Equus_caballus Locus Mono:80:SNORD29
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:80:SNORD29
Equus_caballus
Mono:80:SNORD29
30
SNORD29
1001..1067
2067
CAGTAAACAACATGGCTTTATGTATTTTGAGTCATGTTATTAATTTGATAATGTTGGGA
GATAAGGCAAATAATATATTGTATAATTTGTGGGTAGGGAAATAGAGACTTGAGATATTA
ACTGGTTTCTGTATCACTACCTGGTAGGTGATAGAGCCAGGAGGCAACCCAGTCTTCTAA
CTTGAAATCTAAGTTCTCTGCACAGTGTATTCATTCATTCATTTAACTTATTTCTTGAGG
AACTCCTGTGTATGTGAGCATCATACGAGTGAATAACACAGACACAGCCCCTGCCATTAT
GCAGTTTATAGCCTAGCGGTAGAGACAGATAAATAGTTAAGCTTTGGCCTTTATTATAAT
AAGTGATATTTAAATTTAAGAAGTAGCAGCATCTTTGGGAACACAAATGAGGAATAATAA
GCTGGACTGGGAAGTAAAGGAAAGTTTCCTGGAGAAACAAATGCTGGAGCAGGCAGAATA
ATGCCCACCCTCCCAAAGGTCCACATTTCTACTTCCTGGAACCTGTGAATATCTTAGATT
ATGTGACAAAGGGGAAATAAGATTGGTAATCAGCTGACTTAAAGATAGGGAGATTATTCT
GGATTAACCAGGTGGGCTGAATGTAATCAAGAGTCATTAAAAGTGGAAGAGGGAATCAGA
AGAGAGGATCAGAGAGAAGACAACATAAGGAGAACTTGGCTTAATCATGCTAGCTGGAAG
ATGGAGGAACGTGGCCATAAACCAAGGGATGCTCGTGACCTCTGGAAGCTGGAAAAGGCA
AGGAAATGGATTTTTTCTAGAGCCTCCAAAAGGAATACAGCAATACTGACATCTTGATTA
CAGCATGAGACCTATGTTGGACTTCTGGCCCCCAAAACTATAAGATAATAAATTTGTGTT
GTGTCAAGCCACCACGTTGGTGGTAATTTGTTACTGCAGCAATAGAAAACTAATACAAAT
TCCTAAACGGAGACCTTCAATGCATTAATAAGAACCACGAATTTCTATGATGAATCAAAC
TAGCTCACTATGACTTACACAGTGAAAACATGTGAACACCTGCGAAACTGGAGAAGACAG
GTATGGAGGATATCATGTTTAAGGAAATTTTATCACCCACAGCTTTGTCTTTCCTGTTCC
AACTGCCCTGCTTGTTAACCCAAAGGTCCAGCACATTGTCTGGAGCCCAAGAATGACTTG
AGGGAAACTGTCAGCCATATTTCTGATCAACTCCAATCTGAAGGTACACGTAATCGAATA
AAAGTCTTGGAGCGTGTCGAAAAAAGAATTTCAAGTCATTGCTTGTACAGCCTCGCTGTT
CAAAGTAGCATACAATCATCTCAGCCCTTTTAAATAAAGTTTTATTAACCTTGAAAAAAA
AGAATTATGAAAAATGGAGAAAAATTGTTACCAGTAGAAAGGAATGCATGTGCAAGACCC
AGAGCTGAGAATATGTTAATTATGGTTGTTGTTGTTGTTATTAATATTGGAAGTGAAAGA
GGAAAGCAAAATGTATTTGTTAAAATGGAATGTAAAAATGCAAGGAGTAAAAGAAAAAGA
TAAGGGAAAGGTCCTGCAGGGACTAGTTACTCATGGCCAGCTTGATGGACTTTGTCTTAA
TCACAGTGAACAGACATTTAGAAGTTAGAAGCAGGGAAGCAACCAAAGGGTTGTATTTAA
GAAGGTAACACTAGCATTAAGATAAAGATTTAGGAGTTGAGAGTAAACAGAAAGGGTAAG
CAAGACTGAAGGAAGTATTGACTTAGTGAATTGACTATGAAGAATGATGCTAAAGACTTG
GATTAAATGAGAAACAGGGTCCCTCTTCACAGCTCAATAGCTATTCTAGTGCTAAAAACA
GTCACATGCCATTATACTAAAATTTGAAGAAAGTTTAAGAAAGGAAGCAGCATCACGTAA
AAACCAGAGGGAGAATTAAATTTAAGGTAAGATGCCAGAAAGACCTTAAGAAAAGTCTTG
AGAAAAAGTGATGTTAGAGCTGAGAGTAAGGTGAGTCAAGATTCTTCAGGAGAAGTGTAA
ATGGGAAAGAAGAAAATAGTCTAGTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved