Equus_caballus Locus Mono:37:SNORD45
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:37:SNORD45
Equus_caballus
Mono:37:SNORD45
5
SNORD45
1001..1079
2079
CTCGGTGGGGTCCTAGGGCAGCCCTGGAACTGCTCCTTCCTTCAGGCGGGAGTATGGTC
AGCTATGCCGGGGCGCGGAGGGGACTTGAGGGCGCTTCTGCGCAGGCGCGTGCCGCCTAA
ATCTGCCCAGGAACTAGCCAAGTCCTCTTTTCGTTCTCGGACATGGTGAGTGAGGGAGTA
TTTGGCACTGCTGTCCAGACGGGTCGGGGAGAGACTGGTTAGGATAATGTTGAGCCCTCA
GTCACCATACAGTGGTTTGCCAAGTATTGGAGAATAGTTGGGTTAAGACACGGGCTTTGG
AAGGTTTCTTGAGGGCTCCGAGAGGATGAAGGGTTACTCAGCGTTTTCTGCAGACTTCGC
GGGCCCAGTTGCTGCTTCTCATTTTACCCAGGCTTCCTCCTACCCGGCGGGCCTCGGGAT
TCAACAGCCCGATTTCTTAATCCCGCAAAGAAGCCAGGCCGGTTGGTGGTTCTTTTTTCC
TTACGTATATAGAATTCTTATGGCTCAAAATCCTTAGAATCATTAGAGATGTGATCTTGT
TGAACATCTAGTAAATTTTAAATGGGGTCTTAAGGAAATTTACTAGTACGTAGTCCTTTT
TGGTAATTGTTATGACCTACTTAAAGTGAGTGCAATGCAGTCTCCAGCGCAAAGATCTAA
ATAAATGCGAGAAACAAGGCTTCTGGGGCCTTGTTGCAAATGCGGAAACAGACTAAAGCT
GGAGAAGATGAGGCTAAAGGGACTGCTCCCTTGATAAATTGAACAGCTTTGGGGGTGTGT
AGAGGTGCTTTGAAACCTGAATTTCTAGGATTAATAAACTTTCATTAAAGAACTTAACTG
TAAATTATGGGCTAGCTAGGTTTTTATTTTAATGTTTCGGCTTGCTTTCTGCCACATGTA
AACGGTAAGTTACCCTGAGTTGGTAAGTTTTCATAGTTTATGGTGTTTATTTTACTTATC
TCTTCAAGTGAACGATAACAGATGAGGGTAATAATTTTTTGGGTCGATGATGAGCCGGCA
TGTATTCTGAATCTAAAGTTGATTATTACTACTTCAGCTCTAGAATTACTCTGAGACCTG
AAAAATACCTGAACCTGTACAGGGCTTTAGTGCTTAAGTTCCTTTTAGTCAGATACTTGG
CAATTTCTAAACTGGAAGTTTTTGTATAGCAAGATGAAATCAAAGTAAAAGGTTCACATA
TATATTGAATAGATACTACGGCGTCAAACATTAAAAGATAAACATTGATGAAATCACTAC
CTTTTTATTTTGAAAGGGTACACCGCAGAAGGATGTTATTATCAAGTCAGATGCACCTGA
CATCCTGTTATTGGAGAAGCATGCAGACTATATCGCATCGTATGGCTCAAAGAAAGACGA
TTATGTATGTAAGGTTTTATGTTGAAAAATGTATTTTAAAGGAGTTAGACTATTCTGCAT
AAGCAGTCAGTCTAGGTCAGTATTTGTGGCCCGTGTTTCTTAAAAATTGTATCCAGCTCC
TGCATGCCAAGGACTGAATTTATGTCCTTGAACTTCACTGAGTGTGCCTTTGCATATCTG
AGGTTGAGGGTCAGTCAGAATTAACAGTGGTCCTTACCAATACTTATTTAGAGGGCTTGA
CAAAGTAGATTCCCCTCCTGCTCCGATTTGTAAGAGGTTTGAGGTACAGAACAGATTTTT
ACTGTTGTAGTTGAGGTGATACTTTCAAGGTCAATGATGTGTTGGCATGTATTATCTGAA
TTTATGGCTGATGTGTAATAACACTTTAGCTCTAGAATTACGCTGAGACCTTGAAAAAGC
TTTGCCTTGAGTTTTAAACTTTGAAGAATAGTTTTCCTCTCTGGGACAGTCTTAGAAAAA
GTAATGAACAACTCAACTGAAAGTAACTATTTTCCCCTGTAGTATCGAGACAGCTCAATT
ATCTCCCAGCTTGGAAAACCCCTAGTATTGATGAATTCTTGACTTAAATGTGGTAGGTTC
CCACAACGTTGTATGGCTTTGTTAGGGCCATGTTTATTTTTTTCCCTGGATGGCTAAAGG
GTTAGAGGATGACTTGATTCCTGCCTTTTTTTTTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved