Equus_caballus Locus Poly:2:SNORD12
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:2:SNORD12
Equus_caballus
Poly:2:SNORD12
22
SNORD12, SNORD12, SNORD12
1001..1091, 2401..2491, 2776..2867
3867
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACATAGGAGGGATAGGTAGT
GAACAGAGTTTCCTTGTGGTGATGGGACAAAAATTCTACTTTTTGTGGGATTTGGTTGAA
GGGCTGGAGGCACCCCCCCTCGGCCCTCCCAGAGTCCCGGGGCTCGGGAACTCCTTGGAG
GTCTGGGTGGGGGTGTGTCTGGGTAGGGTTTGTGTATTCTCATTTATATTGAGTAACCTG
GCGGCGAGGTTACGCGTAGATTCATTCCGGGTGCAGAATGAGATGGATGGTACCTCCGGC
GAGCCGCAGTTATACCGCCACCCTAGGTCATTGCCTGACGTTCACATATCTCCAAAGAGG
GGAAGCCGGCGGCGGCTTGGTGTGTGTGAAGCGCGACATGGCGGCGAGGCCGACGAGCCC
GGCTGGCCCCGTGCGTACGGGAAAGGGGCAGGCTAGAGCTTCCTTGACGACCATTAGGTA
CCTTCGGAGACTACATTTCCCAGATGGCCCCGCGCGGCGCGGGGCTGATGGGGGAAGCGC
CGAGGGCCCAGTGCGCAGACGCGAGAGCCCCCTCTGGTTATATAAGGGAGGGCCGCCACG
CTTATAGTCCTTTTGTGTTTGCGGCACCTTACTTGGTAGTCTTCCGCTGGTGCTTCCTAG
TCCGACGGCGTCCTACCCTGGGAACCCGGGTTGACTGCTGTGTGTGGTGAGTGGAGACGC
CGCTGTTTTCGCTTCGAGATCTCTGTTCCTCCTTTTCCCTCTGCCATCGCCCTTGCCGGT
GGCTGCCTGTGCTCTCAGCGTAAATAGGCCGTAGGGCGGTGGGGGAGGTCAGTTAGAGCT
GGAACAACCCTCGCCATATGTACGGACCCGACGAGTCCTTGGCTGGTGTAAAGGATGACT
TCACTTTTTTCCCCATCAGATCGACAGTGTTGATGTCGTTGAACACTTGCCAGTTAGTTC
TGATGCACCAGCCTTACAAGGCCCGGCTATGTTCTTTCGACCGTGGAAAGATGGCGATCG
ATGCCCTTTCTTTGTTAGTTCGCAGGTTAGCGTGGTCAGAGGGTACGGAATGGATCTTGG
AGGAGGGGGTCGCTGCTGGGCCTCGACGAGAACGCCGTGTAGACATCTACAGCCTTCAGT
CTCCTGATCTCTGGGGTAAGCATTTGTCTCCTGGGCTGTTGTAGGAAACGTGTGCTCTGA
GGAGCCTCTGAGTTCGCTAGGCGAATTTGGGAATAAATTGGCTAATGGTAGCTAATTTCT
GTTAAGCATCTTTCAGGTGCTAGGTGTTCTTTAAGGTTTTCTGGATGCTTCATTTTATTA
TAATTCTCAAAAATGGACCTAAATGTTATTGGTGAAGAAACAGGCTTAAGAGAAAGAATT
CTCCAAGATGGAGTTATCTTTCTAAAGTGAATAGGTGTTATTATTTGTTTTTGCACCTAG
GGGTCTAGGTGTTAAAGACTTAGGAGTCTTTTTAATACTCTGTTAATACCTGGTTTAATA
CCTCTAGAAGCACACCTTGAGATGCTGTTCCTTATTGTGTTCTTGATAAACAGCTTTCTC
GTGCCCTTAAATTTCCAAGTGGATGGATAATGTGGCTTTTTCCCCCCTTTTCTCCCCAGA
GCCCCCTGGTACATAGTTGTGTGTTTTTAGTTGTGGGTCCTAGTTGTGGCACCAGAGACA
CCGCTTTGGCATGGCCTGATGAGCTATGCCATGTCCCCGCCCGGGATTCGAACTGGCAAA
ACCCTGGGCCGCCGCAGCAGAGCGCTCGAACTTAACCACTCGGCCACGTGGCCGGCCCCT
AATGGGGCATTTTCTAAAGGAAAGCCAAATGTGTGTTTCTGTTGACTTAGCCACTCAAAC
TAATTACCAGCTGCCTAGCATTTAATTAAATTCGCTTGAGTCCGGGAATGACGCCTTATG
GCGGGCAGACTTGAGGGACACATTTTTTTGTAAACTTTGTGTCCCAGAGTGTTCCTTTTA
GTCAGGTTTTTAGTGATGACCTCTCACATTAAAATGTAACATCCTGACACTTGGTCACAA
CCCTGCAGTCACGTCTCCCATTAGAAAAAGCTGACCATTTCCCCACAGCTCTTGCCCGTC
ACTCTGGCTTCTATCACGTACCCTCAGAAGGCAGGGATGTTTTTCTTAGATGGTAGTTTC
ATATTTCTAACAATAGGACACAGAAGTGCTCAAGTATTGAAAGATTCTGCTCGTATGAAA
GTGGACCACCAAAATCTTAGTCCTGATTCAGAGCTCTTTTTGTAGAGGCCAAGAGCTTCC
TACTGGCATATATGATGACTGAACTTTTTTCCCCGACAGATCGACCATGTTGATCTAACT
TCTCTAAGCCAGTTTCTGTCTGATATGCCAGCTTGAGCAGCTCCTCTGTCCGCTACTCTC
TTGGGCATCTAGCTGATCAGAGCTCACATTTTGGTGTTTTCATCTCAGGTTTGCTGTTGG
CAGAAAGCACACTTGGAATGGGCCAGGATGAATCTGGGAGTGGGAAAGGATTGGTAAGTG
ACGTCCACATGTCTCCTAAGTGCCCATGCCCACGTGGCTGAGTAGACAGGAGCTGGAGAA
CGGAGGAGGTAGTAACTGCTTTTCTCTGAAAAGATGGGCATACCCACCTTGTGTTCTACT
TTCTAATTCCAATTTGGCCACTGCAGGTGATGACATAACTTTTTTCCCCATCAGATCGAC
CCTGTTGATCTCACTGAACTATTAGCCAGTTTTGTCTGATGCATTGGCCCCAGTGATAAT
TTCTGTCCTCATTTTCTGCTTGCCACTAGCAGACTGCTTTCTCTCTCAGGTTTTTTGGTG
GGATTGGGTTTTACCCCCCAGCGTTCAAGTCATTCATCTTGGCTTCATCTGTTAACTTCC
TGCAGGTCAGGAGCCATGTGTGCCACAGGGCAGGAAGAAGGTTGGCTGCAGCCTGATCTT
CCTCTCGACTTGATTCAGTATGTCCTGTAACAGGTGAGGTAAATGGTGTTACCCAAGTGT
CAGTCCCCTAATAAAATGATTATTAAATGTGCCCAGAATAGGGGCCACCTAGGATGTAGT
GGTTAAAATTCGCATGCTCCATTTTGGCAGCCTTGGGTTCACAGGTTCAGATCATGGGCA
CAGACATAACTGCTCTAGTCATGCTTTGGTGGCGTCCCACATAGAAAACAGAGGAGGATG
GGAACGGATGTTAGCTCAGGGCCAGTCTTCCTCAGGAAAAAAGAGCAGCCCCCAGGATAG
GTGTTCGCCCACTTGTGAATAACCCCCAAGGCGGGTATATAAAACAGGAGGGGAGAATTA
AGTCCTTAGCAGGACTGTTGAGCTATTGGTACTGTTAGATCTTGCAAGGAAGGAAAAATA
AACAGTTAATTTCTGCTTTGGCAGGTGTATTACAAGATAAGGAAATCTAGTCATTTTCCA
ATTGGGATTCAAATGGATTGTAATTTTTGAAAGATTGAGTTCCTAGCTATTGGCTGGAGG
CCACCGTCACTTCCGTGCTGCCTGGGCTGCCTCACTATGGCAGCTTGCTTCATCAAAGTC
AGCAAGTCAAGGAGATAGGCTATTTAAGCCTACGTTTCCTGCCCCCATCTTTTAAAATGG
AAACTAACAGCCCCTTTCTGTATCCTTTGGGTACTAGGCAGTGTGCACCTCCATGGCTGA
TGGTTAGTGACTGGAACTTATTTCCCCAGATAGCCTTGCTGATTAAGGGAACCGTTTAAG
GCAGACCTGTCTGATTGAATCAGGCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved