Equus_caballus Locus Poly:1:SNORA71
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:1:SNORA71
Equus_caballus
Poly:1:SNORA71
22
SNORA71, SNORA71, SNORA71
1001..1132, 2863..2995, 4215..4348
5348
AGGGCGCCGTGCGGAGCCCGGGTGAAGCGGGCCGGAGGGCGCCGAGCCCGCGATCCTCT
CCGCCCCACCTCCTCGCCTCCTGGCGTTCGATCCCCCAGGGCCCCTCGGCGCTTCCTACC
AGGTGAAGCGTCCTCACGGCCGTTAAGCCATTTCTCCCCAATAACCTCTCAAGGGATGTG
TTAAAAGCTCCCTTCTGCAGACCGGGTGGCTGAGCTTTGGATTCAGGACGCCCCCAGGGC
CCCGAGGGGCAGAGTCTGGGTTCGCCGCCCCCCTTGGCTCAAGCCCCTTCCCCTTTTCTC
CCTGCCTAGGCCCTGCGGCTGCCGAGCTCGCGGAGAGATGGGACCTCGGCCTCGGACGGC
TGAGCGGGCTCTGCGTCCGCCGGCGCCCCCTGCTCTCCTGCGGGGCTCTGACCCGCGCTG
CCCGACGCGCCCTCCGTGTCCAGCGACTGAGGCTGTGCCCTGGTGAGAGCTGCGGCTCCT
GAGCGCCTTGAAGGGGGCTCGGTGGCTTCCTGCTGCCCGCAGAGGGGGTGGTCCTGGGGC
TCAGGTGACTTCTGAGAACTGTGTTCGAAGCTCTTGTGCAGGAGGAGGCCTGGTGTAGTA
GGGGGGCTGAGTTTGGGGTCAGAAAGGCCTGAGCCCAGATCCGGACTCCGCTCCTCGTTA
CCCGGGTATCCTGGGGCGAGTTACTTCATGCTCCTGAGCTTTCCTTTCCTTCAGGTAGGG
AAACTGCAGGAGCTCTGGGAGGACAGAGGCCTTGTCTGTGTTTTTCTTTGTTTTTGAAGC
CACAGTGCCTGGCGCCCAGTAGGTGCTCAGTCAGTATTTGTGGGGTGAATAAAGAACTGA
GGCATGTTTACCAGAAGCTGTTCCTCCTGTGGACTGTGTTGATGCTGGGAGCTGGCATCT
TTCTATGAAGCTCTGATAGCGCTCGGGGTTCTGAGCTTGCCTATGGGGACAGTGGGCTAA
CGTGGGCTTCTCTTCCTGGCTCGCCTTCTGCCCGCTTGTGCCCCTGCATTCGAAAGTGAT
GTGGGCTGCCTGTGCCCTGGTCATTGATTGTGCAGGGAGAGGAAGTGCTGAAAGCCTTTC
TCCGTGTTTGGAGGGCCCATCCTGTCTCTTCCAAACCCTGGAGCTTTCCTGCACCTCCTC
CCCCCTGCCACCTTTTGGATGACCCCTGTCCCCTGGGATCCTGCTTATTAAGCACTCTCT
ATGTGAGGCTTTTAAAAAAGAGAAAGCGTGGTCCGTGTCTCAAGGAGCTATGGGCTGGTT
GTGGAGCCACTAATTGGGTTATTTCTCACCAAGGGTTTCCCTCCAGGAAGCCACTTTTGC
CTCCCTTCTCTCCCTTTTCCAGGTCCTTAGTCAAGCATGTTTCCTGGTGTGATGTAGTCT
GGGAAGTGGCTTGACGTGAGATGAGGGCACTAATCATACCTTGTGAAAATTGTTGCTTTT
CTAGTCTTTTTGCCCCTCTCAGCTCTGATCTTGAGGTCAGCGTCTGAGTCTCACCTCTCC
TTAGGCTCAGCGCCTGGTGGGGGTCCAGTGTTCACCAGTTGTGAACAAATGCACAAGAGA
GAAGAAAAGGAGAGACACATCCTTGTAAGGTGGCATGGCCTCATCACGTTGTGGAAGATC
AGAGAAAGACTACGTGGGAGCCAACCAGAGGGAGGTGAGAGCGCTTCCTCTGTATCCATT
GGAGGCCCTTTGGCATGAGACGGAGCCTAGTCCACCAGGGGACGACTTTCCTGGTGGCCT
GCGGTCATGGTCATAGGAACCAGAGCAGTAAGGAAATTGGACCAGGCTGATATAAATAGA
AACCAGATCTCACCTTCACGGGCCATCTGAGGTGCTGCTGCCCCATTGCCTCCCTGTCCA
TGCCAGGCACTGCCTGTCAGGTGCCACCCACTCCCAAACCTGTCCTGGATTTTACATCCT
GTTCAAGGTCCAACTTCCAGAACCTCCACAATTTCATTAGAGTTCACACAAAAGATGACC
TGAAAAGCCTTCTTTGCCATAGATGATCTGTTGTCCCATGCGGAGTTGTAAACTTCTTTC
CTGTTCATGAGAAAATGATGCAGCTTGTGGGTTAGTAACAATAGCCCACATTTTGAAGCA
GCCAGCTATGGTGCTAGATACTCTGCATGTGCCTACCAGGACATGTGGTGACCAGGTGAC
ATCTAGGTTGCTCATCCAGGGCTTCTTGTTTATTGCAGAGGGGGCAGCTCGGTGCAGAGG
GGCCCTTGAGAGGTGTCTCCATCCTGTCAGGAAGCAGCTGGACCACAGTGCTCCCAAGGT
GAGGTCTGTTCTCTGGAAATCTGGGGCTTTGCATCCCACAGGCGCATGCAGGTTCCCTGG
GTGTGATGTCGTCGGGGAAGTAGATAGAGGAGACAGGAGGGTGGCTCTGTCCTGGCCCTC
AATTTTACTCTCTGTGACCTTTGAGAATGCACCTGCTTCCTCTTTATGTGCTTGGTTCTG
AGAGCCCTTGGGGAGCCCTTCCTCAAATTGATCTGTTGGCATCAGAATGGCTGAATCTAA
AGCAGGAAGGATTTTGGCATATTCGCCTGTGCCCGGGTCTCAGTCACTTCTCTGCCCCTT
CTTAGCTCTGGGACCTTCTCTTATCCCTGGTCTCATCACCCAGAAAGCAGGAATACAATG
AGGCCATTTTTCTTAGGATCGCATAGCCCCTGTCTTTTACAACCCAACAACTCTATCGCT
TTTCTTTCAGAGGTGTCCACCCTTTCCTCTCCTGTCTGGGCCAAGTTGAAGGAATTTTTC
TGCAGGATTGAAGCAATTACGTGGTGCTGTGCTCAACTAGGCTGACTCCTCCAGGCCTCT
GCCACTGGCCTCCTTTTTCAGCAAGCCCTCTGTCCTTTTCTGCCTCTGCATTTGGAAGTG
ATCACAGCTGCCCGTGTCCTGTTCATTGGTAGTGCAGACAGAGGAAACGTGGAGAGGATT
GTCACATGTTTGGAGGGTCCACATCCTCCCCTTCCAGATCTGGGAGCTTTTCCACATTCC
TACTTCTCTTCTACACACACCTTGGGCCTCCAGGGCCTTGAGGGCTGTCATGTGTGTGTC
GGTGTCATTGCTGGGGCTTTCACTTCCTGCCCCTGCTGTTGGGAACCAGGCTATGTGTGT
TGCTTAAGTTCCGCTTCATGCCCAGCTCGGTTGCTGTGAGTCAGCCATGGCACACTCCCA
TAAACCCGGCCTTGGCATCCTTTTCAGCCTATCGCTGATTAATTACACGTTAATCAGTGT
TGCCCACCCTGCCGTAGGCCATCCACTGTCTCCCTCTTTAACTCTTTAGAGTTAACTACT
ATCCCTTTTATGAGAAAATAATGTATCTGTTTAGGAAGTAATAACAGCAGGCATTTGTGG
ACTGCTTACTATCTGGTAACTACTGTGCTCAGCTCTTTCCTGATGCCGACCATGCCCTGT
TGTGAGCAGGGACAAGTGAGGTGCTCATTCATGGCTTCTTTCTGTTTCAGATGAGTCCAC
TGTGTGCCAAGGTGGTCATGGGAGTTATCATGTCAGGAACATTCTAGACCCCAGTGTCCT
TGAGGTAAGATCTCTAGAGGGTCTGTTCTCTAGTGTGTTGATTCCTTGCATCCAGTAGAG
TCCTGTTTGTGTTTCCAGGGGCTTTCGGTGAAGATGTAGGGGAGCTGAGAGTTGAGATGA
AGATAGTGTCCGTGAGTTCCCAGATCCACTCGCTACCCCAGCCCCAGGCAACCTAGATCA
CTTTTGGTCCTTTACATGTCTTTAGCGGCTGCTGCAGGGGTGGGGCCTCCGGAGTCCCCT
TTGGGTAATGATAGGTCTCTGGGGTATCTGCCCACCCTCCCTGGAGTGTCAGCAGAAGCA
TGTTGTAATGGAAAAATGGGTGGACCTAAGCATCAGATACTCCCGTCCTGGGTTTGAATC
CCTTCTGCTGCCATCTCAGTCAGTGACATATTCAGAACCTTCTTTTCTTCATTTGAAAAA
CAAAGCTATGATAGAGGTGACTTTTGTGGTACTTAAGCCCACATGATTCCTATCCTTTCC
AACCTTAATATTTTCCCAATGTTTTTGCCCAAAGTGACTTCTCTTTGATTGTAGCGAGGT
TCTGTGGGGCTTTCGCAGGAAGGAATAGCCATTCCTGGGGTCCTGTGCTTGGCTGAGTTG
TTTTCCCAGACTCAACCTATTCCACAGGCTGCTGGCACCTGCTCCTCTTCCAGATCTCTC
TCTGCCCTTGTACACACCTGCATTCAAAAGTGATCACGGGCTGTCTGTGCTCTGGTCATT
GATAACGCAGGGAAAGGAATTGTTGAAAGCAGTTTCCCGTGTTTGGAGGGTCCACACCTG
TCCCTTTCAAATGCTGGCGCTTTCACACACTCCCACCTCCCTCCAGCCAGTGCTTTCTGC
GCTCAGGCATCGTGGGCTGCTGTGTGAGGTTCAGTGACAGGAGGCTTCTTAGCTCGGCCT
TTCTCAGCTTGGCCTCCTGTTATCTGAGCCAGGCTATGTCTGTGTCAGGTTTAGATACCC
TAGGGGGTGTAAGGAGCCAGGATGAATTATGCATAATGAATAAGTGCAATGTCAGGTGGT
ATATAGTGACTGCCAGAAGATTTTCAAAGGGAAGCACTTTTTGGAGGTGGTAGGCCTGGG
CAGGCCCTTGAAGGGGTGGGATGTGATGGGCCATAGGAAAGTATTCAAGGGAGGGGAGCA
ACATGAGGACGACTTTGAGGCCGGGGTGAGCATGGGCACCTGGGAAGACAGATGTGCAGG
CAGGTAATGACAGTGTGGAGGGCCAGCTGCTGAGGTGGCGCCCTTCACTCCCACCACGGT
GTGGTGGGGCTCAGTGGGAGGAGCTCTGGCAGTTTCAGGGCAACACAGCAGATGTCTGTG
TTGCCCTGAAAAAGCCCATTTTTTTAAGACCTGTTCCTTTTAACTCTTCTCTGAGAGCAC
TGAGATTCTTTTTTGAGTCAAGTTTAGTGTGAAAAACAAAACTGGCAACTCATCCCAGAT
TAATTGGGGGCATCCTCACTGATGACAGCTTGAAGAAAGAGGAGATGACATTGGAGATCA
AATGCTCCTTGTGACCTCCTGCTCTGTGGCCTCCTTGTCACTCTAGGGGTGCTGCTGTAG
ATCTGGAGCTCGTTGGAGGAAGCCTCAAGGGGTTGGACGCACTGGCCCTCTCAGGATGCT
TACCTGGGTCCCAGTTCTCCTGGAGAGGCCTCCTCGTGGTAAGTTAATGCCAAGGGGCTA
AGTCAGCCTTTGTTTCTGAGATGAAAATTCTAAGCTGCTGGCCTTGTTGACTTTCTCCTT
TAGATTATTTTGGAGTTCATCACAGACACTGGTGTAGCAGAGTGAAGAGTGATGTTGCCA
CATGACACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved