Equus_caballus Locus Poly:13:snoR38
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:13:snoR38
Equus_caballus
Poly:13:snoR38
11
snoR38, snoR38, snoR38
1001..1078, 2534..2617, 3078..3150
4150
TCGCGAGAGTTCCGGCGAGACCGCCGAGAAGACTTGCGCGCAGGCGCTACCTCGCTCTC
TCTCCGAGGCCGGCCGCGTGGCTGGAAGTCATGGCGCCTTATGTCTGGGCCATGCGCAGC
GAGCTGTCACTGGCCTTTGGCGATGGCAAGGCTGCGGAGGTGGAGGGACGGGGTCTTCCT
TGATACGGCGCTAGTACGTTTGGCCTCCCCCCCAGAGGCGAAACGGTGACGATAGGCCGG
TCTCCGTCCTCATAGGGTGGTTGGGATTCGCTGAGATGCTGGGTGAGAAAAGGCTTCGTG
AACTGCGCGAGTGTTGCCGATTGAGGGGAGGGAGCCCAGGCCCACCCTTGGCGTCGGAGG
GCCCCTCCCGGGGGAGAGCGGTCCTTCCAACCTGCGCCGCCCGGTGCGCCGCACAGCCAC
GCGTGTCTCCCCGGTCCGCCCACGGGCAGGCTGACGGTGCGGTTCTTAATTCACATCGAC
AGTGTCGACGGCTGGGTGCTTGACTCCTCCTGGAGTGCCCGGAGGACGTCCCCGATCAGC
AGTTTTATTTAGTTCACAGAGAGCAGTCATGGGATTGTGGACTTTGGAAAGCCGTCGTTT
TACATGCTCACTTTTTTCTTTCCCCACAGGCCTTTCTTTGGCATCTGCAGAGACAATGAG
AAGCAAACCTGCAGGTTCAAGCTTAAAAGTAATGAATGGAGCCCCGGCATAAGTAAGAAC
GGGAGCAGGCAGGACCTGGGTGGGCGCCGGCAATGGGAAAGCCAGGCAGTGTGAAGGCCT
TTCATTACGGTTCAAATTCTGTGAATATGTGTTGACCCCTAAGTTCAGTTAGAGTAAGAA
ATCGACCCGGAATCCGGAAAAGAGGAGGGTCTGTCCCAGTGTAATTGGCGCCGCTAGGTG
TCAGTGTTTGAAACCAAAATGGATGCCACTGCATACAGGGATGAACGGGAGACTGGAAAA
TGAGTTTTGGTTGGCTGGGATTTGGAGGTGTTTGTTGCTGCTTGAGCCAAGGATGATTTA
AAGTTATCCCTGTCTGAAGGGACATCTTTTGTGAGGAGTTCTGACTTGCTGAGGCTCAGC
TTTTTAAATACCAATCTTGAGAATGAATACTTAAGATTGTTTCTGTTAGAATGAATTGTG
TTGTCCATCTTTCTCTTTTAGATTAAAGGCGTTGGCTGTGGACTTTGAAAAAAGTCACGG
GAAAACCATCATCTTAGGATGCTGGGTGTAAGGATCTTTGTGATGAAGTTTCTACAGATG
GTGAGATTTTAGCTCTTTCACAGAAGTGCGTAGGTTGGGATCCCTCTAAGTATTGGTCTG
TTAAGATTTCAAGGGTGTGAGGGTCTTCCAGGATTGTTAGAGCACAGAGAAGGGAATTAG
TACGGAACTCTTTGCTAGGCTCCTTGCCAAGTGGTCTCACAAACAGTATTTTTTGCCACA
ACACTATGTGAGGTAGATATTTTCCCCACTCTGCTGCTGAGTGGATAAACTGAGGCTTAG
AGTTCACTTGCCCAGAGTTACACAAGTTGCTTTTTTTAAGAGCCATAAAAATATGGCTAC
TTGATTTGTTTGGGGGGGCATTATTAATATTATTGTTACTTTTTTCAGCTTTATTGGTAT
ATAACTGAACAGCTAGTTAGATAGACCAGTGGTTCTCAACTGAGAGTAGAGGCTGCTAAG
TATCCTGCAGTGCACGAGACAGCCCCTGTGTCAAAGAATTGTCCCCCAAAATGTCAGTAG
AGCTGAGGTTGAAACCCTCTTAGACTCACTTGAGAGATCTGGGCTCTAGCCTCAGCCTCT
TATCGGATCATGGCACCAGAGTCTTATTCTTCATTTGTGAAATAAATGAAGTTAGTGCTT
TCAAACCTGGCTGTACATCATAGCTACCTGCAGAGTGTTACAATAGATGCAGTCCTGGAG
CCCACCTGTGGCGTGGATGAGAAGGACTCCGAAGTGGGGCCTGAGAATCGTGTAGCAGTT
CAGGAGCGAGCATTTGGGAACGAGTAGATGGTCTGATCTCCTTTTAGCTCAGGGATTTTA
TTACAGCAAGATTATAGCACTGGCTATTTTTAAGTATCTCTCAGGGTAGATTTATAATCC
TCTCTTAGAAAACTGAAAGCCACATGCTTGCTCTGTAGGATCTTTTGTACACAGAGGTGA
GTGAAGGAGAAGTGACCTTCTGTGATGTCGTTACCCCTTGGCATCAGGTACCTTCTGTGC
AGCCGGCCTTCAGTGGCTTGCACTGTCTCGGGCATTTTACCAACACTAGAAAGAGGCTAG
TATGCTCCATACTCAGCTGTCAGCCGCTTTGTACCGTGACAGACCTCGTCTTTAAAAGGG
CAGGCACTGTCAGTGTCGGGTCTGGGATACTGGTACACCTAGGCACTAGATAGGAACAGT
TTTTGCCTTTGAGGGAAAGCGCATTCTAGTAAAGTAGACAAGGTCGAAGGAGAGTTCTCA
GGAGGGAAGGAAAGCAGAATCTGGTAAGGAAAAAATAGTTTTATCAGTGCTGTTGGCTGG
CAGATTGGTGGGAGCTGAGTCCATGATGATGTCGAGTTATCCCTGTCTGAAGGCAAAGAA
AGGCCTTTCTGTGTGGAATTGGGATGTCTGAGACTCAGTTTCCCAAGTTTGCTTTATAGA
AAATTGAGGCCTGATTTAGAAGCGAGCTATTTGAGAGAGAGGCGTGTCTATCTTCTTGAA
TAGGTTTTTCTTTCTCAGTTTCTCCTTGCCAGGGACAGTCTCAGCCACGATTTCTGAGGC
TCCAAAGGATCCTCCGGAAGGAGACACTAGCTAGCCACGTGGTGTCAGCTGCCCTGAGCC
CGAAGTGGGACTTCGCTCGTGCATGTAATAGAGAAGACCTGGAGTGGGCTTGGGTGGGAT
GTCCTTTTCGCTTCCCCTGCCCTGGACGAGGGTTGTGCTCAGTGGCAGGGAGACTGTAAC
ATACGTTTGTCGTCTTTACCAGGTGTCTGCGGCATGTGGGACAGAACTGAGCTGCTGCTT
TGCCTGAAGCAGGTGCAAGGATTCCTCCTGTTGTTTGTAAGCTTTCTGTTCCCATCTTAC
ACGTCCCTAAGAAGCCCCACAAGCCTGTGATGCTCAGTTATCCCTGTCTGAAGATCTCGA
CTGAGGGAAGACAATCTGTTCTGAGGCTTAAGCGTTTGTCTTTTGCTCTTAAAAGAAGCG
CAGGCTTTATAAGGGCTCGAATTGAGTGGACTCCAAAGGGAATTGCTCGTACCCTGCCGA
GACCCCAGTCGAGTGCATCATCCATCTGCAACTCGGAAGCCAGTGCTGTGGCTGCCGTGT
CACGCTCTAAGCCCTTTGATTAATGGCTCTGAGGGTACAGGCTATAAGAGGTGGCAGAAA
CGGGCAAGTGGCCCAGATTCGGTTTATACTCTTATTGTGGAATGAAAGAGTGCTTGTCAC
ATATTTCAGGGAAACGAATGTGCTCTCTGAAACCGACGGGAATGTAGAATGTTTGCCAGC
TGTGGCAGTGAGAAAACTGAAGGGCTTTCTGACCTCCTGCCTCTGTGTGTGTGCTGACAT
TCAGGAAAGAAGAGGCACCAGGGCGCTAGCAGAGCTACTTGGTTTCCAGGTGCTTTGTTC
ACACCAGAGCCTCGGGCCTCTCAGCTTAGCTCAGTTCCTGTCTGAATGGCTGACTGTCAT
GGGGCTGCTCCTTGGGCAGCAGAGGGCTCGGCTGGCATACGAGCAAGAAAGTAGCGAAGT
GGCGCCGGGCAGGGAGGGCATCTGGTTGTGTTCCCGTTCAAATGTCAGTCTCGAAGTGGG
CACAGGTTGCCTTTTCTGTTGAAATTGGGAGGTACGTGCAGGCTCTTTATGTTTAAGGTC
ACGTGTTTGGTCACCACGGAAGCTGTATTTGGGGTCAGATTTAATGATCCTGGAAACTGG
CCACAGCAGCTTACAGCCTGTAAGTCAAACCAGGTGAACGGAGGTGTCGGCAAGCAGGGG
ATCTCCTTCCTGGGTCAGAGTCGGCTTCAGTAGACTTGGCGCTCTGCTGGACTCGAGAAA
ACCTTAGGTTTGACTTTGAAATTGTGACATCCAGAGGGGGGTTGAATATCAATGTCCCCA
GTGCTCCATGGTGGTTCTCTCCTGGCCACTTTCCAGACACTCCTCCCTACTCCCCCCAAG
CACGGCCTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved