATCTGAGGATA
ATTAATGAAATAAATATATTGATGTTAGAATAATTTTGTGTGTAGAATCGGAATATTAAG
CCTCCTCTTGGGTTTTTGTGTATCATGGCATTTAAAATTATTATTAATCAATAAACAATG
AAGAAACAAATGGGGAAACAGAGGGCCAATCGTGATCAATGATGATGATTTGGTGGTGCA
TGAGTCACATACAATGAATACTATGTGTCTGGAACTCTTGAGGTCCAACACAAGAGGACT
CTAGTCCATTCACTTTATTTTAAGTGATACTGTAGACAGATTTCAGTTTTACATAGTGAT
CTTTTTCTTGGTCTTTCTGTTTATGAATTTTAAACATGATTATAAAATAACGAATGGCAG
AATAAATTAGGAAATGTATAAATGAATAAAGATGAAGAGGGTGAAGCATTGTTCATTAGT
AAAATGTGTAGTCAGGAAAATGAATATTAATATACACTGGAATGGATAATAAATGGACCG
AGTGTATTAAGTATTGGACTAAGGATGATATGGACAGTGATAGGGAGTAGTCAGTTATCG
CCCTGAGTCAGTTACAAGTTTGATGTTTATTACATTGAGATAAACATTTATTACCATAAA
TTAAGAAGTGACAGAAAATAAATATTACCATAAATTAATAAACACTTAAATGACTATGAA
CGTGAAGGATGTGGATCAACGGAGTTAATGTCTCAATCTTTTGATCATTATGCCTGCTTG
GCACTCTTCATAATGGAGGCGGGTAGCTGATTTTAGCTTCTGCCCTGATCAAGATTGTCG
CCTCTGTCAGGAGCGAGAATAAGGTGAGTAGTGGTCAAAGATCTTATCTTGGTTTCAGTC
ATTTGTTTGAGTATTTCCAGCTTATTAAAAAGTATTAAATATAATCAAAAAGTATCCATG
GCCCAATAATAGATATGACAGGAGACATTCTGTTGATTAATTAATAATGTGCACATTGAA
GTCACTTAATGGAAAAAAAATGTAGTGTACTATTGTGAGAGAGGATTCTATAGACAGACA
TTAAGGATATGGCAGGGTTCTTGGTCTTGTGTTTTCTTGAATAATGTGTTTTTTATTAAT
ATTCATAAATTAATGATTTAATCGATACCAATATAGAAACAAATGAAGAGAATGAGAGTC
TAACATGGACCAATAATGATGGCTGGTGGCATGTGAGTCATGGATGATGAATAATATGTG
TGTGGAACTCTGAGCTTCAACACAAGACCTAGTCTGTTCCTCTACAGTCATGAGCCATAT
AAGGACCTCTTGGTCTACAACGCACCACATATATGATGGTGGTCCCATAAGATTAGTACC
ACAGAGCCTAGGTGTGTAGTAGGCTATACCATCCAGGTTTGTGTAAGTACACTCTATGTT
TACACAACGAGAAATTGCCTAATGACACATTTCTCAGAACATATCCCCATTGCTAAGCAA
TGCGTGACTGTACTTGAAATGACCCTATAGACAGATGTCAGGAATATGCAAATATCATGT
TCTTATTTTTGATTCATAGATTCATAGATATAGTTACTAATGAATCAATGATAGAAGCAT
GAAACAAGTATAAATAAATAGGTAAAGAAGAGAGTTAAGCATTTTCCAACTGTGAACATA
CGTGGTGAGGCAAAAAGTGTTACTAATAAAAATTGAAAACACTGATGTTCATTAAGAAAT
AAATGCATCAAGACTATGACCTCTTTGGGTTAGGATCATAGGGACACTGAGTAGTGAAAG
TCAGTTTTAGTGTTTGGATCAGTTCCAAGTTTGAGATGCTTCCTTTTAAGAGAAAAAATA
TATATTTATGAAAAATTAATAAATATCTAAATAAGTAACTGAAATACAGAAATAAAGGAT
CAATGTAAATAAGGTCTGACATATATATATATATTTTTTTTTTATCATCTGTTCTGCTTT
GTACTCTCAGAATGGACACACTGGAGCTGATGTAAGCATCTTCCAAGTCAGGAACTCTCT
GGTTGTGTCTGTGAGTTAGGAGCATGGAGACTAATGTGAGTTATAGTCAAAGTTCTTCTC
TTGGTTTAGGTAGTTTTCTTTAAAAGTATTCAAAGTATTATTAAAAAGTGTGAGAAATGA
AGATGGCCAACTGTGAACTAGTGATGAATGTGAGATTGATGTGATACATTATATTGATGA
TGGCATATATGTAAAATCGAGGCTAATTAATGAGAGATATTGATCTGAGAATTCTATAGA
CAAATTAAAGATATAAAGACTCTTGGGCTTTTGTGAATCATAGTGCTTAAAAATTATTAT
TAGTGAATTAATGATCAATAAACAAATGGAAATAAATGAAGAAAAGGAGGGATAATGTTG
GATCAATGATGACTACTGGTGGCATATGAGTCATATATGATGAAGATGTGTCTGGAACCC
TAAGGTCCAACGGAAAAGAAAAGACTATTCTCTTGGTTTGAAGGGATCCAACAGACAGAT
GTCAGCGATACAGAAATATACAAGGATCTTCTTTATGATCTTTGTGTTCATGCATTTTCA
TTCCCTTATTATAATTGGATAAATGAAAGAATCTATAAATACTAAATATATAAATAAATA
TAAATGGAGTAAAGCATCATCCAATTATAAAAATGTGATTAGGCAAGGAATGCTATTAGT
ATATATTGAAAACACTGAAGTCCAATGAGAAATAAATGGTATATGACTGTTATCTCTTAG
GTAAGGATAATATAGACGGTGTAAATTATAGCCAGTGTTTGTGTTCTGGGCCAGAGGCAA
ATTCGAAATTGTTTTCTTAAAGAGAAAATGAAATAAATATATTTGAAATTAATGATTGCA
TAAATAACTGTCTAAATTAAAGATGAAAGGCAAGGGTCACTGGAGAGAAGGTGTAATTTT
TTGTCATCTGTCCTGCTCTGCGCTCCTCAGAATGGATACACTGGAGCTGACTGAAGCATC
TTCTATGGTCTTGAGCTCGTGGTCACATCTATTTGTTAGGAGGCTGGAGACCCGTGTGAG
TAATCATCAAAGTTCCCATCTTGGTTGGGTCCCTTGTTTAACAGTATTCACTGTTAACAA
AACGTTTGGAGTATAGTCAAATAGGGCCAGCTGTAGCCTCCTGATAAATATGGGATGGAT
GTGAAGCATTATATTGATAGATGAATATGTGAAAAACTGAAGATAAGTAAATTAAAGAGA
TACATTGAGGTGAGAATGATTCTATATACCCCTTAGGGATATCAAGTCTCTTTCTGTGAG
TCATAGTGTTTAAAAGTTTTCAGTGAATTAATGAATTAGTCAATAAATATTGTCAAAATG
AATGAAGAGAAAGTGGACTAATCTTGGATCAATGATGACGACTGATGGTGTATGAGTCCT
ATACGATGAATACCACGTGTCTGGAACTCTGAGGTCCAACACGAAAGAAATATAGTCCAT
TCTCTCTGTTTGAAGTGGTCCTATAGATAGGTGTTGGAAATACACAAGGATTTTATTTTT
GGTCTTTGTGTTCATGCATTTTCAAACTATTATTATAATTGGCTCAATGAAGTAACATTA
AAAATGTATAAAGAGGGCCTGGCCTCGTGGCTGAGTGGTTAAAAAGTTCCACACATTCCT
CTTTGGTGGCCCAGGTTCATGGGTTCGGATCCCAGGTGTGGACCTGCTCTGCTCACCTGC
CATGCTGTGATGGTGTCCCACATATAAAAAAAAAATGTTGAGGAAGATTAGCAAAGATGT
TAGCTTGGGCTAATCTTCCTCAAGCAAAAAAGGAAGATTGGCAATGGATGTTAGCTCAGG
GCAAATCTTCCTCAGCAAAAAAAAAAAAAAAAAAAAAAGTATAAAGATAAAGATGAAAAA
CATTAAGCATTGTCCAGTTATAAAAAATATGTGCTTTGGCAGGAAATACTATTGATAGAT
ATTAAAAACTCTGATATTCACTAGGAAATAAATGGTATAAGAGTGTTTCTCCTCTTTGGT
TAAGGAAAATATAGACATCGTTAAGTAATAGTCAATGTTCATGTTCTGTGTAAGTGGTAA
GACCTATATTGTTTGTTTGCTTGAGAAGATAGAATAAATGTAATCCCAGAGAACTAATGA
CTGATTAAATGAAAGGCGGAATGCAAAGACCAATGCAGATAATGTCTCAAACTTCTTTAT
CATCCCCTCTGCTCTATACTCCTTAGAATGGGCACACTTGAGCTGATTCAAGCGTCTTCC
ATAATAACGATCATTTTGTTTACATCTATGCGTTATGAGCATGGAGACCAATGTAAGTAA
TAGTCAAAGTTCTTGTCTTGGTTTCGGTGTTATTTGTTAGAAAAGATATTCACTGTATTA
TTTAAAAAGTGTGAGATATAATTATTGAAGGTCAATCATGGCCCAGTCATAAATATGGGG
TTGATATGAAGCATTGTTTTGATTAGTCCCTATATGCAATATTGAGACCAAGTAATGAAA
GAGACATATTGCCAGGACTAATAATTCTATAGTCAGCTGTTAGAGATATTTAAGGATCTT
ACTCACATGTTTTGTGGCTTTAGGTATTTATTTTGTTATTGTTAGTAATTTAATGAATTA
ATAAAATTCATCTAGGTGTGAATTAAGAAAGTGAGGGCCAAGGCTGGATCAGTGATGACC
ACTGGTGGCGTATGAGTCACGGACGATGACTACCACATGTCTGGAACTCTGAGGTCCAAT
ACGGTAGAAATCTAGTCTGTTCCTCTGTTGGAAAAAATCCTATAGATAGATGTTAGAAAT
ATTTAAGAATCTTATGCTTCTAATTTTATGGCACATGATTTATGATTATATTAATGTAAA
GGAACCAGCAAAAATATTTAAATGATTCCAAATTATTAAAATATGTGGTAAGGAAAGAAA
TACTATTAATATAATTTGGAATGGACCAAGGCTGTTACCCCCTTTGGCTAAGGATCACGT
AGTCAATGATAAGTAATAATCAGTGCATTATTCTGGGTCAATTGTAAATTCAGCATTTGT
TTTATTAAGAGAAAAGTTAGCAAATATTACCATAAATTAATAAATATTAAATGATTGAGT
AAATGAAAGGTGGAATGCAAGGACCAATGGATAGAAGGTCTCAAACTGTATTTTTCTGCT
CTTTCTTGTACTCCTCCCAGTGGGCACCGCTGCACTGATCTTAGCGTTCGCCATGGCTTC
CAACTTGGTGGTTGTCTTAGGAGCATGGAGACCAGTGTGAGTAATAGTTGAAGTTCTTGT
CGCGGTTTGGGCAGTTTAAGAGTGGTCAGTGTATTATAAAGAAGTAGGAAGTATCATCAA
AGAAGGCTGAACATGGCCTAATAATGAACACGGGATGACAGGAGACGTTGTGTTGAGGCA
TCCGCCTGTGAAACACTGAGGTCAATTCAAGAAACACATCGAGTGTCCGTGGGAAATGAT
TTCATAGATAGACATTAGGGACAGCGAGGCTCTTATTCTCGGGGTTTTCTTGATTCATGT
GGATTTCTTTACTAGTAAGTAGTAAATTAATGAATAAATCAATAGACAAAGTATAAATGA
AGAAAAAGATTCACGAGCTTGGACCATTGATAACGACTAGTGGTATATGAGTCAAGGCTC
ATGGATAATATGTGTCTGGGCTTCTGAGGTCCAACACAAAGAAATCTAGTATATTGTGTT
GGAAAAGATCCTGTAGGCAGTTGGTAGGAGTATCCAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved