Equus_caballus Locus Poly:16:SNORA63
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:16:SNORA63
Equus_caballus
Poly:16:SNORA63
19
SNORA63, SNORA63
1001..1136, 1929..2059
3059
TTGACATTCAAAATGAAATGCAAAAAATGCAGACGGACACAGCACGTACAGTTATTGGT
ACTCCAGGGAAAATATTTGATATGTTAAATAAGTATATCTTTGTAAGTATTACCAGATTT
TTCCTAGGGCATTTTTTAAACCAGTGATATTTGGGGTACGGGAGGGAAAATAATTAGCCT
AATTGTTTAAGCCAATTGCCATGCATGAATATCTAGAGTAATACTGACTTTTCCTTAAGA
GACTTTATTTTTTACAATAGTTTTAGATTTACGGAAAAATTGACAAGATGGTTAAGAGAG
TTCCCAGGTACCTTGTACCCAGTTTCCCGTATTAACATCTTACATTAGTATGGTATATTT
GTTAAAATTAACAAACCAACATCAATATGTTATTATGAACTAAAGTTCAGAATCTGTTCT
CCTTTCCTTAGTTTTTACTTAATGTCCTTTTTCTGTTCCAAGATCCCACTCAGGATGCTC
CATCACATTTAATTGTCGTGTCTCCTTAAGTTCCTCTTGGCTATGACACTTTCTCACATT
TTCCTTATTTTTGATGACCTTGACAGTTTTGAAGAGTATTGGTTAGAAATTTAGTAGAAT
GCCTTTGTATTGGAGCTTTTCTTAAGAACTTTTTTAAGATTAGACTAGGGTTATGGGTTT
TTTAGGAGGAAGACCACAGAGATAAAGTGCCATTTTCATCTCATTATAGCAAGGGTCATG
ACTGTTAATGTTGACCTTGATCACCTGGCTAGAGATGGCGTTTGTCAGGTTTCCCCATGT
AAAGTTCCTCTTCCCCCGTCCCCTTCCATCTGTAGTCTTTGGAAGGAAGTCTCTATGCAC
GACACACACTTAAGTAAGACATTTTTTGCTTTCCAAAACGGATCAAGATGCTTGCTTTTG
AAGCAGATAAAAATGTTGAACCAAGGGATTAAAGATGAAATCTATGAGATTTACCAGAAA
TTAAATACAAGGACTGAGGTGTGCACATGATTTCCTATAGCTGGCAGGTTAAGGTTGATT
GTTACAGTATAGCTGTGCAGTGCTATATTGTCCTTGCCCCTGCTGAAAGCAATTGTTTCC
TACAATCTCTGTCTAGCTGAATTCTATAGCAAGACAGGGACGCTTGGTCTCAAACATTAC
TTCTCTAAGTGTTATTATAAAAACTGTTAGATCTGCTTGATTGATGTGTCAACATAATTA
GTCATTGTCTCTTTTTTAAGGTTGTGTTGCTTTCTGCCTCAACGTCAACAGATATGTTGG
AAGTGGTCAAAAAGTTCATGAGAGATCCATTTCAAATTGAGGTGGAGAAGGAAGAATTGA
CCCTTGAAAGTGTCAATATTTTATAAGAATTTTGAAAGAGGGTAATGTTTTTCTAATTGA
TATACATAAAAATTGTAGCCAGGATTTTTTTTTTAACCTTCTTATTTAGGCTCTGAGCTG
AAATTGCAGAAACTCTATCATATCTTAGTCTTTGTAATAAAGCTAGCAGAGTAAACACAG
GAAGAGAGGCAACTCTCCCAGGTAGTAGAAAAACTGAGATGAACCTCTTTCTGAAGTGCG
GGCTACTTCATTCTAAGATTTGGTACAATAATATCTGTATTTAGGCAGAATTAATAGAAT
GAACTTCTAACTGGTGTCTTCCAGTGGTAGAGATGACAGAAATCAAATGGCTTTTTATTC
CGACTCTGATATGAATTAACGTTTTCCTCTCTGAGATACTTTAGGAAGGAAATTGTATGT
TCTTTGTGATATGTGGGACACCAGCCAGTGTGCAAGCTGTTCTTTTTCAGAAGACAAGGC
AACAGGCACACTGGCTTCTGAGAAAATGGCTGCTGGGAATTCCAGTTTCTGATGTGGTTA
AGGGCTGCTCTTCCCTAGTATTGCTTAATTAAGACCCTGTTAATATCTAATTATTTTCTT
AATAAACCGACGCAGGATCTACTTACAATGCAGCTGTGAAGTGCCGCATTGTCCTTGGCG
CCTGCTCAAAATAAAACTGTTACCCTTCAGCCCTGTTGGCCACGGTGCTGTAGCAGCCAG
GGATGCATGGTCTCATACATGTTTACCTACTTAAACACTGGCTTCACCAATGACTCCTGA
AAATTAAGGCGTGTTAATATTTTGCAGGTGGTGACAGAAAGAAAGAGACGTTATCAAGAG
GGAGTTCAGGTAGGGGACAAACCACATTTTGATTACTACTGACTTACTGGCATTTCAATT
CCTTCTTTAATTACAATATTTATCTACTGAAAATTGGTTTTGAGGGGAAGATTTTTAGTC
ATCTTTGTCAACTCAAGTTCTGTGGGGGAGTGAAGACCACACTCCATAGTGAGCTTTACT
CTTTATGTGCAGTTCATTACTATTTTGTGGCCTAGAAAAATGGGCGGCAGTGCTTTTTGA
ATCAGAATTTGAATAGGCACTATCATATCTCAGTCTCGTGTTTGTCATGTACAACTAGTA
TCTATATTATAAACTGTGATCTGCCCACTACCTGTGAAAACTATATTCTCAATTGAATAT
TTGTCATCTTCATTGAATTACTTGCTTTTATTCCAGTGAAATAAATTCATGTATTGCTTT
TCAAGTATGATTTTGTCAGCCAACCTTGAAAATCAGGTAAATGAATCAGAAAATGTAGAA
ACGTGATAAGATGTATTTAAATTGTACGTGGGAAGATTCAGGGTTGATCAGAACACAGTG
GGAAAGCAAATGAGAAATGTAGCCCAGATTTTGGACTTTATACAGTTGTTAGTCAAAGAA
AAAATCAATAATGCTGTTAGATCTGGTTTAGCTTACACACGAGGCTTTTTTTAAGTTATG
TTGCTCATATCTTGTGCTTTCTTGGTGATTCCTCTCTAATTGTGATTTTCTCAGCATTTT
CTGGTAGCAATTTATGCTGACTCTGGCTTAGGTATAGTGGTTTTAGCACTAAATAATTGC
ATTATGTCTTCCTACTAAAGTAAAAATAACTTTGTTAAAAAAAATATACTAGTTGATAAG
AATAGATGACAAAGTGGTGCTCAGAAATGGCATTGGCCTGTTAGGACATAGATTTGTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved