Equus_caballus Locus Mono:97:SNORA52
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:97:SNORA52
Equus_caballus
Mono:97:SNORA52
Un2742
SNORA52
1001..1135
1151
GTCTAACAACAAACTCTTACTGTTCATAAACCTCTACTGCCGAGTTACACTTAGATAGC
TTTTAAATCACCATATCCGTGAAAGTGAAATGTCAAGGTAGGAACGCGGTTGGGGTCGGG
TCGGGGCCGCGTCTGCCACGTCGCGCAGGCGGGGTGCCGGGTGGGCTCAGCGAGGGCCCC
GGGCCGGGCCACGCGCGGCCGCGGTCGGGGCTCCTAGTCATGCCGCCGCCCTCTTCTCCC
CTCCCGCCGCAGGATGCGCTACGTCGCCTCCTACCTGCTGGCCGCCCTCGGGGGCAATAC
CTCCCCCAGCGCCAAGGACATCAAGAAGATTCTGGACAGCGTGGGCATTGAGGCGGACGA
CGATCGGCTCAACAAGGTAGCAGCCCGCTACCGGCCCGATACTGCGCACAGAGGGTCCTC
TCCTGCTCGGCTGGGTTTACCTTTGGGAAAGGGCACTTCGACGTGCCTGCCCATGCTGTC
GTTTATTGGGTTGCCTTTGGGGGCCCTGATACAGCCCAGAGGAGGCTAACGTGGGTGTGA
GGCCAAGTCCCGACCCGCGTGGTTGAGTAGAAGTATAAGTCACGTGTAATTGAAAGTTAT
GTAATAATTGACTTTTTGAAAAAGAGAAGAGGGAAGAGTACACTCTACTGCGTTATTTTT
CAGCCTGTTTATTCTAGGTGTTATTTCCACGTGTAGTAGTGAGTCTTAGAAATCTGTCGC
TGGTTCCCACTTGGAGCTCGTCTCCATTCAGAGATCTCAGTTATGGGTAATAACTGCAGT
GGGGGGTGCAGGCTGAGAAGCTTCAGGGTGTCTCCTCGCTGTGCGGGAGGCCAGCCCTGC
CCCTGGAGAAGGTGGTTAAGACCAGGGGTGTGGTGGTGGTCCGTGGTAACTGTTGGGTGT
GCTTGTCTGCTTCAGGTCATCAGTGAGCTGAACGGGAAGAACATTGAAGACGTTATTGCC
CAGGGTGAGAGTGTGTGGGGGGCGGGGAGGCTTTGTTTTCACAGTCCATCCTAATTCCTG
CCGGTCAGCCTGTGGCCTGCCAGGTTTCGCTTGTGGACCAGAGCACCCTAGGAGCCTCAC
CCAGAGGAGCTGGCAGGGCTTCAGTAGGCTCATGCCACGGGCGCTTCTAGACATTCCCAG
GGGCAAGGCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved