Equus_caballus Locus Mono:62:SNORA7
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:62:SNORA7
Equus_caballus
Mono:62:SNORA7
20
SNORA7
1001..1140
2140
TAATCACCTGAACTTGGAGAAGTCTTCCATCCTGTCTGGAATTCTGTTGTCTCTTTTGC
GTTGATTGTTGCCATCACTGTTATCGTCATCATTTTTATCATCCCATCTTCATCACCAGT
CGCCATCAAATATTTTATTGTTCTTTTTCTGTGAAACCAGTACTAAGACAGACACTGCGC
ACAGTGAGTTAGGAAATCTTCCTGACCACCTTCAAATGGTATTATTGTTCACAAGGTAGA
GAAAAGGAAAATAATACCCATAAAAAAGGGATAATTTGCTAATTCAGGGAAGAGCTTGGA
TTCAAACTGTTCTTTTTAATTCAGTACCAAATTACTTTCCACTACATCATGCTGCAAGTA
CATGAGGATATTGATCTCTAATACTACTCCGAGTACTAAAGGTATATAACATGTCGAAAA
TTAAATTTAGTGCGTTTGTTTCTTTTGAGATTTTTGTCTCTGTCAATGCCATCAGCATTC
TCCTCATCTCCTTTAACTTTTCCCCATTCCATGCCATAATGTACTTTGTAACAATATTGC
CCACACATCTTATCTGACTTAATTGCCCATAGATAAGTCTAGTTTTCAGTCTTTCATTAC
TTCTCTAATTGTTGTGAAATCTTGGGCAAACTGTCTCATCTTATTGAGCTTTAGTATCCT
CCTCATTAACATGCTATCTGCCCTGCACTCATGGGGGCTAGGATCCCCTGCTCCCACTGG
AGGGACTGGATTGATTGGATGAGACTGAAGGATATGAGGATCTCTCTGCCTTAAATCTCC
CCTCCCCACAGCTTCTCAAGAATGTTAGTTTTCTCCTCATCCAGTCAACACTCCATCTCA
ACCCCTTTTTGATGTTTTATCACGAAAAAAATTAAAATTCAAAGGCCATATAAGTCAATT
ATTGACTAGATGCCTCATCAGAGATACAACTGTGATTGTTTTTTGGTTGTACTAATGAAG
TTGTGAGTAACAAATGAAATAGTATATGTAAAAATAATTCGGACCTCCTGGGATTGCATC
TGGAGTGTGGTTAGTGTTCCGCCAGCTTCGGAGATGGAAGGGAAAGCAGGCCTGGCAGAG
GTACCCCTTCCATTCCCAGCGTTCTCAGTAACTGGTGATTGGAAGACACTCTGCAAGGTT
CAAGCTCTGGGCAAGAACACCTCCCTCCAGGACTCTTCTTTGACACCATCTCTGCCTCTT
TCTTGAAGGAGTCATGGTTGCCCTCACACCACTTGTGAAGCCCAAGATCATCAAAAAGAG
GACTAAGAATTTCATTCAGCACCATCAGACCGATACAAAATTAAGCGTAACTGGCAAAAA
CCCAGAGGCATTGACAATAGGGTACACAGAAGATTCAAGGGCCAGATCTTGACGCCCAAC
ACTGGTTATGGGAGCAACAATAAAACAAAGCACATGCTGCCCAGTGGCTTCCAGAAGTTC
CTGGTCTACAACGTTAAGGAACGTAAAGAGCTGCTTATGTCCAACAAATCTTACCATGCT
GAGATTGCTCACAATGTCTCCTCCAAGAACCACAAAGCCATTGCAGAAAGAGCAGCCCTG
TTGGCTATCAGCGTCACCAGTCCCAGTGGCAGTCTGCGCAGCGAAGAAAATGAATAGACA
GCCGATGTGCACATTGCATTTGTGTTAATAAAAACATAAAACGATGAAAAAAATTCATAA
ATAAAAAGGACTAGTGAAGGAGAGAGTGTTACACATAATATAAACTATCATATAATAGTA
TATATTATAACGTATATAATATGTTATATATCATAGTATATATTATATAACATATATATG
ATATAAAATATTGATTATATTAATATTTACTATTATATATACTATTATAACATATAATAG
TAACATAGTAATTATATTTTATATAATTATATATAAATAGTAGTAATTATATTACAACAT
AATAGTAAATATTAATATAGTCAATATTTTATAATGCATTAATACATTAATATTTATCTA
ATGTACATTATATATCTATGTTATATATTGTATTATTATAATATATATTGTAATCTATCA
CATATAGTTTACTACACACAGCTTATATGGTATTTTTTGGCTGTATTAAATAGCAAAATA
GCAATTTTTTTATTGCATTAGAAAAAGAAACACTAAAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved