Equus_caballus Locus Poly:11:SNORD88
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:11:SNORD88
Equus_caballus
Poly:11:SNORD88
10
SNORD88, SNORD88, SNORD88, SNORD88
1001..1091, 3508..3598, 4141..4231, 5594..5687
6687
CCAACATCACAGTCTTGTTAAAGGTTAGTTCTGGGCTGGTTGGTGCTTAAGGTCGTCTT
GATCATCCGTTTCCTGATGGCCGAGCAAGGCCGCACCCCTGCCGAGGAGGCCCAGCCCGG
GGCAGCTTGCTGATTTTCTGTCTCCCCACCACGGCCCAGGAAGAACCCCCCTGGCTGTGT
CCCTCTCTTCAGGCAGCCACCTAGAAAACCCTTGACTTTATCCTCACCATCGCCATGTCT
TCTGTGGAAGACTTTTTCTCCGGCATCCATCATTGGCATGCCCTCTTTCGCCGTTGTCCA
ATATATTCCTTTTTCATAGCTTATTTTTTTAACTTATTATTAAAACCCTCCTACAGGGAA
ATAGACATAAGTTTCACAGTTGTACCATTTGGCTTTGTTTGTTTTTTTGTGTATTTAGTG
TTTTGAAAGTAAATTTATTTCATCCAAAATAGTTAACCGTTGTGACTCTTAAAGTAAAAT
TTTTCTTCTGAACGACAGTGCTGTTGTCACCTCTAATGAGACTGATCCCTTAGTGACGCC
GTCCCCTGTCTGCTTTGTGGTCACGGTTCCTAAGACATCCCCAGAATGTCTCTCACGGCT
GATTTTTCAAAAATGGGTGCTGCGAAGAGTCTCCAGTCATTGCTCGTGGTCCTTGTATCT
TGGCTTTTTTTTCCTAGAATAGCCCCCTCATTCCTCCCAACAGGTTCTTCCAAGAGATCT
GCATCTTAGCTTTCACTGTAGGCTTATTAGCAGGAATAGCCAGTGCCGAGAATGTGCAAA
AGTGGGCAGGGGCGCGGGGACCCCTGGTTCTCTCCACAGAGTGGGTTTGAGGACAGTTCC
CTGGGACGCTGGGGGGGTGGGGGCATCCTGCCGTCTCCATAGGGAGAGCTGTGGGCATTC
TCACCCTCATGGATTTCGTGGTTCCCAGTCTCAGTGCTCTTCTCAGCTTGGCCTCTGTCC
CTGAAGGTGAGTGGCCTTGGGGCCTGATTGCAGAGGGCCCAGGGCTCCCATGATGTCCAG
CACTGGGCTCCTATCACCCCTGAGGACACAGTGCCCCCCAGGACCTTTGACACCTGGGGA
TCTGAGGAGCCCTGGTTTTGATAGTCTCTGTACCCCCAGACGGTTTCCCCCCCACCCTCA
CCAAGTCCTTTCTGTGTTTACAGGTGTGTCTTCAAGCGGAGGAGCCACCCACCACCACCC
CCTCTTGGTAAGAACCCTTGCTCCCACTCCCTCATGCACCCACATCGAAAACACCTCACC
CTCTGTTTGGGTGACTTCATACCCAGTATCTCTGGGACCTAATTTATGTGCCAACCATTG
TGCTTGGGATTTATGCCAGATCCCAGCTCCACTGTTGATGGCTTGGTAGTGTTAGTCAGA
CACTGCTCTCCCGAGCCTCAGCTTCTGTGTCTGGAGAGTGGACCCAACACATCAGGGGTG
GATGGGCCCGAGGCCTCCACACGGCGGGTGGTGGGCCGTGAGGTTTCCCGCCTTCAGAGG
TAAGTGTTGAATAAGACAGAATGTGTGGGCTGTGGAAGGAAAGAATACGGATGTGTTTGG
GTTTGGGGCAAGACAACTAAGGAGAACTCTAATTTTCAAACTCAGCAGAAGAAAAGAAGC
AGAAAGGCTGGCAGCTGTCATCGCTCACACTGCGGGTTTTGTACAGCCTGGCTACAGTGT
ACCTTTCAGCAAAGCTTAGCCAGCCTCCCATGAATCCTGTGCTTACAAACTGATACAGTT
ATTCCAGCTGCCCTTACTTTACACACCAGCCCTTATTAAAATGACACAGATTATCGGGAG
AACGTTTCACAAGTCTTTCAAAGAGCTGAATCATCAAAGGGGCAGAGATCTGCGTGTCCT
CCAAAAAGAAAAGAGAGTTCTCAGCTCTAGGGGGGATTTTCCGGTCCAAGGAGCCGGGAG
AATGGGGGCTGCGGGGAAATAGGACTGAAAGTGTGTTCTCCGGGATTCTCAGGTTTCGCC
TCTTGCTGATGAGCGTTTAGGGATGAGCGGCTGCTTTCTGGGAAGGGTGAGCTCAGATCG
TGGGTCATCTGAGGGGCTCAGGCGAGGGGTCCTCTGTAGAGCTCTGAGCCGTCAGCGCGG
GCTGAGAGGGAATGTCTGGGGAAGCGTGGCGCAGGCAAGGGGCCGCCTGGGCAGTGATAT
GTGGCGGTGGGGGGGTGGCAGCAAGCAGAGGGAAGATGTGACAGCAGGATAGGGAAGACC
TGAGGAGTGTGTCACATCTGTCGATTTCTCAGGCAGTGCTGGCCGACAGCTGTCAGGACG
TGCCCGTCCTCTCTTACATTGTCCATTCCAGTAGCTCCTGCCACACGTGGCTCGAGTACC
TGAAACAGCAAGTGCAACTGGGAGCTAGATGTTGAAATTGTACCTATAAGTAGCAGCTGT
GTCTTTGGACAGTGCATTTCTACACAAAACATGGGTTTGAGGGTTTGTGCTTGCTAAATA
GTAGCCCACACTTGGGGAGCACTTGCTCTCTGAGTCCTCCCGGGGTCCCAGTGAGAGGCA
TAACCGTTCCCCATTTCACAGTCGCCTCCCCAAATCACAGAGCAAGGGAGTACAGCCACG
CGTCGCTTAACGACGGGGCACGTTCGGAGAACGGCGTTATTAGGCGAGCTCGTCGTCGTG
TGAACATCCAGTGTGCTTGCACACACCTAGATGCTAGAGCCACCTGGGCACTGTAGTGCT
GGTCTCATGGGACCGCCACTGTTTATGGGGTCCGTCATGGACCGAGACGGGATACAGCAC
ATGACTGCAGTGATGTGGGTCCCGCCCAGCCAGTTTGTCTCAAGACCACGGCTGCGGGGC
CGGCCCCGGTGGTGCAGCCGTTAAGTACGCACATTGCACTTCGGTGGCCCGGGGTTCACT
GGTTCGGATCCCGGGTGTGGACATGGCACCGCTGGGCAAGCCATGCTGTGGCAGGCATCC
CACATATAAAGTAGAGGAAGATGGGCACAAATGTTAGCTCAGGGCCAGGCTTCCTCAGCA
AAAAGGAGAATTGGCAGCAGTTAGCTCAGGGCTAATCTTCCTCCAAAAAAAAATAAATCA
TCACGGCCGAACAAGAGACTTGGGAAGAGTTGGGAAATCAGACGAGAGGTGTGGGGTGTT
CTCATTCGGCACGCCGGGGAGCTGAGCCCGGGGGAGGCCGCCTTCGTCTCACTGGAGTCT
GCCAACCGCCTGTCTGCCCGGCGGATCTGTTCCATTTTCCAGAGGAAGAAACAGCCGGCG
GGGCGGGGGGCACTTAGTTCTGTGGCTGCAGGTCGTACAAGAAGTGACACCCAGGGAGGA
GCCAGGCAGGGAGGGGTGGTCTAGGGGGGCTTGGGGGCGCAGGTATGCTGTTGGAAGGTG
AGTCATGGAGGCTTGCCACTTGGCCTCCCAGGGACCAGATACTGCTCATTTGTCCCGCCT
GCGTCTCTGAGCTCTTGTCTGTGTCATCCCCTTAGGGCTATAGGCAAGGGACTCTGGGAC
CTGAGCGAGGAGGGGGATGAGGGCACCAGGGCCCCCGTGATGTCCAGCACTGGGCTCCGA
CCGCCCCTGAGGACACGGTGCACCCCGGGACCTTTGACACCCGGGGGTCTGAGGGGCCCT
GCTCTGGGTGGGGGAGGGAGGGCTGGCGGGCCGTGGGTGCCCTGCGCCCCACTCACCTCC
TCTTCCCCTCCCCCTCTTCTGTGTGCAGATGTTTCCTCCGGGACTGGAGCAGCCCCACCA
TCCATCTTTGTAAGAACAGAAGAGGCTCCCTCTTAGTAATACCATGATGATCATATTCAA
TTTATGTTATAAATGTATTGTTTATAAATAAAATTTATAAACTAAAAATTTCTAGATTAT
GGTAATACTAATTTAACAGAGACAAATGCTGAGCATTTGCTGAGCCAGGCTTGGTTGTAA
GCACTTGCCTGCCCCCCGCTGGCCACACAAGGGCTTGGGGAGACCCCGGGCTGGTGGCCG
AGGGCTCAGCTGGTGCTACTGAGGATCACCAGGTGGTGGCAGAGGGGGGAGCGTTGACGC
CAGCCTCTGCGGCCCCCGAAGCTGCCATCCCCTCCGTGACGTGGAGTCCACCGCGCAGAT
GCTGGGGGAATGTAAGACAAGGGGGGTGCTCCATCAGAGGGTGCTAAAGGGGCTGCACGC
GGGGCCCCCGTGATGTCCAGCACTGGGCTCCGACCAGCCCTGAGGACACGGTGCCCCCCG
GGACCTTTGACACCTGGGGGTCTGAGGGGCCCTGCTCTGGGGATGAGGGATGGGGGCCCG
TGGGTGCCTTGCACCCCACCCACCTCCTCTCCCCACGCCCCCACCCTCCCCTTCTGCCGG
GAGCCATGTTACCAACGCCTGTACAGCCATCTGACAGGGTCCGGGCTGAGAAGGGCCGAG
GGGCGCAGGGACGCCCCTCGGTGGAGAATGGCCGACCGTCACCCCTGATATTTTCTGAAA
TGTATGCATGCTTTCTATCAAGGTTTGACTGTACTTGTCTCTGCTTTTCATTCTTGAAGA
TAGATAATTTAACTTAGCTTTTCAGTCTGATGCCTTACTAGCAAAATGATATTTTCTCCG
GGCAGTGTGCTCAAGGGACAAATAGTCCTACCCCCTGAAAGACAAAGGAATGCTTTCACC
CCCTAAGGGGCGCGGGAAGGTAAAGATGTTTATCCGCTGAGAACGCACATAGTCCTGGGG
ATAAGATACCCGGGAGTTGCTTTTTGTTCCCATTGACCATCGGAACAATGACTAGATGAT
CGATGGGGGCAGGGGTAGCTCCCCCAGGACGTGAACAGATGGAATGCTGTCCTGTCTGGA
TGTCTGGACCTTCTCTCCGCCTTTGATCTAACTTTACCATAAATTACCTTTGTTTCTGAA
CCCACAAATCCATACGTGAAGAATAGAAGATTCAAATAGACCCCATCCCTGACGTCAATG
TATATTCGTCCCAAAATAGTAGAGGAAGTCATTTCTATACCCTTTAAAGTTTAGAAGTTA
AATTTAAACATACTCCACTACAACAGATGCTAAGCTACCTATCTCCTTTAGTTTAGAGAC
AATAAATAATCGTTAATTGCGGAAAAGATGATCGTTAACCTCGTGCTCTATAGAATGGAA
TGCTAATAAAAATTCTTGTGCTCGCTTTGTACTTCCTTATCTCTCTCAGAACATCTGTAG
AGCTATTTCTGTACTAATCTGAAAAACATAAAAACGACACTTGTGCACAGTAAAGACAGA
CTTGATTGCACCGACTCAAGTTTCACGTCTCTTCCTTCACTGCCGCGACTCTGTCCCTCC
CTCAGGAACCTGGACTTGGCTGGAGCACCACTCCGGCACCCTTCCGTCTGCAAGTGCTTT
CTCCAGGACTGGAGCAGCCCCACCGTCCTTCGGTAAGGACAGAAGCTCCCTCTTGTTAAT
ACCATGCTAGTCATTAAATTTATTCTAAGTTTGTAGTGAGTAAACCTTACAGACCGTGGC
AGCGACAGGCAGGTGCCGAGCGCTTGCTCTGAGCCGGGAGCCATTCTAAGTGCTCGACTC
ATTTCATCTCCACCGTTGCCCTATGAATTGGGGGGGTCACAGCCAACATCCTGTGTCAGG
GGTCCTGAACGGGCTGTCCCCCGCAATGTCCAGCACTGGCCTCTCACCGCCTGTGAGGAC
ATGGTGCCCTCCGGGCCCTTTGATACCCCGGAGGGCTCTGAGGGGCCGCTCTGGAGAGAC
GGGGGCGGGGCCGCTTCCCCGCCTGATGTCTTTGGTGTCCTTCCTGCAGGTCCTCTGGCC
GAGGCCTCAGGCTCCTGTGCCTCTCCCGCCCGGGGCACCTGTGGCCATGGCCGAGGGCGC
GCTGGCACCCATGGAGGTGGGGCGGGGGGACCGCCAGTACACGTACACCGAGCTCCTGGC
CATCTCGCAGCGCTTCAAGCAGAACCCCAGCGAGCTCATGATCACCTGGATCCTGCGGGT
GTATGACCAGGGGGGCTCAGCCCTGACCCTCAGCCCCGGGGAGCTGACGCTGCTGGGCGA
CCTGACCAGCGACACCGTCTTCAACTACCGCTGCAAGGCGCTGCGCGGCGGCCGCCAGCC
GCTGCTCGCCTGGCTGCTCCTGGCCTGGCGCCAGCGCTGGGAGTCCTTCCTGCATTTCGA
CTCCACCGAGCTGCCCTTCCAGCCCTGGACCACCATGGAGGAGGGCATCCAGCTGGTGCG
CGAGCTGGGCATGCTGGACTGGATCTACAGCGAGCCGCCCCTGCCTGCCACGCCCGAGGA
CGGGCCCTTCACGCCCGGCCTGCAGCAGCGCCTGCTCACGGCGGCGCCCTCTGAGGCGCG
GGTCTCGCTGGTCAACCTGCTGGTCAAGGGCATGACGGTGCTGGAGGCCATGATGAAGAT
CCACGCCCTCGCCGACGTCGGCCTGCTCTGGCGTCACAGCCAGCCGGGCGGCGCCAAGCT
CGTGCTGGGGCCCAACCCGACGCACAAGGACCTCCTGGGCTGGCTCCTGAGCCACGGCGT
GCCCAGGGAGAGGGTGGACAAGCAGCCCACCAAGGTCCTGATGGAACTCTACATCAGAGA
GGCCAGGCGCAGCCGTGGCCACCCGGCCTGTGTGCTGGGGGACAAGCCGCCGCCGCCGCC
ACCGGTGCATCGCAATTAGGACCCCCAGGCCTGGCCTTCCATGGCCCTCGGAGAGGAGGC
GGGAGGCCACGTTCTTGGGGAGCCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved