Equus_caballus Locus Mono:3:SNORA15
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:3:SNORA15
Equus_caballus
Mono:3:SNORA15
3
SNORA15
1001..1144
2144
ATTAATGGACATAGCTCACACAGGAATCTCATTGTCAACTGGGTATCACTCCACTTTCA
CCATTATGACTTTGAGGAAGAGGACTCACAAGCGGTCAACTTACCACACCACCGCCAGCC
GAGTGCACGAGCACGGACATCCCTTCTCGGAGGTTGGCAACTTCAAAGAGCATCATGTAG
GCTGTGACGAAGTTCATGGGGAACGCAGCAGCCTCGGAGAAGCTCATGTCATCTGGGATC
TTGTAGACAAATTCCACTGGCGTGCAGACCACCTCTGCCCAGGCATTGTAATTGACAAAT
GCCATGACACGGTCTCCAATCTGGGCACAGGGAAGCACTGGGTTAGTGGAGGTTTCTTAA
TCTTTTTTGAGGGATTTCTCAAATACTCCTAAGAATCTGAAAACTATAGATTCCATCCCA
GAAAAAAAAGCCCCGAATCCTCAACTATGCACACCCTCACCTGCCTCCCAATTTCAAGGC
ATTTGTGGATACAAGGAAGCCCATCTATGAAAACTTCCCAGGGGCTGTGCAAGCCAGGTT
CTCTACTCCTCTTCTCAAGCATGAAGATAGAATGTGCATCACATCACACATCGCGGCATG
TTAGGTCATTTTATTGACTCAACCTCTCATCCAATCCCTGTTTTGGAGTTGAGGAAACCT
CAGCCACAAGGAAGGTTGAAGGGGCAGGGCCAGGAGTAAAATCTACTCTCATTTGTTCTC
TGCCACCCTATGTGGATTCCCTGCCAGGCTAGTTCACTGTGGTATTGGCATCAAAGGTTA
GCACTGGATTACCGATTGCCATGGATGTGAACTGTAGTGCACCAGAGGAGCCATGTAAAT
CCAAGTGCAGGAGACTGAACAACAGCAATCAGGCTCCGAGAGAAACAGGAGAATGCCACC
GAGTGTGACGAACGGCAACTAACATTTATTGGACACATATTATATGGCCTAAGGGAGTCA
CGTGTTTTAACTCATCTAATCCTTACAAATACCCTCTGAAGGCATGGCTGAATCTGTGCT
CTTTTTATCAGTATTTTACACAGCCAGACACCACGCAGTAAAAAGAGCAGTCTTACCTTT
AAAGTGGTTATGATGGTATGCTAAGTTTTTTTCATAGCATATCAGTAATAAAGGGAAATA
AGTAAACTAGTAGAAATAGCTTGCATGAGCTGCCAAGTGCTAGTTAAATTGAACCATTCT
GCTGTTCGATGTTAGTTGTTCGTACTATGACTATCAAATGCAATATACAAGTTGCTGTGG
TCATAGGGAGTTCTCAATAAATTAATGGCTTTCATATATGTATGTTTTAGTTTACACAGT
CATGCACTGCATAATGATACTCGGTCAACGACAGACTGCATACATTATGGTGGTCCAAAA
GATCAGTACCATATAGCCCAGGTGTGTGGTAGGCTACACCATTTAGGTTTGTTTAAGTAC
GCTCTATGGTGTTCGCACAATGATGAAATCACCTAATGACACATTTCTCAGAATGTATCT
CCGCTGTTTAGCAATGCATGACTGTATATATTTTTATAATTGATTCTCCTGCTTTACTTT
CTTTGTATCTTAGCTTTTCTCTTCTACTTCTATCCAACGACAATAACAAAAGCCTTCCAT
GAGATGGGTTCTGTAAGAGCCTCATATTACAGATGAATGATTATAGATTTCATAGACATT
TAAATTGAGGCAAAAAGAGATTAAAGCACATGCTAGAGAGTAGCTGGGCCAGGATTTGAA
TCTAGGTCGGCTGACTCCAGATACAAATAATTAATTCATTACACCTGAGATAAGTGCTAC
CAAGAAGACATAAAGTTAAATAAGGTGTACAGCAGAGGAACCAACCAAGTCTGGGAATAT
TAAACTCTTTAAGACTCAGTATCCTTAGCTCTAAAATGGGTATAATATTAGGAAAGAGTC
CTTATGAAGATTAAATACCATAATATGCATGCAGTCAGTTGGCACAGTGCCAGTAAAAAT
GAGGAAAGAGCAATCAATATTAACTCTTAAAAAGAACAGATTGGATGGGGCTGGCTCCGT
GGCCAAGTGGTTAAGTTCGCGCGTTTCGCTGCAGCAGCCCAGGGTTCGGATCCTGGGTGC
GGACATGACACGGCTCGTCAGGCCACGTCGAGGTGGCGTCCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved