Equus_caballus Locus Poly:8:SNORA40
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:8:SNORA40
Equus_caballus
Poly:8:SNORA40
7
SNORA40, SNORA18, SNORA8, SNORA1, snoZ40, SNORA32, SNORA25
1001..1128, 2181..2311, 3219..3356, 3609..3743, 4348..4421, 4893..5016, 5409..5535
6535
GAAGAATTTTATCCAAAAGTTACTCTTAGACTGTATTTAACTTTTGAAAGACTCCATGC
ATTTGGTACAGGAAATGAAAAAATAAAAATGAACTTTTGGATAGTTGAGAACACGGACTT
TTCAATACTATTGTTAAGTAAGGTAAGATGTGGTATTGCTACTGGTATATCCAATGAGAA
AATAAGCAGAACTTAATTTGGATTTGTAACATCTCGATGTAGTCTCCATGTTATTTGAAA
TAACCTAGAGCTCAGTTATGTATAATTACTAAAGCAATAAAGTTTTACTTATTGCTTAAT
ATTTATATTTCTTATGCAGGAGGACAGTTGTTTCATAATAAGTTCTGAATTACCAAAGAA
GATGAGTGTATATTTAGAACAAGAGGAATATACTGGAGAAGATGCTTTGTCTAAAAAGAG
GGCATCAAAGTCCAAAAACATTGGACAGAATGGCCTGAAAAGAAAATAGGTATATAAATG
TCATGGTAAGCAGAATTGAGAAAAAGGAACATTTGGAGAAAGTAAAGATGATGAATGTAT
ATATACGTATACACATGCGCGTGCGCCATCCTTGTGATGAAAAAGAACCTTTCAAGGAGA
AAATAAAAAGAACTTGAACAAATTTGAAAGAAACTCCTAAAGAATAAGAAGTAATGAGAA
GATACTACTTTTTTTGCCTATACTTGTTTATTTCAGGGTAAGAGAGCTTACAGGCATCAA
TTGAGCACTGGATCAAAGTAGTACAGAGATTGTAATCCTAAAAGTGAAATGTTAGTTATA
ATAAACACTGATTCATAACCAACCACCCTCTTTAGGGTACGTGAAACCCCCCATTTTTAT
CCCAGTTTTATTCAGACAAGTGACCTTTAGTATCAAATGTTTAATACTGTAGTAAGAACT
TACTAATTTTCCCTTCCTAACTACCTAGGATATTTCGACTACCATTTTCTTCACTATTGT
ATTTTGTCAATTATGCTACTATATATACTGCATTTTATGATAGCACTTGTGTTTGTTTTT
GTTTAATTTGTGGACAAAGACTTAGAGACAGGTGCAGAAAATAAAACCTCTTTTGCAACC
CAGAGCTCATTGTTCAGTATGAGTTTTGATACAGATAAGAAGGAACATTGTATCTAAAGC
AGAATAAAGTGATGAGGGTGGGGTATTGATAAACAAAGGTTGCTTCCAGGCTATAGAATT
GATAATTAAAATAGCATATAAGGGGAATCTTGGCCCTATTGGTTTTTGATGTTGACATGA
AAGATGGCTTCCTTTTTTTTATTAGGCTTTTATTTTGAGAACACAATGTCTGGACTTAAG
GTATGTCTTATGCTTTAGGTGAGTTTTTGTATCTGATTTGTTGAAGTGTAGTATGTTGTC
ACGTAATTTAAATGTCCACAGGTCTCATTATTGAAAGACATTTTTGCCAACTTTTAATTT
CTGTTTATGATGTCATTTCAGAAAATGAATCTTAGGATTCACACATTTTATAGTGATATT
GTGCCATCTTCCCTTTTGGAGTAAAGGGTCCCCAAACAATCTTAGGCTATAGCAATAATC
AGAATCTTGGATATTGCTGCCACTTGAAGCATATACAACATTATTTTTAATTAATGCATA
ATCTAACGAGGTAGAAGATACAATAGTGTAATGCTAGGATACAAGATTTCATAAACCTCA
ATGATAAAGTTTCATTAAAAAGCACCCAATATGTTTGTCTTCTACTTATTTCCAAATATA
GCCACATTAATATTTTTCTTGGTTTTTATAACTGATACCAAATGAGAAAATATTTTATAT
AGTTATTAAATTGAAGCAAAAGTTCAGCTGAAGTAAAAATTTCGCTGTAATCTGGGAATT
TCAAAGGTAAAACATTGCAGTGTTGAAGTTCATAAAAATCGAGACTTCAGTTTATACAGG
TAAATTTTTTCCTTTGGATCATCTGTAGTAGGTAGTTGGCATATTTTCATCAGTATATAC
TCAGCTGTTCCTAAGCAGCATTGTTAAAGTCATTACCAAGTGATTAATTTATGGGATGAT
TTCTTTAAATCTCTTTTAAATGGATGTTTGTTTTTATGCAATTTTGAATTCATCCAAAAG
GCTAGAGCAAATTACAGTTCTGGTAATAATTGAAAATTTAGACTTTTGTTTATTTATATT
TTTTAAAAGGTGTAAATAGTGGTTGAGGTCTATCCCGATGGGGCTTTTTCTGTAGACCCA
CATCGTTGGAAACGCCTCATAGAGTAATTATGTGGTTTCCTTTACTCACAGAACTGTGTG
TTAGATCTGTGGGAAAGAACTACAAGACAGCTGCTAAAAGTATGAAAGACGTAATAGTCA
ATTTTTTTTATCCTAGGTATTGGCCTATCCCAAGGTCTATACTGTTCTAGGGTGAGACAG
CTTAGGTAAGTTTAAATTGGTGACAGTTAATCTTGGTACCATTACAGTTCATATGATGAA
TTTTAACTGTTCAACTGCTGAATGATACAGACATGAACTAAAACTTAATTCTGACAGAGC
TGTATTCAGCTCTGTATAGGTGTTAGCTTTTAATCACACATTTAAGTTGTCCTTAATCTT
TTATTTGTCATTTTATCTGTAGGAGTGAATATGATTTGAACTTACTCATGTGTAGAGGTA
AGTAGAATAATTGATTTCTATTGAAATTTATTAAGGATTCAAAAGTGCTGAAAAAATGTA
AATTATGACTACAGCACTCCATTACTGTTGTGACTAGTAGTTATTTAGGTACAAAACAAT
TATTAAGATGTTGGCCAAAATATTTGCCATATTTGTATTTATATATAGAATTGGGGAAAA
AGGAGAGTGCCTGTCTAGGGCTTCCAGATGAAATGCCTACTTTTTTGCACCCTTTTACTA
ATCTGACAAATCCATATGGTTCATCCTAATAACCTGTATACTTGGATATGTTAGAATAGG
GATTGTGAATTTTTTATAAGAAATTCTGCCCATAAGAGCAATCATGATCCTTATGTCTGG
TGTGGTGTTTGTTTTAGTGATTTGACTTAATTACATCTGTAAGTGTATATAAACAGAGGG
CAAAGATCAGGACAACTAGGTTTATAGTTTAAAATGCAGTTAATGTAGTTGCCTTATTGA
AATGATAATTAGGAATAAAGGTGAAATTATTTTACCTGTAATAGGAACTTCAAGTTTTAG
AAATTAGTAAACATAAGTTTATAGCAGTTCAGTCCTGATTGCACTGCATGGTATCTGCAT
TCAGCAGTGTATTCCTGCTGGGTGTTCAAAGGACAGTGCGACATAAATTCAGTATCTGGC
ATCGTTGGTTTTCTTTGCTTCGTGCATGTTAAACCTGGTATTTTTATTGATACAGTATTT
CTGTAGTTTCTCATACTGTTAGTTGGACCTAATCTTGAGTAGGAACTAATGCTTCTCTTT
TTTCTAGGGTGTGTGACATGGAGAACCAGTCATCCATGGACTCTGATCCTAAACATGTAA
GGCTTTGTATTTCTGTTGTTTCTATTAGCCTCCTGTTTATTGAGAGCATGGTCAGCAAAA
GAGAACTTCTAGGAAGATGCAAAAACCTTTTGTATAGTGTATATGTAAACTTGAGAGAAA
CTTTTATGAGGCCTCATTTTAGATGAAAATGGGCACTCTTATTCATGGTGTCCAGAAATT
GTTAATGTGGCTATATTGAGACACAGGTTATGCTTCCATCACAGTACGTGTATTACAGTG
GTGACAATGAGACCTGTAACATTATTTGCTAGGCTAATGAGTAAAAATTGGATGTAACAA
GACTTATCAATATTAGAAATGATTAAGGAATCATCTCTTAGGGGCTGGCCCTGTGGCTGT
GTGGTTAAGTTTGTGCACTCTGCCTTGACAGCCCAGGGTCTCGCTGGTTCGGATCCTGGG
AACGGACATGGCACCACTCATCAGGTCATGCTGAGGCCACGTCCCACATAACAAAACTAG
AAGGACCCACAACTAAAATACACAACTATGTACAAGGGGGCTTTGGGGAGAAAAAGCAGG
AAAAAAAAATTGGCCACAGTTGTTAGCTCAGGTGCCAATCTTACAAAAAAAAAAAAAAAT
ATATATATATATATTAGATCATTTGGTAAAATAGGAATGAACTTCCTACAATTTAACTCC
TAGGGCCCTAAAGTAAATTGGTTGAAGAAATTGGATCCTAAAGATTAGAGGTAAGATTTT
AATTTATTCCTTATTTTATAGGAGACTTTAACTTCTTTACTTCTTATAGCTGATAATCCT
GGTTACTATCACCACTTAGGAGAAAATGAAAAAAAATATAGATGTTAAAAAGGACACTGT
GTTGTGTATATTGCTTACCAATGATGTATGTTGTTATGATGATGGGCAAAATGTTCAACT
GCTCTGAATGGGCTGAATGAAAATAGCCTTTCTGAACATGCATCTACATTAAATATGTGC
TATATTTTAAAACATTAAAGCTCTAAGGTGAAAGTTAGCTGGACACATGCATGTTTCCAC
ATAGCTACCATTGGAGTTGCTAATCAGCACATTTTTCAAATACGTTCAGGTGTGAATGGA
AATGGGTTAAAATCTGTCTTGATTTGAACATATATTTGTTCCCAACATTTCGTTTAAATG
AACTGGATTTAGAAGATGTTTATGGCAACTGTTTGCAATTTTAAACCTGGAGTTTTTAAT
ACATACTTGTTGGAAACTGGGTTTCAGGATACTTTGGAACCTAATCAACCTCATTTTGAA
AAATGTATTCCAATGTAAACTTTACAAACTTTTTCCGCAGGTGGAGAATTTTTAAAGTAT
GTCCATATTCAAGTGGAGATCAAAGAATCCCAACTGAAAGAATTGTGGCAAGTTAGTTTT
TTATCTTCACAGCATGTTATTTGTCAGGGATAATGGTCATTACCAAGGCTTTTAGAATGC
AGTTTCTCATTTGCTGTGGACATGACCAGAAAAAAAATTTCCCACTGGGCTTTTTCTCCT
GCTACCTTGCTAGCATTGCAGCCTATTGGGAACATTTTGTTAACCTTGTTTTATTTCCAT
TGCTTAGATCAGCACTGTCCAATATAAATACAACACCATCTAATAGCCAAAGGTAATGAA
TGAGACTGGATGACAGTCATTTTTCAAATTCTCACCATTCATGCCTAGTGGCGGTTGTTC
AGTGCATGCCTGGATCTCTCGAGTGTTGGCAACTATCTTTTGCCTGGTTAATCTTTCTGA
GTTCCTAGAAACCAGGCAGCTTCTAATGTAATAGAACTAACAGGGAGGGCTGGTTTCAGA
ATTTACTTGAGTATCTCTGGAAATGGAACCTTACTGTTTATATTCTCTTATAGAATTGAC
TGACATGACAACCATGGATTGAGCAAAATTTTTTAAAAGGTATGTACATATTAGAAAAAG
ATAATTTGTAGGTCATCTCAAAGAGGGCTTGTGGGACCAAAACCAGGAGCTCTTAACGCT
GTGACCAAAGATTGAAGTTCTCCATAGGATATAATAGTCACTCAGTAGTGCTATGTTTTC
CTGAGGAGATACATCCGTGATGGGTCCCTGAAGTTTAACCACTGCCTACTCTCTTCTACA
GGGCTGTCTTGAAGATATGACTCAAACTTTGGAGGAATGGAAGGAATCACAACATGAAAT
TACTTAAATAAAAATTTATTGACTGGAATAATTTTGCCTATTACATTTAATTAAAAAAAA
AACCCTTTATGCTTTTTGTAGAAAGTCAGCATGTTGAACTTTTGGCTCGAAGTTTCTCTA
GTGTTTTCTGTGGAAGGAAGAGAAATAAAATTGAGCAGTTATAGTTGTAGTGTACCTTAG
ACATGAAAAATTGTAGTGGGCCCTGCTCACCTTATGAAATTCTTTTGCCCTTGCTCTGTT
CTGGGCATAAGCATCTTGCTTTGCTTTTTCTTCCTTTCGCTGTTTCACTTCAGCTAACTG
ATTGTATAATCTGTAAGAAATTTATATGGAATAAAACACTTCCTAAATTTGCATTACTAT
TCATATATACATACATATATGTGTGTACCTTAAAGCCCTTTGGTGCATGAGGGCTTGTGC
AGTCTTTCTATCTTCAGGAAGAGACACTCTGACTTTATTCACCCCCTTTAGGCAATTCAC
AGATGAGCCTGAGCAGAGAACAAGTGATTTGATTAAATACATAATGCCAGATTCTCTTTG
TGAAAACACAAATGTGAGGAACATACCTGTAGATTTCTCCTTAACTGTTTTGCTTTGAGA
ATTCTCAGAGACATGGATTTTATTTTTTATTTCTTTCTGTCGCTGTGAGGATCGCTCTAT
AAATGATTTTTTTCGTTTTACAAATGCTTCTTGCAAGCTGCCTGGTATAAGTGGAAACTT
TGGGAGGGTTTCTGTTAAAAAAAGCACAAAAGCTCTTTTTTCATGTCATTGAACTTTTTA
ATGTTTAATGTGAAGATTATGGGGTTCCTCCTTCCCTCCTAGAAATGTGGAGGTTGAGAA
CTTGAGTAGGGAAGTCCCACTGTGCCTGGGTTCAGACCTTTTCAGATGGTTAAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved