Equus_caballus Locus Mono:2:SNORA67
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:2:SNORA67
Equus_caballus
Mono:2:SNORA67
6
SNORA67
1001..1139
2139
TCAGGCTTGATCCAAGGAGAAAATTTATACCACCTAAATAATAAATCAAGGTTAATTTT
ATGGCATGTGAATTATATCTTGATTTAAAAAGTTTTTTAAAGAATTAGTGAAATATATAT
CCTTCAGAAGAATTTTACTCAAAATATTATTTTATTATGTTTATTTTTATTATTTTTTTG
CTAAGGAAGATTCACCCTGAGCTAATGTCTGTGCCAATTTTCCTCTATTTTTTAGTACGT
GGGCCACCACAGCAAGGCTATTAACAGAGTGGTGCAGGTCCGTGCCCAGGAACTGAACCC
GGCACTTGAAGCAGAGCATTCTGAACTTAACCACTAACCCACCGGGGCTGAACCCAAATA
CTATTAATATTATTATTATTTTTGAAACTGACATTAAACATAATACTAAAGAGAGAATTC
AAGTTATATTATTTTAAAGAATCTGTTGACAAGTCGACCTACTACACCACAATGTCTCCT
CCATAAGGACTAATGGTGCAAATCGGATCTCATGTCTTAAGAATCAGGAAAAGCTGCACC
TCTCCTAAATAAGTAGTAAATTTTCATCAAGTGAACATATAGATGTAATAAGTGATTGTG
TTGCTCTCTTTCCCCCTGCTGTTAGTATTTTTTATACAGTGACATTTTAATTTATTTATA
TCTACCTTATTACACACATACACGCAAGAATTTACAGAGGCTTTTAGAAATACATAAAGT
AAATGCAAGTAACATACAAAAATAAGTGATGAAACATCAGTTAGAGACCCTGATTCTTGG
TTAAGTCTTGTGGCTAAGTGACTCAGTAGGTGAGCAATACATATAATAGGAGAAACACAA
AACTGCTAAGAGCTTATAGAAGAAGTGCATAGGTTGTGGATAAGAAGATCCTAATAGAAT
ATTATGTTAGTGACCTTCCAATCATGTCCATGCAAGGACATGACTGTCTTTTTTACACAA
AATACCCATTTGGTCACTCACAGACATTAAAAAGCAAGCTCTTTCAAGGTGATCCCCTCT
CCAAGGGGCCAACTAGTGACCCCCAACCCCCGGAAACATAGCAACTTGGAGTAAATCTGG
CATGCCCAAGGTCTGTGGGGGTAAGGGGATGTTTCCTTTGACCTTTGACCTCTCCTCTAC
TAGAGCTGTCATCTTTCTTGACATGGGCCAGAGGCACTGATGTGCAGCAATCTGCTCTAG
TCATCAACCATGACTTTCCAACCAACAGGGAAAACTATATCCAAAGAATCCGTCATGGTG
GACATTTTGGCTATACAGGTGTGCCAATCAACATAGTAACAGAGGACAAGAGGACCTCTG
GGGACATGGAGACATTCTACAATACATCCACATGGCCCTCAATGTTGCTGACCTCATTTC
AGAGGGCTGTTGGGCCCAGCCAGGGACCAATTCTGAGACTGAGGAGGAACTGGAGCAGGA
CAGGGAGGAAATCCAGGGATAGACACCTCTGTTATATTTTTCTTTTTTTCTAAAATGAAT
GAATGAGTCTTTTGGTCAGAACTGCCATCTTCCAGTAATTCACCAAAATGACCAACACAA
AGGGAGAGCAGAGAGGCACCTGCTATACGTTCTCTAGGCCTTTTAGAAAATATGGAGTTG
TTACTTTGCCACATACATGGGAATCTACAAGAAAGGTGATATTGTAGACATTAAGGGAAT
GGGCGCTGTTCAAAAAGGAATGCCCCACAAATGTTACCAGGGCAAAACTAGAAGAGTCTA
CAATGTTACCCAGCATGCTGGTGGTATTGTTGTAAACAAACAAGGGCAAGATTCTTGCCG
AGAGAAGTAATGTACATATTGAACATATTAAGCACTCTAAGAACTGACATATTTTCCTGA
AACGTGTGAAGGAAAATGATCAGAAAAAGAAGGAAGCCAAAGAGAAAGGTACTTGGGTTC
AACTGAAGCGCCAGCCTGCTCCACCCAGAGAAGCACATTTGTGAGAACCAGCAGAAAGGA
GCCTGAGTGGCTGGACCTCATTCCCTATGAATTCATGGCAGGATGGGTGAAAAAAAAGAC
CTCTGGACTGTAAAAACGTTTCTCTTAACTGAGTACAAGTGTGGTGTTCTTTCCCCCCAA
GAAATACTTGAAGTAAACTTAATTGTGTCCTAAAAAAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved