Equus_caballus Locus Mono:25:SNORD22
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:25:SNORD22
Equus_caballus
Mono:25:SNORD22
2
SNORD22
1001..1126
2126
TCGCGCGGCCTCGGCGGCCCACATCCGGCCCACCCCCATTGCAGGGGAAAGTTAGTTTG
CAGGACGCCGCTGAAGCGAATCCTTGCAAGTTGTAAGACGCCCACGGGAAGTCTGGTCGG
CGGACCCAGGATAGCAGATCAAGTGCAGACGAACCACCCGGGTAGAAACACTCACCAAAC
AAGCCCACAGTGCAGCGTTAGCCCTCTCCCAAAAGACCGACTGGTCCCCCGGCATCCGTA
TTTATAGCTACTGAAGCGCGCGGAAGTCAAGAAATGACCATTGCGCCTGCGCCGTGCCAT
GCGCAGTTAGGGAGTTAGAAATTCGCTAAGGGTGCTGGGAATCTACTTCAGGTTAAGCCC
CACCCCTACCTGGCTCAGAGTCCTCTCGCGACACTAGACCCTTCGCGCGGGACTTTGCTG
TTGAATGTAAATTACGGAAACTGAGTTTTGTTAAGTAGGTAGGTGGATGGGTGTGTACGG
CGTAGCAAGTTTGCTTGTCTACGGTTAGTTCGCCCAATCTGGAAGATATGCCCTTAAGTA
AGCTCGCCAACAAAAACTTTGGAGTAATAAGTATGCGAGAAATGCAGAGTCTCAAAAGGG
ATTGAATTTGCTGTGTCACGTGAAATAAACATTTGATAAATGCATAGGTAAATAAGACAG
AAGTGCTCCTATACGAACTGGCGAGAATTAAAAACCTCCTGTGCACACTATGTGAATATA
CTTAAGGCTAGTGAACTGTATAATTAAAAATAGTTAAAATGGTAAATTTTATGTTAAATA
TATTTTAACACACACCTAATATAATGAAGTGGGCAAGTAAAGAATCCTGAAGATACATAT
TACATGTGAAGTGTTGCAAATGTGATAGAATTTCGAATATGGTGTTAGGTGAATAAATGG
TAAATTGACATACAGCCATCACAGCTGGGCTATAATGAGTAGAAACATTTATGGTGTTTT
ATAAGATTTTGTGCTGGGCGCTTTACATAAAATTATTTACTTCCCAGTGAAGAAACATTC
ACACGTCTTACCTCCTGTCCTAGTTCCAGAGCCTGTAAAGCTAAACCCACTGGGGCTGGC
TGGGGGAAAAGAGGAAAGCTTGTTCCAGAAGGAACTGTCTGAGGGATCATAAGGATTTCT
AAACATAGGAAAGGGAAGAATAAATCACTTGTTTTAAAAATCATTTGTATAACTTTTTTC
AGGACTGAAGAAAGAAAGATCAAAGCGCATAAAATGGAATCCAGCTCTTGGAGGACATTG
GAAAGGGAATTTTCAAGTTGTTTCTTGTAGAACCTAGCTATTCAAATTGGTATATAAAAC
ATTTCAGCGTTTCTAAATAAAAAGTTTTTTAACAAAAAAAAAAATAATAAAATTATTTAC
TATCAGGGCAATCCTAAGACGTTGGAATTATTATCCAGATTCTAAGATGTGAAACAGGCC
CAGAGCAATGGTTGTCAAAGTGTAGTTGGCATATCCCGGGATCCCTGAGGCTCTTTTGGG
GGTCCATGAGGTCAAAACTTTTTCATAATAATATGTATTAGACTTAGACTTTGCCTTTTT
CACTGTGTTGACTCTGTAACGATCTTGTAAAATGAAATTGTGGGTAAAACTGCTGGTGCC
TTAGTATATTTCAAGGCCCTGTCACCAAACTGTACTGGCAATCATTGTGTTCTTCATCAT
CACAAATTTACAGTTCAAAAAAAGTCAGTTTCACCTAAGAATGTCCTTGATGAAGAAGCA
AAAATCATTACCTTTTTTCTTTTTTTCTGCCCAAGCTAACATCTGTGCCAGCCTTCCTCT
ATTTTGTATGTGGGTCCCTGCCTCAGCATGGCTGATGAGGGGTGTAGGTCTGTGTCCAGG
ATCCAAACCTGTGAACCCTAAGTGCCGAAGTGGGGTGCCCTGAACTTAACCACTATGCCA
CAGGGCCAGCCCCCCAAATCATTAATTTTATTAATTCCAAACTTTTGAGTATTCATCTTT
TTAACATTCTGTGTGACAAAGTGTGAAGTACACATAAAACACTTTTGCTGCATACAAAAG
TACAGTGGTTGTCTCCAGAAAAAGTACTTACGGCCATAGTTGGAGCTGAAACAAGCAAAT
TTTTTCATGGAACATCATTTTACTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved