Equus_caballus Locus Mono:57:SNORA16
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:57:SNORA16
Equus_caballus
Mono:57:SNORA16
17
SNORA16
1001..1131
2131
GAACCCAATAAGAAATTATTTTCACTACAGGTTATCTAAAGATATCTAGGCTGTATGGA
TTGAGGAAATAGTCTGATAAAGAAAAATTAGTTTAATTTCTAATTGTTCCTTCATAAAGA
TCTCTGTTGCATCATGCATGTGGCCTGGGGAGAGGGCCTGGGAATGGGGAGGGGAAATGG
AGAAAGAAGAGAATGCCCACATTACTGAGTGCAGACTGTATGCCTTTGCTGGCTTATTGG
AGCTTTACAGTAACCCTAAGATAGGGTTGTGTTTATTTTATAAATGAGGACGTTAGGATC
AGAGAATCAAGCGTTCGATTCTGAGACTCTGGGTTTCATGATACACAAAGTGGTCTCACC
AAGGATGTTCACGGACAAACACTCACACCCACTTTTCACAGTTGTTGGGGAATCCTGTTG
AAGTATGATTGTATAGCTGGGGTATTTCAACGTTCTTTTTCACTTTTAAGGATATGCCAC
AGAAAGGGTCTTTCTCTGCTGTCTCGAGTAGCGTCTTTCCAACGTTCTTTGCCCTGTGAT
TGGACTTTCTTTTCTTCCTTGCATTAGCACCACCTGACATATACTTATTCACTTCTTATC
TGTTTCTTCCACTAGCATCTAAGCTTCATGAGATGTGATGTGAGCTCTGTGAGATTAGGA
ACTTTGTTCTGGTCAGCTCCTCAGAAGCGCTGGCACATAGTAGGCCTAAATCACTAAGTG
TTTGATGGATTTGTTAATGCCAGAAGCTTCCTAAGAGTTGGCAGCTCAGATGTCAGCATG
GGTCTTGAGTAAAGAACAAAACCAAAAGGGAGATTATTCACATAAAGAGAAATATAAGAG
AATGAATGGGCTGTGGAGAATAGACAAGAGGAAAAAAAAAAAAAAGGAATAGAACCACTC
GCCCCAGAGTTCTCTTCAATTTAGTGCACAAGAAAACCATCCCTATGTTTTACACGTGAA
AGTGTTTGATGTGCCGTCTCCTTCACCCAATAGTTATACTAAAAAGGGATTAAAGGTGCA
GCTGCTTTCCCATTTAAGCAGCTGTCAAAAAGAGCCCAACGTGACAGTTTTCCTGTACGC
CCACTGTTCTGTTGTCTGTAATTGATTTATGACATTTTGGGAAAACACAGCGAAAAACAA
ATGAACACTGAGGTAAGTGTGCTTCTGACTTGCCGCTCTTCTGAGCATGGCTGAATTGGC
CAACAGAACACAAATGGGGAAACCTGTACCATGGCAGGATTGTCTGGAAGCGTGCTGTTC
ACATGCGAGATACTAAAAGGCATTTCCGCTGCATAGAGTGAAATGTGAGGGCTCCCTAGG
AGTCTGGTTTTGGATCTCATAAACATGCCCCACTTTGGAGGCGTGAGGGGTGAGGGCAAG
AGTGAGCAGCAGAACAGACTGGGAGCTCTTCAGTGGAGTCCTCTGAGACACTGTGGCTCG
GTGGTACCCATGGGCAGGCGGTGGTTGAGGTCCATCTCTCCAAGAGCGGCGCTCCACCTT
GGTGTGGCAGTTAGAGCACCAGGAAGGTCAGGCCACACCAGGCCTCAGGGAGACTGTCCC
AGGACGTTTACAGCCACGGCTCCCTCCCCATTCTCTTCAGGCTGTTGGGGTTCCTACCTC
CCAGTTTGAAGTTCTCTAGGGGAATTGCAATAACATTCAGAAGTGGGAACCCAGAAGAAT
CCTCTCTCCCAGTCCCCACTAGGGGGTAAATCTGAGGTTTGGGTCAAATTCTCAATGTAC
AAAGATGAGTAAATAGAAATTCTCCTCACACAGTTTGGAGCCCAAAAAAAGTTTGCATAA
TTAAGGCAACAGAGCCTAACATTCAAGAACCATTCATACATTCACCAGATATTTATTGAG
TGTCTCTCATGTGTCTGACATTCTTCTAGATGCTTGGAATAGAGCAGTGAGCAAAAGGGA
CAGAAATCCCCACCTTCATGGAGCATCTATTCTATCAGAGAACAATTTTCTGAAGGAAAG
AAGGAAATTTTAAACAGCATCTGCTCTGCTCTGTTCTCTCAAAAACAAACGAAAAAAGAT
TCTGTAGCTTTTCCCCTTGAGGTCTATGCCCTCAGGAAACATTCCACATGTACACAAGGA
GAGGGGCACGGTGACGTCCAGTGAAACTCGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved