Equus_caballus Locus Mono:50:SNORD42
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:50:SNORD42
Equus_caballus
Mono:50:SNORD42
4
SNORD42
1001..1068
2068
TCATCTTAACCACCACATTATACTGCCTTCTACAGAGAAACTGGTTACTATTTAGTCTT
CAAGAATAAGAATCTACATGTTAATGATATAACCTATGAGGCATAGTCTGTTGTAAACTG
TCGTAGTTAGGCGTAATGCAAATAGTAAAAAGCCTGAAGAATGTGTGCATGGAGGAAGAA
GTCAATGCCTGCTGTAATGAGACAGGGTTATTGATGCAAATTATTGCATCTGAGGGGAAG
GGAAAGTCTCCCAAGACACAGAAATGGTTGGCAGAAAAACTGCTGGTTAAGCAAGGAATT
ACTATTTTCACCAAGATACCTGCTTCCTTATGACACCTTTGCTTGTCCTCCTCAGACATA
CAAACAAAATAGATAGCATGGGATATTAGAAAGTACACTGACTAGTATTTAGAGGTATCA
ATTCTAGTTCTAACTGGCAGTGTGCTCTGGGATAAGCCATTTGAAGAAGAGAACAGCTTA
TTACCAGTTATTTCCAAACTTCCAAGTTTATTTTAGAAATGCAAGCTTACTGTCTGACGA
AATTCTAAAGATTTAACTTGCCTTTTAAAGTAATTAGATTACTAAATTAGAAGTTTAGTT
TACGTGTCTGTCAATCTATGCATAAAAATCTCTGGCATTTGAAGATAAATGGTAACCTGA
TCATTTGTAATTTAGGGTTATCTCCCTGTATGACTAGTGATTACAGCTGGAGCCCGCTTT
TATAGAGACAGGCAGCATGTATGCGCAGCGCTAAGCAGCATGGGCTGTGGAGCCTGACTG
CATAATTCCCTAATAGCTTGTTTGCTGTGGAACCTGAGACACTTACATAAGGATACTAAT
GCCAAGAAAGCTTATTTGCTATTATAATAGTAACTAGTACCTCATAGGATTGAAAATAAT
GACTAACTCTATAAATTTACAATGATGCTCAAGGCTTGATACAAAAGCCTCAAGGCACTA
TTAAACAGTAAAGCTAAGCAATTTTGACCTATCTAAATATTGTAAATTTTATCTATAAGG
AAGCAAAAACCTGAGACTCGTGATGTCTTCAAAGGAACAACTGATGTACATGTGGGAAAA
AGAAAAAGGAAGGAAAAACCAAGTTGGGGAGAGAATTCGTTCAGGAAAAGAGACAACTTA
CAAAATTCTCCCCATTTTCTAATATGGTAACTAGTTTGCTGACCACCACAACAGAAAGCT
TTCTCTCTCTTGTTTTTTTAAGAAGTTTTTTTTACCAGAGTAATATTTTGAAGTTTATAT
ACAACTTCTCCCTTAAGGGAGTTTTGACATTTTTCAAATTACAAAATATCACATATTTAT
TTTAACCAGTGAAACAAGATTAACAAGTATAGTAAAGACAAAGCTAATTCTTTCTTCCCA
TGTCTGTTTCTAATACCACCTCCTAAGATAACCAATATTATCAGTACAAATGCTTTTTAT
AAGTTCATTTTTTCTTTTCAAAATTACAGATATGATAATCAAAAGCTTACCTCCAGATAT
ATTGATGGTGGATTATGCTCCCCACCAAATTTGTCCAATAGGGCCTCTATATGTTCCTGT
GTCAATTTAATCATTTGTTTGATATTCCATACCTAAAAAATATTTTAAAAGAATTTACAT
AAAAATGATTTAGGATATGAATTAGAAATATTTTAATATTTCTATTAAAATAGTGCAGTA
ACTGCCAGTGTTTCTTGAAATTTAGAGCTTAGAGAACTTAGAGATCATTTAATATAGTGG
TTTTCCCCTTTTATTATTAAACATCTTCAAATTTTTTTCTATACTAGTAATACAATATAT
TCTCAACTATAAAAGATTCAAATAACATATGAGTATTCATAATAAATGATGAAAATCTCT
TTTCACCTTCCCCATATTCCTGGGCGCCCTGCCAAAAGTATTGTTTACAGTTTGGTATGC
ATCCTTCCACATCTCCTTTTTATTCAAGTAAAAAACAAATACATACATATATAAAAAACA
AATCATATAAATATTACATATAAAAATATTTTTAACAATTGCTTTTTCACTGAACGTGCC
TCAGAATTCTTTCCATGTCAATACATACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved