Equus_caballus Locus Mono:73:SNORD89
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:73:SNORD89
Equus_caballus
Mono:73:SNORD89
15
SNORD89
1001..1114
2114
ACTTTGATTCCAGCCACTCGTAGTGAAATTACTTGGTAAGCAAATAGTTTTACTGACGT
CAACTCTGTGGCCAGACTCAATTTGAGGAGCTACTGAAATAGAAAATTTGTCTTACTGTG
AGCTCTTATTTTAACAGACAGCTTCAAAGTAGGTTTCCATAATAGCCGTTATGCTTGGAG
TCAGCCTTCTGTGGTTTATTGTGAATAGGAAAATATGTCCTTGATTCTATACTAAGTAGA
TTGTTTGCACTTTGTATTTGAAGAAACATACCAGCAAGAAATGCTTTAATCAATTCTTCC
CAGTAGCCAATGAAACTGACTTTTAAAAAGAATACTGTGACAGATGAAGGAAGTGTGATT
TCTTAATCTTGATCAGCAGCTAACAAATACAGCTTTCCTTAATTCAGAAGTTTGAACACT
AAATTATGAATAGAAGAGATTGGAAGAATTGTAGTAGCCTCATCTCTAGAAACACACATC
TTTAATAGCAGATAGAGAAGTTAGCAAGAGAAGAGACAACTCTTCAGTACTTCAAAAGGA
AAAAGTTCCCTTTGTTAGGTTTTTTGTAGATGGAAGTAAGCATAAAGAAGGATCAAATGT
TAACCAGAATTTTTGCTGAAACATAAAGTTGATAAAATGTGGGGATTATAGGGAATGTAA
ATGAAGAAAGGATAGTAAATCTGAGAGGTTTAGGGAAGGGTTAGTTATATTATTTATGGC
AGTAATCATTTTCCTTCAACAATTGTCATAAAGGCCATTTACTCACAAACAATAGAGAAA
CAGTATTTTTTAGCTCATAGCCGCAGCAGCGTGCGCAAGGCCGCGCGTCCGTGGGTGTGG
AGCTCTCCTCGGCCCGTGGCCGCCTGCGCGCTGTGGCCAGAAGAGCGGACGGTCTGGAGC
GGGGCAGACGCGCAGCACCCTGGCAGGTAACCGTTCCTGCGCGCCGCTTCCGGGGACCTT
GAGTGTGCGCAGCCTTTCCTGAAAGATTGCTCCCTGTGGTTACTGGGGAATGATGACAGT
AAAAGGCCGAATTGCAGTGTCCTCCAGCAGTTTGCTCTCTTGTGGGGTACACGATGACAA
AATCTCCTGAAGCGAACCACTGGTCTGACCTCAGTAACCGCAACTTGGAAGCCCCGTACC
TTGAGCAGCTTTCCAAGAAAGGCATTCCCAAAGAGCGCTCATGTTTTAAGGAAAAGCAGT
CAGTGAGCCTTCGGACAGTTTTGGGGCTTAAACGAGTAGTAAATACCTGTCTGCACACTT
TGTGATCTCCTTGCTGAGTCAAGGATGCTAGATCATAAAAACAGTCATAGACTTCCATTT
GGATCCCATTTGTTCCCATTTAGATGAAATACCCAGTGTAACCAAATTCCTTAGTGAGAT
AGCTTAGTTTGGCAACAGTGTCTTCACATTAGAGTTTATCTGGGGGCTGGTCTGGTGACG
GAGTGGTTAAGTTCGCCCGCTCCACTTCCGCAGCCCGGGGGTTACAGGTCCGGATCCCGG
GTGCAGACCCAACACTGCTTGTCATCTCACATAAAATAGAGGAAGATTGGCGCAGATTTA
GCTCAGCGACTATCTTCCTCAAGCGAAAAAAAGGAGCATTGGCAACAGATGTTAGCTCAG
GGCCAATCTTCCCCACAAAAAAAGTTCATTTGCTCAATGAAGGCTGAGGTTAAATTGGTA
TGTATATATTAGTAACTAGAATCTGAGGTAATGATACGTTTTACTCAAAAGCAGTTTCTT
CGGGCTCAGTGTAAAACTGCTTTGTGATTTTTATGAAGCACAGGATGCTGACCTGAACGA
AAGCTAGTTTTGTGGCTTAACCCACGTTGTGCTTCTGTGATGCAACAACCAATGAGGAAA
GCCACCTACACCTTTCCCAGTTAATGTAGGTTTTGAAGTTTTAAAAACACTTTAAAGCGA
TTCATTTTCAAAAATACTAATACATGTATTGCTAGTTACGAGTGAAATTTCTACAATGTC
ACAATCAGTCATGCAGGTAGAGATTTGCCCTCATTCTAACAGCAAAGTATAAAATAAGTT
GTAAATTTTAAAAAGTATTTGCATTATGTTAAAAAAAGGTCAGGGGCTCCCTTGTGGCAC
AGTGGTTAAGTGCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved