Equus_caballus Locus Poly:21:SNORD116
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:21:SNORD116
Equus_caballus
Poly:21:SNORD116
Un0338
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1094, 3749..3841, 6540..6633, 9279..9371, 12065..12158, 14803..14895, 17592..17685, 20329..20421, 23115..23208
24208
TCTGTTGCGCCGCCCGTGGGCGAGTGGTGCCGGCTCTCGTGTCAGCCCTGTTGCCCTGG
CGGTAGCCAGGTAGCATTACCATCAAGTGCCGTTCCCCCCGGCCCAGCTCGCGGGGACAC
GCTGGCCACGTTGACCTCACATCCACGGTCAGCGTGAGGGTGTAGGTGGATGGTCCGTGT
CCTTTGCTCAGAAGGAGTGGCGCTCAGAGAGGGAGTCCGGGGCCGATTGCAGCAGCCTCT
AGCGGTGCGAGTTGGCGTCCTTCCTTGGGAAGTCACCGGGCTTCCGCGTGGGGTGGCAGG
GCACGAGGTCAGGCATCTGTGAGGACGGCGTGCTTTCCCGGGTGCTGAGGCCACCGCCCA
CGGAAGCCCGCAGGCACGCACGCGCGCGCGCGCAAACACACACACACACACACACACACA
CACGTGCACAGGCCTGCGCATCTGCCTACACTCGGGATATCACACGCGCCTTCGGTCATC
CCGAAGGGATAGAGGTACAGGGCAAGCAGATGCAAGGGTGCCGCGGGGGGAACTGTGGCA
CGGATCCTGTCTTCTGACCAGCTGGGCACGTTTCTGAAGCATGCGTGTGCTTTCTCTACA
CTCCTCAGGTGGAAGTGCCGTGCAAAGCTCGCTGCCGCCCACCGACAGAAGAAGACCCTT
CGTGTCCCGTGACGAGCGCAGGTGCGAGGCAGTCGCGGCGGAAGTGTGGCCCGGGATGCG
CACCACGCCCTCGGACGGCCCAGGACGGTCAGCATTGCTTTGTCCCAAGTTCGGCCTCTC
GCCCTGAGGGCTTCGCTAGACCTGCCTCAGAGGCTTCTTGGGCGCGTGTGCCCGGGGGCC
CGCGGCGTCGTGCTCTGAGGGCGGACTGACTGTTGCCCCTGCTCCGGCGGGGCTCGGCTC
TGGATTCTCCAGGCCGCTGGCGCCCATGAGGCGATCGGCTCGCCCGCTGCGGAGCCCCCC
AGCCTGCCTGGTTAGTTTGTCCAGGTTGGCAGAACGTGCTCGGATCGATGATGACTCCCT
CATATGCATTCCTTGGAAAATCTGAACAAAATGAGTGAGAACTCACTACCGTCGTTCTCA
TCGAAACTGAGGTCCGGCACGTTGTCTTCCCCAGGCATGGCAGGAGTGAGGGACCGCTTC
CCCTTGAGCGCACTGGGACGGGCACGGGCACCACGCCGGGCGTCCGCATTTGGGAGCCGT
GGCATCTGGGGGTCCTTCCTCTCACCGCGTGAGGGGGGTGTCCGTCAGTCGGCGGTGCTT
GGTTGAACGGCCTGTGGCTGAGGGCCGTGGCTGGCAGCTCGCATCCTAGGTTGGGAAGTC
GGAGAGTGTGGCGCTGGCACAGGCCCCGTGAGCTCAGGGCCTTGTGGCTGTGTGGGCCTG
GTTCCCGCCGGGGACGAAGGCCCCGGGGGTCTGCGTCTCGGAGCTGAGCAGTAAGCAGTG
GAAGGTCGCGTGGTTTCTGATGAGAGCCCCGGGCCAGGCGGGCGGCCGTCAGCTGTTCTT
GCCTTTTGGCTTGGTGAGGCAGTTGGAGCACCCCTCGCGGTTTGGGGCGCCGCCGGAGGG
GTGAGACTTTGGTGCTGCAGCTTGGGGCTCCTCTAGTTCTCCGGCTCGCCCAGTCCACGC
CAAGGTGCCCAAACGGGGACCGGGCTGTGGGCCTGGCACTCAGGTCAGGACACTGTGGTG
GCTGATGGCCTGGTCGTGGGGAGCTGGGGGGGAAGAAGAGCACGGAGAGGACAGGTCACA
GTGTGATGCCGTGGGCTTCCGTGGGACGTGCTGCCTCGTTGTGTTCCGAGCGCTGGCAGC
GGCTTGTCGGGAACGTGCCCTGGCTCTGACGGGGCTGGCGATTGGTGCGTGCCGGGGAAG
GCTGGAGGCTTGAAGGCCCGGGGGTGTGCACTGTGGTCGGTGACCTTTGTGGCAGATGGC
GGGCCTTGTTCCAGAGAGGTGGCGCTCTGCGGTTCTCTCCACGGTTCCTTGAAGAGGGGC
CCGGCACGTGACTGCCGGGCGGCCGGCCGCCGCTGCTCATCGATTGCTTGGGCGACCGTG
GCCTTGGATCCTCCCCCGTCTCAGGCGCGGGGTCTCCGAGGAGAAAGCGTTCCTCCAGCA
CGGTCCGATTTTCCTGGCGCGGTTCGCCTCATGCCTCGTCGCAGGGCTTTAGGTTTCTTC
GTGGAAGCCTGTGGGCCTGGCGGAGACGGCGGGTGCCGTGACCCGAGCTGCCCTGCCGCG
CACAGACGTCCGCCTTGGAAAACGTCCGCCTCTCCAAGGGTGGCGGGGGCGGGGTGTGTG
TGTGCTTCTTTCTGTGGCTTCCTTATTTCCTTTTATGGACAGGAGCCATCCCTTGGGGCC
GTGTGAGGGTCGTTTTGTGGTGTTTACAGGTGCCCGATGGGAGAGTTCACAGACGTTGAA
CGTGACGGGTCCGCGTCCCGTACGCACAGTCGAGATTCCTCGTGCCGTCTCCCGGGCTCC
CTGGCGCCACGTGTGTGTAGGGTTGAGGTCCTGCTTGGGGGACTTGCCTCGCAGGCCTGA
GGTGGGCCAGGCAGCGCGTGGGTGGGAAAGAAGTCCCTGGAAAGGCCGGGGTCCAGAAAG
CGGGCCCACTGTGGTAACGCCAGGTCCCTGGACGGGAGTGGGCTCCAGGTTCAGTCGGGT
CTTAGCGTGGGTCGTGGTGGCCACAGACCACCTCTTCCTGGCACTTCCCCTGCCGCTGGC
ACCGCTGAGGGCGTGGGTGTAGCCTCAGTCAGCAGGAAGAGGCGCCTGGCCCCCGGTCCC
CCGGTGGCGTGGCCACTGGAGATCAGGAGGGGCTGCTGCTTCTGCCCTCTAGCCCGTGTC
CCAGCGGCGCCAGCCTTCGAGTGGTGTAGGCGCTTTACGTGGTTCAGGTCCAGCAGTGGT
CGGCGCGTTTCCGTCGGGCGCGGTTCGCGTGGCACGGCGTGCGGGGACAGCGGGCGCCCA
CGGTCGGGCGGAGGGTGAACCTGCTGGAGTGTCGTGTTCCGGTGTTCAGAGGCAGGGGCT
GTGAGAGAGGGAGCCTGTGGCCTATTTCAGCAGGCCGAAAGGGCAGAGGTGAGCCGCCGG
GCGAGTCGAGGTCAAAGCCGCCAGCGCGAGCTCCTGGTCTCGCGGCAGGGCCTGAGGCCA
GTGATGTGTGCGGAAGACGTGCTTCTTCAGGGTCTCGGGCCCCGCGCACCCGAAGACACG
CACACGCGCCCGCCTGCGCGCCTTCCTGCGCTTGTGCTGTCACACACGCCTTCTTGTCAC
ACCTGAGGGGAAGAGGTAGAGGCCAAGAAGATGCAAGGCTTGCCCCGGGGCAGGGAGTCG
GGGTGGAACCCTTGGCCTGGCTCTGGTTACCTGAGAGCCTGGCTGGGTCGCTGAGGCGTG
CGCGTGCGATTGCTCTGCACTTCCCAGGTGGGATCTCCGAGCAAAGCTTGCCGTCGCCCA
AGAAGAGAAGACCTTCCTGTCGTTTGTGGAGCGGAGACGCGAGGGAATCCCGCAAGAAGC
GTGGCTTCGGGTGCGCCCCGTGCCCGTGGGTCGCTGAGGCTGGTAAGGATCCCCCTGCAC
CCAGTTCGTGCCGTTGGCCCTGGGAGTCCCAGACCGCGCTGAGAGGCTTCTAGCCCGCGG
GTCCCCGGGGGCGTGCGGAGCTGGCGCTCTGAGGGTGGGTCGACAGTTGCCCTTGCTCAG
GGGCTTGGCTCGGGATTCTCCGGGCCGCTGGCCGACCCTGAGGTGATGGGCTCACCCGCC
GAGCCCCGCCAGCTGCCCCGAAGGTGCTCGGATCGATGATGACTCCCTCAAATGCATTCC
TTGGAAATCTGAACAAAATGAGTGAGAACTCACTACCGTCGTTCTCGCCGAGACTGAGGT
CCAGCACCTGGTCTTCTCCGGGGGTGAGAGGAGTGAGGGACAGCTTCTGGTTGATGACAC
TCGCGCAGAGCCCGCCCAGGGCCTCAGCGTGTGGGCGTCTGCTGTGTTTGCACCGGGAGC
GTGACCGCATGAGCTGGACGTTTGCGACTCGGAGGGACTTGCTTGAATGGCCGGCCTCTG
CTGGCGCGGCGCCCGGGTCGCATGGGCGTCTTTAGAGTCGGAGAGTGTGGCGTTGGCATG
GGCCCGGCCCGTGGTTGGCGCTGAGTACGCGCTGGCCCGGTTCTGGCCTGAGCCGTTGCC
CCGGGGGGCGTGGCGGGTGGGGTGGCGGTCCGTGTCTGGAGGCCGAACAGCCGAGTCTTC
CCTGGGTTCCGTTCGGAGCCTCGGTTTGGGCCGGGCAAGCCGCAGCGCCTGTGGTTGCCT
TCTGGCTTGGTGAGGAGGTGTGATGGGCCCGTGGTTTTGGCGGCGGGGGCAGCGGCCCTA
GGCCGCAGCGCTGCAGCTGGCAGCTCCTGTGTGTCACCTGCTCACCCGGGCCACACACAG
CTGGCCAAAGGTGGCCCTGGCGCTGACGTCCAGGCAGTGTGGTGGCTGACAGGGCGGGCA
GGAAGGAAAGGGAGCGGAGGGGAGCGGCCGTAGTGCGGTTCCACGGGCTTGCACAGGATG
TACCCTCTTGTTGAGTTGCGACCGCCGTCGCGGTCTTGCCAGGGGTGGCGTTGGGTCCCA
AGGGGGCTGCCGGTTGTTGCCTGCCAGAGAAGGCTCGGCTGCGGTAGATGACCTGTGCGG
TAGACGGCGTCGCGCCCCCGGGAGGTTCGGCCCCCAGTGTTTGTCGTCCTAGCGCCTTGA
AGAGACCCACAGGCCCGCGACTGGCCACCGGCCCCGTCTGCTCCGGATTGCTGAGGCGGA
CAATCTCTTTGACCCTGCGCCCCCTCGGGTCCGGCGCTTGCCAGGTGAAGGCGTTGCTGC
AGGAAGGTTCGCTCTTCCTGGCCCGGGGGGCTCCTGTGGTCCCGGGCGTGCCGGGGAGCG
GGGCCAGGTGGCGGTGTGGGGCGTCGGGGGGGGGGTGTGGGGGCGTGCGCGAGGGGTGGT
TAAGAGCGGTGTGCGGAAGCCTGCGGGCGTGGCAGCGACCCGAGGGTGCTGCGATCCTGG
GCGCCCTGCCCCGGACGCACGTCCAGCGTGGAGGAGGAGCACGTCTCCTTGTGTGGGAGC
GGTGTCCTAGTTTCATTCTTTGCCTTGTCTTCCAGGAGGAGGCAGCGTTTGTGCTCTGTG
AGGTCGTCTGTGGTGTTCTGGGGCCGAAGGAGGGGGTCATAGGTCGAGTGCGACGCGGTC
GACTTAGGCAAAGTCATAATGCCTTGACGGCTGTCGTCCGGGAGGCTCCCTGCCCGCCTG
GCGCGCGAGGTGTTGGAGGCTACACCTTGGGGGACTTGCTGTGCAGGCGTGAGGGGGCTT
CCCCTTTGGAGCAGGGAGCCGCGGGGTTGAACGTTTCCTCGAAGGCCAGCGCCCCGCAAC
CCGCAGGCGGTGGAAATGCCGCGTCGCTGCGTGGGAATTGGCTGTGGTCTGAGACGGGTC
TTGCCCCGGGTCTCGGTGGCTGTGACCAGCCGTTGCAGCGGGGTTCCCTGCTGGCCCGCC
CAGGGCGTCTTGGCTTAGATAGCCCAGACCGGAGTGCGGCCTGAAGGCGTCGGGCCCCTG
GAGGTTCAGACGGGCTGCTTCTGTTGCGCCGCCCGTGGGCGAGTGGTGCCGGCTCTCGTG
TCAGCCCTGTTGCCCTGGCGGTAGCCAGGTAGCATTACCATCAAGTGCCGTTCCCCCCGG
CCCAGCTCGCGGGGACACGCTGGCCACGTTGACCTCACATCCACGGTCAGCGTGAGGGTG
TAGGTGGATGGTCCGTGTCCTTTGCTCAGAAGGAGTGGCGCTCAGAGAGGGAGTCCGGGG
CCGATTGCAGCAGCCTCTAGCGGTGCGAGTTGGCGTCCTTCCTTGGGAAGTCACCGGGCT
TCCGCGTGGGGTGGCAGGGCACGAGGTCAGGCATCTGTGAGGACGGCGTGCTTTCCCGGG
TGCTGAGGCCACCGCACACGGAAGCCCGCAGGCACGCACGCGCGCGCGCGCGCAAACACA
CACACACACACACACACACGTGCACAGGCCTGCGCATCTGCCTACACTCGGGATATCACA
CGCGCCTTCGGTCATCCCGAAGGGATAGAGGTACAGGGCAAGCAGATGCAAGGGTGCCGC
GGGGGGAACTGTGGCACGGATCCTGTCTTCTGACCAGCTGGGCACGTTTCTGAAGCATGC
GTGTGCTTTCTCTACACTCCTCAGGTGGAAGAGCCGTGCAAAGCTCGCTGCCCGCCCACC
GACAGAAGAAGACCCTTCGTGTCTCGTGACGAGCGCAGGTGCGAGGCAGTCGCGGCGGAA
GTGTGGCCCGGAGATGCACACCACGCCTCTCGGACGCCCAGGACGGTCAGCATTGCTTTT
GTCACAAGTTCGCCCTCTCGCCCTGAGGCCTCGCTAGACCTGCCTCAGAGCCTCTTGGGC
GCGTGTGCCCGGGGCCCGCGGCGTCGTGCTCTGAGGGCGACTGACTGTTGCCCCTGCTCC
GGCGAGCTCGGCTCTGGATCTTACAGAGCCGCGTGGCGCCCATGAGGCGATCGGCTCGCC
CGCCGCTTGTAGACCCCCAGCCTGCCTGGTTAGTTTGTCCAGGTTGGCAGAACGTGCTTC
GGATCGATGATGACTCCCTCATATGCATTCCTTGGAAAATCTGAACAAAATGAGTGAGAA
CTCACTACCGTCGTTCTCATCGAAACTGAGTTCCGGCACGTTGTCTTCCCCAGGCATGGC
AGGAGTGAGGGACCGCTTCCCTTTGAGCGCACTGGGACGGGCACGGGCACCACGCCGGGC
GTCCACATTTGGGAGCCGTGGCATCTGGGGGTCCTTCCTCTCACCGCGTGAGGGGGGGTG
TCGGTCAGTCGGCGGTGCTTGTTTGAACGGCCTGTGGCTGAGGGCCGTGGCTGGCAGCTC
GCATCCTAGGTTGGGAAGTCGGAGAGTGTGGCGCTGGCACAGGCCCCGTGAGCTCAGGGC
CTTGTGGCTGTGTGGGCCTGGTTCCCGCCGGGGACGAAGGCCCCGGGGGTCTGCGTCTCG
GAGCTGAGCAGTAAGCAGTGGAAGGTCGCGTGGTTTCTGATGAGAGCCCCGGGCCAGGCG
GGCGGCCGTCAGCTGTTCTTGCCTTTTGGCTTGGTGAGGCAGTTGGAGCACCCCTCGCGG
TTTGGGGCGCCGCCGGAGGGGTGAGACTTTGGTGCTGCAGCTTGGGGCTCCTCTAGTTCT
CCGGCTCGCCCAGTCCACGCCAAGGTGCCCAAACGGGGACCGGGCTGTGGGCCTGGCACT
CAGGTCAAGACACTGTGGTGGCTGATGGCCTGGTCGTGGGGAGCTGGGGGGGAAGAAGAG
CACGGAGAGGACAGGTCACAGTGTGATGCCGTGGGCTTCCGTGGGACGTGCTGCCTCGTT
GTGTTCCGAGCGCTGGCAGCGGCTTGTCGGGAACGTGCCCTGGCTCTGACGGGGCTGGCG
ATTGGTGCGTGCCGGGGAAGGCTGGAGGCTTGAAGGCCCGGGGGTGTGCACTGTGGTCGG
TGACCTTTGTGGCAGATGGCGGGCCTTGTTCCAGAGAGGTGGCGCTCTGCGGTTCTCTCC
ACGGTTCCTTGAAGAGGGGCCCGGCACGTGACTGCCGGGCGGCCGGCCGCCGCTGCTCAT
CGATTGCTTGGGCGACCGTGGCCTTGGATCCTCCCCCGTCTCAGGCGCGGGGTCTCCGAG
GAGAAAGCGTTCCTCCAGCACGGTCCGATTTTCCTGGCGCGGTTCGCCTCATGCCTCGTC
GCAGGGCTTTAGGTTTCTTCGTGGAAGCCTGTGGGCCTGGCGGAGACGGCGGGTGCCGTG
ACCCGAGCTGCCCTGCCGCGCACAGACGTCCGCCTTGGAAAACGTCCGCCTCTCCAAGGG
TGGCGGGGGCGGGGTGTGTGTGTGCTCGTTCCGTGCCTCCTCTTGCCTTCGTGGACAGAG
CCATCCTTGGGGCCGTGTGAGGTCGTTTGTGGTGTTACAGGTGCCGAGGGAGGGTCCAGA
CGTTGAACGTGACGGGTCGAGTCCCGTACGCACAGTCGAGATTCCCTCGTGGCCGTCCTC
CCCGGGGCTCCCTGGCCGCCACGTGTGTGTAGGGTTTGAGGTCCTGCTTGGGGGACTTGC
CTCGCAGGCCTGAGGTGGGCCAGGCAGCGCGTGGGTGGGAAGGAGTCCTGGAAGGCCGGG
GTCCAGAAAGCGGGCCCGCTGTGGTAACGCCAGGTCCCTGGACGGGAGTGGGCTCCAGGT
TCAGTCGGGTCTTAGCGTGGGTCGTGGTGGCCACAGACCACCTCTTCCTGGCACTTCCCC
TGCCGCTGGCACCGCTGAGGGCGTGGGTGTAGCCTCAGTCAGCAGGAAGAGGCGCCTGGC
CCCCGGTCCCCCGGTGGCGTGGCCACTGGAGATCAGGAGGGGCTGCTGCTTCTGCCCTCT
AGCCCGTGTCCCAGCGGCGCCAGCCTTCGAGTGGTGTAGGCGCTTTACGTGGTTCAGGTC
CAGCAGTGGTCGGCGCGTTTCCGTCGGGCGCGGTTCGCGTGGCACGGCGTGCGGGGACAG
CGGGCGCCCACGGTCGGGCGGAGGGTGAACCTGCTGGAGTGTCGTGTTCCGGTGTTCAGA
GGCAGGGGCTGTGAGAGAGGGAGCCTGCGGCCTATTTCAGCAGGCCGAAAGGGCAGAGGT
GAGCCGCCGGGCGAGTCGAGGTCAAAGCCGCCAGCGCGAGCTCTTGGTCTCGCGGCAGGG
CCTGAGGCCAGGGATGTGTGCGGAAGACGTGCTTCTTCAGGGGCTCGGGCCCCGCGCACC
CGAAGACACGCACACGCGCCCGCCTGCGCGCCTTCCTGCGCTTGTGCTGTCACACACGCC
TTCTTGTCACACCTGAGGGGAAGAGGTAGGGGCCAAGAAGATGCAAGGCTTGCCCCGGGG
CGGGGAGTCGGGGTGGAACCCTTGGCCTGGCTCTGGTTACCTGAGAGCCTGGCTGGGTCG
CTGAGGCATGCGCGTGCGATTGCTCTGCACTTCCCAGGTGGGATCTCCGAGCAAAGCTTG
CCGTCGCCCAAGAAGAGAAGACCTTCCTGTCGTTTGTGGAGCGGAGACGCGAGGGAATCC
CGCAAGAAGCGTGGCTTCGGGTGCGCCCCGTGCCCGTGGCTCGCTGAGGCTGGTAAGGAT
CCCCCTGCACCCAGTTCGTGCCGTTGGCCCTGGGAGTCCCAGACCGCGCTGAGAGGCTTC
TAGCCCGCGGGTCCCCGGGGGCGTGCGGAGCTGGCGCTCTGAGGGTGGGTCGACAGTTGC
CCTTGCGCAGGGGCTTGGCTCGGGATTCTCCGGGCCGCTGGCCGACCCTGAGGTGATGGG
CTCACCCGCCGAGCCCCGCCAGCTGCCCCGAAGGTGCTCGGATCGATGATGACTCCCTCA
AATGCATTCCTTGGAAATCTGAACAAAATGAGTGAGAACTCACTACCGTCGTTCTCGCCG
AGACTGAGGTCCAGCACCTGGTCTTCTCCGGGGGTGAGAGGAGTGAGGGACAGCTTCTGG
TTGATGACACTCGCGCAGAGCCCGCCCAGGGCCTCAGCGTGTGGGCGTCTGCTGTGTTTG
CACCGGGAGCGTGACCGCATGAGCTGGACGTTTGCGACTCGGAGGGACTTGCTTGAATGG
CCGGCCTCTGCTGGCGCGGCGCCCGGGTCGCATGGGCGTCTTTAGAGTCGGAGAGTGTGG
CGTTGGCATGGGCCCGGCCCGTGGTTGGCGCTGAGTACGCGCTGGCCCGGTTCTGGCCTG
AGCCGTTGCCCCGGGGGGCGTGGCGGGTGGGGTGGCGGTCCGTGTCTGGAGGCCGAACAG
CCGAGTCTTCCCTGGGTTCCGTTCGGAGCCTCGGTTTGGGCCGGGCAAGCCGCAGCGCCT
GTGGTTGCCTTCTGGCTTGGTGAGGAGGTGTGATGGGCCCGTGGTTTTGGCGGCGGGGGC
AGCGGCCCTAGGCCGCAGCGCTGCAGCTGGCAGCTCCTGTGTGTCACCTGCTCACCCGGG
CCACACACAGCTGGCCAAAGGTGGCCCTGGCGCTGACGTCCAGGCAGTGTGGTGGCTGAC
AGGGCGGGCAGGAAGGAAAGGGAGCGGAGGGGAGCGGCCGTAGTGCGGTTCCACGGGCTT
GCACAGGATGTACCCTCTTGTTGGGTTGCGACCGCCGTCGCGGTCTTGCCAGGGGTGGCG
TTGGGTCCCAAGGGGGCTGCCGGTTGTTGCCTGCCAGGGAAGGCTCGGCTGCGGTAGATG
ACCTGTGCGGTAGACGGCGTCGCGCCCCCGGGAGGTTCGGCCCCCAGTGTTTGTCGTCCT
AGCGCCTTGAAGAGACCCACAGGCCCGCGACTGGCCACCGGCCCCGTCTGCTCCGGATTG
CTGAGGCGGACAATCTCTTTGACCCTGCGCCCCCTCGGGTCCGGCGCTTGCCAGGTGAAG
GCGTTGCTGCAGGAAGGTTCGCTCTTCCTGGCCCGGGGGGCTCCTGTGGTCCCGGGCGTG
CCGGGGAGCGGGGCCAGGTGGCGGTGTGGGGCGTCGGGGGGGGGGTGTGGGGGCGTGCGC
GAGGGGTGGTTAAGAGCGGTGTGCGGAAGCCTGCGGGCGTGGCAGCGACCCGAGGGTGCT
GCGATCCTGGGCGCCCTGCCCCGGACGCACGTCCAGCGTGGAGGAGGAGCACGTCTCCTT
GTGTGGGAGCGGTGTCCTAGTTTCATTCTTTGCCTTGTCTTCCAGGAGGAGGCAGCGTTT
GTGCTCTGTGAGGTCGTCTGTGGTGTTCTGGGGCCGAAGGAGGGGGTCATAGGTCGAGTG
CGACGCGGTCGACTTAGGCAAAGTCATAATGCCTTGACGGCTGTCGTCCGGGAGGCTCCC
TGCCCGCCTGGCGCGCGAGGTGTTGGAGGCTACACCTTGGGGGACTTGCTGTGCAGGCGT
GAGGGGGCTTCCCCTTTGGAGCAGGGAGCCGCGGGGTTGAACGTTTCCTCGAAGGCCAGC
GCCCCGCAACCCGCAGGCGGTGGAAATGCCGCGTCGCTGCGTGGGAATTGGCTGTGGTCT
GAGACGGGTCTTGCCCCGGGTCTCGGTGGCTGTGACCAGCCGTTGCAGCGGGGTTCCCTG
CTGGCCCGCCCAGGGCGTCTTGGCTTAGATAGCCCAGACCGGAGTGCGGCCTGAAGGCGT
CGGGCCCCTGGAGGTTCAGACGGGCTGCTTCTGTTGCGCCGCCCGTGGGCGAGTGGTGCC
GGCTCTCGTGTCAGCCCTGTTGTCCTGGCGGTAGCCAGGTAGCATTACCATCAAGTGCCG
TTCCCCCCGGCCCAGCTCGCGGGGACACGCTGGCCACGTTGACCTCACATCCACGGTCAG
CGTGAGGGTGTAGGTGGATGGTCCGTGTCCTTTGCTCAGAAGGAGTGGCGCTCAGAGAGG
GAGTCCGGGGCCGATTGCAGCAGCCTCTAGCGGTGCGAGTTGGCGTCCTTCCTTGGGAAG
TCACCGGGCTTCCGCGTGGGGTGGCAGGGCACGAGGTCAGGCATCTGTGAGGACGGCGTG
CTTTCCCGGGTGCTGAGGCCACCGCACACGGAAGCCTGCAGGCACGCACGCGCGCACGCG
CAAACACACACACACACACACACACACGTGCACAGGCCTGCGCATCTGCCTACACTCGGG
ATATCACACGCGCCTTCGGTCATCCCGAAGGGATAGAGGTACAGGGCAAGCAGATGCAAG
GGTGCCGCGGGGGGAACTGTGGCACGGATCCTGTCTTCTGACCAGCTGGGCACGTTTCTG
AAGCATGCGTGTGCTTTCTCTACACTCCTCAGGTGGAAGTGCCGTGCAAAGCTCGCTGCC
GCCCACCGACAGAAGAAGACCCTTCGTGTCCCGTGACGAGCGCAGGTGCGAGGCAGTCGC
GGCGGAAGTGTGGCCCGGGATGCGCACCACGCCCTCGGACGGCCCAGGACGGTCAGCATT
GCTTTGTCCCAAGTTCGGCCTCTCGCCCTGAGGGCTTCGCTAGACCTGCCTCAGAGGCTT
CTTGGGCGCGTGTGCCCGGGGGCCCGCGGCGTCGTGCTCTGAGGGCGGACTGACTGTTGC
CCCTGCTCCGGCGGGGCTCGGCTCTGGATTCTCCAGGCCGCTGGCGCCCATGAGGCGATC
GGCTCGCCCGCTGCGGAGCCCCCCAGCCTGCCTGGTTAGTTTGTCCAGGTTGGCAGAACG
TGCTCGGATCGATGATGACTCCCTCATATGCATTCCTTGGAAAATCTGAACAAAATGAGT
GAGAACTCACTACCGTCGTTCTCATCGAAACTGAGGTCCGGCACGTTGTCTTCCCCAGGC
ATGGCAGGAGTGAGGGACCGCTTCCCCTTGAGCGCACTGGGACGGGCACGGGCACCACGC
CGGGCGTCCGCATTTGGGAGCCGTGGCATTTGGGGGTCCTTCCTCTCACCGCGTGAGGGG
GGTGTCCGTCAGTCGGCGGTGCTTGGTTGAACGGCCTGTGGCTGAGGGCCGTGGCTGGCA
GCTCGCATCCTAGGTTGGGAAGTCGGAGAGTGTGGCGCTGGCACAGGCCCCGTGAGCTCA
GGGCCTTGTGGCTGTGTGGGCCTGGTTCCCGCCGGGGACGAAGGCCCCGGGGGTCTGCGT
CTCGGAGCTGAGCAGTAAGCAGTGGAAGGTCGCGTGGTTTCTGATGAGAGCCCCGGGCCA
GGCGGGCGGCCGTCAGCTGTTCTTGCCTTTTGGCTTGGTGAGGCAGTTGGAGCACCCCTC
GCGGTTTGGGGCGCCGCCGGAGGGGTGAGACTTTGGTGCTGCAGCTTGGGGCTCCTCTAG
TTCTCCGGCTCGCCCAGTCCACGCCAAGGTGCCCAAACGGGGACCGGGCTGTGGGCCTGG
CACTCAGGTCAGGACACTGTGGTGGCTGATGGCCTGGTCGTGGGGAGCTGGGGGGGAAGA
AGAGCACGGAGAGGACAGGTCACAGTGTGATGCCGTGGGCTTCCGTGGGACGTGCTGCCT
CGTTGTGTTCCGAGCGCTGGCAGCGGCTTGTCGGGAACGTGCCCTGGCTCTGACGGGGCT
GGCGATTGGTGCGTGCCGGGGAAGGCTGGAGGCTTGAAGGCCCGGGGGTGTGCACTGTGG
TCGGTGACCTTTGTGGCAGATGGCGGGCCTTGTTCCAGAGCGGTGGCGCTCTGCGGTTCT
CTCCACGGTTCCTTGAAGAGGGGCCCGGCACGTGACTGCCGGCCGGCCGGCCGCCGCTGC
TCATCGATTGCTTGGGCGACCGTGGCCTTGGATCCTCCGCCGTCTCAGGCGCGGGGTCTC
CGAGGAGAAAGCGTTCCTCCAGCACGGTCCGATTTTCCTGGCGCGGTTTGCCTCATGCCT
CGTCGCAGGGCTTTAGGTTTCTTCGTGGAAGCCTGTGGGCCTGGCGGAGACGGCGGGTGC
CGTGACCCGAGCTGCCCTGCCGCGCACAGACGTCCGCCTTGGAAAACGTCCGCCTCTCCA
AGGGTGGCGGGGGCGGGGTGTGTGTGTGCTCGTTCCGTGCCTCCTCTTGCCTTCGTGGAC
AGAGCCATCCTTGGGGCCGTGTGAGGTCGTTTGTGGTGTTACAGGTGCCGAGGGAGGGTC
CAGACGTTGAACGTGACGGGTCGAGTCCCGTACGCACAGTCGAGATTCCCTCGTGGCCGT
CCTCCCCGGGGCTCCCTGGCCGCCACGTGTGTGTAGGGTTTGAGGTCCTGCTTGGGGGAC
TTGCCTCGCAGGCCTGAGGTGGGCCAGGCAGCGCGTGGGTGGGAAGGAGTCCTGGAAGGC
CGGGGTCCAGAAAGCGGGCCCGCTGTGGTAACGCCAGGTCCCTGGACGGGAGTGGGCTCC
AGGTTCAGTCGGGTCTTAGCGTGGGTCGTGGTGGCCACAGACCACCTCTTCCTGGCACTT
CCCCTGCCGCTGGCACCGCTGAGGGCGTGGGTGTAGCCTCAGTCAGCAGGAAGAGGCGCC
TGGCCCCCGGTCCCCCGGTGGCGTGGCCACTGGAGATCAGGAGGGGCTGCTGCTTCTGCC
CTCTAGCCCGTGTCCCAGCGGCGCCAGCCTTCGAGTGGTGTAGGCGCTTTACGTGGTTCA
GGTCCAGCAGTGGTCGGCGCGTTTCCGTCGGGCGCGGTTCGCGTGGCACGGCGTGCGGGG
ACAGCGGGCGCCCACGGTCGGGCGGAGGGTGAACCTGCTGGAGTGTCGTGTTCCGGTGTT
CAGAGGCAGGGGCTGTGAGAGAGGGAGCCTGCGGCCTATTTCAGCAGGCCGAAAGGGCAG
AGGTGAGCCGCCGGGCGAGTCGAGGTCAAAGCCGCCAGCGCGAGCTCTTGGTCTCGCGGC
AGGGCCTGAGGCCAGGGATGTGTGCGGAAGACGTGCTTCTTCAGGGGCTCGGGCCCCGCG
CACCCGAAGACACGCACACGCGCCCGCCTGCGCGCCTTCCTGCGCTTGTGCTGTCACACA
CGCCTTCTTGTCACACCTGAGGGGAAGAGGTAGAGGCCAAGAAGATGCAAGGCTTGCCCC
GGGGCGGGGAGTCGGGGTGGAACCCTTGGCCTGGCTCTGGTTACCTGAGAGCCTGGCTGG
GTCGCTGAGGCGTGCGCGTGCGATTGCTCTGCACTTCCCAGGTGGGATCTCCGAGCAAAG
CTTGCCGTCGCCCAAGAAGAGAAGACCTTCCTGTCGTTTGTGGAGCGGAGACGCGAGGGA
ATCCCGCAAGAAGCGTGGCTTCGGGTGCGCCCCGTGCCCGTGGCTCGCTGAGGCTGGTAA
GGATCCCCCTGCACCCAGTTCGTGCCGTTGGCCCTGGGAGTCCCAGACCGCGCTGAGAGG
CTTCTAGCCCGCGGGTCCCCGGGGGCGTGCGGAGCTGGCGCTCTGAGGGTGGGTCGACAG
TTGCCCTTGCTCAGGGGCTTGGCTCGGGATTCTCCGGGCCGCTGGCCGACCCTGAGGTGA
TGGGCTCACCCGCCGAGCCCCGCCAGCTGCCCCGAAGGTGCTCGGATCGATGATGACTCC
CTCAAATGCATTCCTTGGAAATCTGAACAAAATGAGTGAGAACTCACTACCGTCGTTCTC
GCCGAGACTGAGGTCCAGCACCTGGTCTTCTCCGGGGGTGAGAGGAGTGAGGGACAGCTT
CTGGTTGATGACACTCGCGCAGAGCCCGCCCAGGGCCTCAGCGTGTGGGCGTCTGCCGTG
TTTGCACCGGGAGCGTGACCGCATGAGCTGGACGTTTGCGACTCGGAGGGACTTGCTTGA
ATGGCCGGCCTCTGCTGGCGCGGCGCCCGGGTCGCATGGGCGTCTTTAGAGTCGGAGAGT
GTGGCGTTGGCATGGGCCCGGCCCGTGGTTGGCGCTGAGTACGCGCTGGCCCGGTTCTGG
CCTGAGCCGTTGCCCCGGGGGGCGTGGCGGGTGGGGTGGCGGTCCGTGTCTGGAGGCCGA
ACAGCCGAGTCTTCCCTGGGTTCCGTTCGGAGCCTCGGTTTGGGCCGGGCAAGCCGCAGC
GCCTGTGGTTGCCTTCTGGCTTGGTGAGGAGGTGTGATGGGCCCGTGGTTTTGGCGGCGT
GGGCAGCGGCCCTAGGCCGCAGCGCTGCAGCTGGCAGCTCCTGTGTGTCACCTGCTCACC
CGGGCCACACACAGCTGGCCAAAGGTGGCCCTGGCGCTGACGTCCAGGCAGTGTGGTGGC
TGACAGGGCGGGCAGGAAGGAAAGGGAGCGGAGGGGAGCGGCCGTAGTGCGGTTCCACGG
GCTTGCACAGGATGTACCCTCTTGTTGGGTTGTGACCGCCGTCGCGGTCTTGCCAGGGGT
GGCGTTGGGTCCCAAGGGGGCTGCCGGTTGTTGCCTGCCAGGGAAGGCTCGGCTGCGGTA
GATGACCTGTGCGGTAGACGGCGTCGCGCCCCCGGGAGGTTCGGCCCCCAGTGTTTGTCG
TCCTAGCGCCTTGAAGAGACCCACAGGCCCGCGACTGGCCACCGGCCCCGTCTGCTCCGG
ATTGCTGAGGCGGACAATCTCTTTGACCCTGCGCCCCCTCGGGTCCGGCGCTTGCCAGGT
GAAGGCGTTGCTGCAGGAAGGTTCGCTCTTCCTGGCCCGGGGGGCTCCTGTGGTCCCGGG
CGTGCCGGGGAGCGGGGCCAGGTGGCGGTGTGGGGCGTCGGGGGGGGGGTGTGGGGGCGT
GCGCGAGGGGTGGTTAAGAGCGGTGTGCGGAAGCCTGCGGGCGTGGCAGCGACCCGAGGG
TGCTGCGATCCTGGGCGCCCTGCCCCGGACGCACGTCCAGCGTGGAGGAGGAGCACGTCT
CCTTGTGTGGGAGCGGTGTCCTAGTTTCATTCTTTGCCTTGTCTTCCAGGAGGAGGCAGC
GTTTGTGCTCTGTGAGGTCGTCTGTGGTGTTCTGGGGCCGAAGGAGGGGGTCATAGGTCG
AGTGCGACGCGGTCGACTTAGGCAAAGTCATAATGCCTTGACGGCTGTCGTCCGGGAGGC
TCCCTGCCCGCCTGGCGCGCGAGGTGTTGGAGGCTACACCTTGGGGGACTTGCTGTGCAG
GCGTGAGGGGGCTTCCCCTTTGGAGCAGGGAGCCGCGGGGTTGAACGTTTCCTCGAAGGC
CAGCGCCCCGCAACCCGCAGGCGGTGGAAATGCCGCGTCGCTGCGTGGGAATTGGCTGTG
GTCTGAGACGGGTCTTGCCCCGGGTCTCTTGGCTGTGACCAGCCGTTGCAGCGGGGTTCC
CTGCTGGCCCGCCCAGGGCGTCTTGGCTTAGATAGCCCAGACCGGAGTGCGGCCTGAAGG
CGTCGGGCCCCTGGAGGTTCAGACGGGCTGCTTCTGTTGCGCCGCCCGTGGGCGAGTGGT
GCCGGCTCTCGTGTCAGCCCTGTTGTCCTGGCGGTAGCCAGGTAGCATTACCATCAAGTG
CCGTTCCCCCCGGCCCAGCTCGCGGGGACACGCTGGCCACGTTGACCTCACATCCACGGT
CAGCGTGAGGGTGTAGGTGGATGGTCCGTGTCCTTTGCTCAGAAGGAGTGGCGCTCAGAG
AGGGAGTCCGGGGCCGATTGCAGCAGCCTCTAGCGGTGCGAGTTGGCGTCCTTCCTTGGG
AAGTCACCGGGCTTCCGCGTGGGGTGGCAGGGCACGAGGTCAGGCATCTGTGAGGACGGC
GTGCTTTCCCGGGTGCTGAGGCCACCGCCCACGGAAGCCCGCAGGCACGCACGCGCGCGC
GCGCAAACACACACACACACACACACACACACACGTGCACAGGCCTGCGCATCTGCCTAC
ACTCGGGATATCACACGCGCCTTCGGTCATCCCGAAGGGATAGAGGTACAGGGCAAGCAG
ATGCAAGGGTGCCGCGGGGGGAACTGTGGCACGGATCCTGTCTTCTGACCAGCTGGGCAC
GTTTCTGAAGCATGCGTGTGCTTTCTCTACACTCCTCAGGTGGAAGTGCCGTGCAAAGCT
CGCTGCCGCCCACCGACAGAAGAAGACCCTTCGTGTCCCGTGACGAGCGCAGGTGCGAGG
CAGTCGCGGCGGAAGTGTGGCCCGGGATGCGCACCACGCCCTCGGACGGCCCAGGACGGT
CAGCATTGCTTTGTCCCAAGTTCGGCCTCTCGCCCTGAGGGCTTCGCTAGACCTGCCTCA
GAGGCTTCTTGGGCGCGTGTGCCCGGGGGCCCGCGGCGTCGTGCTCTGAGGGCGGACTGA
CTGTTGCCCCTGCTCCGGCGGGGCTCGGCTCTGGATTCTCCAGGCCGCTGGCGCCCATGA
GGCGATCGGCTCGCCCGCTGCGGAGCCCCCCAGCCTGCCTGGTTAGTTTGTCCAGGTTGG
CAGAACGTGCTCGGATCGATGATGACTCCCTCATATGCATTCCTTGGAAAATCTGAACAA
AATGAGTGAGAACTCACTACCGTCGTTCTCATCGAAACTGAGGTCCGGCACGTTGTCTTC
CCCAGGCATGGCAGGAGTGAGGGACCGCTTCCCCTTGAGCGCACTGGGACGGGCACGGGC
ACCACGCCGGGCGTCCGCATTTGGGAGCCGTGGCATCTGGGGGTCCTTCCTCTCACCGCG
TGAGGGGGGTGTCCGTCAGTCGGCGGTGCTTGGTTGAACGGCCTGTGGCTGAGGGCCGTG
GCTGGCAGCTCGCATCCTAGGTTGGGAAGTCGGAGAGTGTGGCGCTGGCACAGGCCCCGT
GAGCTCAGGGCCTTGTGGCTGTGTGGGCCTGGTTCCCGCCGGGGACGAAGGCCCCGGGGG
TCTGCGTCTCGGAGCTGAGCAGTAAGCAGTGGAAGGTCGCGTGGTTTCTGATGAGAGCCC
CGGGCCAGGCGGGCGGCCGTCAGCTGTTCTTGCCTTTTGGCTTGGTGAGGCAGTTGGAGC
ACCCCTCGCGGTTTGGGGCGCCGCCGGAGGGGTGAGACTTTGGTGCTGCAGCTTGGGGCT
CCTCTAGTTCTCCGGCTCGCCCAGTCCACGCCAAGGTGCCCAAACGGGGACCGGGCTGTG
GGCCTGGCACTCAGGTCAAGACACTGTGGTGGCTGATGGCCTGGTCGTGGGGAGCTGGGG
GGGAAGAAGAGCACGGAGAGGACAGGTCACAGTGTGATGCCGTGGGCTTCCGTGGGACGT
GCTGCCTCGTTGTGTTCCGAGCGCTGGCAGCGGCTTGTCGGGAACGTGCCCTGGCTCTGA
CGGGGCTGGCGATTGGTGCGTGCCGGGGAAGGCTGGAGGCTTGAAGGCCCGGGGGTGTGC
ACTGTGGTCGGTGACCTTTGTGGCAGATGGCGGGCCTTGTTCCAGAGCGGTGGCGCTCTG
CGGTTCTCTCCACGGTTCCTTGAAGAGGGGCCCGGCACGTGACTGCCGGGCGGCCGGCCG
CCGCTGCTCATCGATTGCTTGGGCGACCGTGGCCTTGGATCCTCCGCCGTCTCAGGCGCG
GGGTCTCCGAGGAGAAAGCGTTCCTCCAGCACGGTCCGATTTTCCTGGCGCGGTTCGCCT
CATGCCTCGTCGCAGGGCTTTAGGTTTCTTCGTGGAAGCCTGTGGGCCTGGCGGAGACGG
CGGGTGCCGTGACCCGAGCTGCCCTGCCGCGCACAGACGTCCGCCTTGGAAAACGTCCGC
CTCTCCAAGGGTGGCGGGGGCGGGGTGTGTGTGTGCTCGTTCCGTGCCTCCTCTTGCCTT
CGTGGACAGGGCCATCCTTGGGGCCGTGTGAGGTCGTTTGTGGTGTTACAGGTGCCGAGG
GAGGGTCCAGACGTTGAACGTGACGGGTCGAGTCCCGTACGCACAGTCGAGATTCCCTCG
TGGCCGTCCTCCCCGGGGCTCCCTGGCGCCACGTGTGTGTAGGGTTTGAGGTCCTGCTTG
GGAGACTTGCCTCGCAGGCCTGAGGTGGGCCAGGCAGCGCGTGGGTGGGAAGGAGTCCTG
GAAGGCCGGGGTCCAGAAAGCGGGCCCGCTGTGGTAACGCCAGGTCCCTGGACGGGAGTG
GGCTCCAGGTTCAGTCGGGTCTTAGCGTGGGTCGTGGTGGCCACAGACCACCTCTTCCTG
GCACTTCCCCTGCCGCTGGCACCGCTGAGGGCGTGGGTGTAGCCTCAGTCAGCAGGAAGA
GGCGCCTGGCCCCCGGTCCCCCGGTGGCGTGGCCACTGGAGATCAGGAGGGGCTGCTGCT
TCTGCCCTCTAGCCCGTGTCCCAGCGGCGCCAGCCTTCGAGTGGTGTAGGCGCTTTACGT
GGTTCAGGTCCAGCAGTGGTCGGCGCGTTTCCGTCGGGCGCGGTTCGCGTGGCACGGCGT
GCGGGGACAGCGGGCGCCCACGGTCGGGCGGAGGGTGAACCTGCTGGAGTGTCGTGTTCC
GGTGTTCAGAGGCAGGGGCTGTGAGAGAGGGAGCCTGTGGCCTATTTCAGCAGGCCGAAA
GGGCAGAGGTGAGCCGCCGGGCGAGTCGAGGTCAAAGCCGCCAGCGCGAGCTCCTGGTCT
CGCGGCAGGGCCTGAGGCCAGTGATGTGTGCGGAAGACGTGCTTCTTCAGGGTCTCGGGC
CCCGCGCACCCGAAGACACGCACACGCGCCCGCCTGCGCGCCTTCCTGCGCTTGTGCTGT
CACACACGCCTTCTTGTCACACCTGAGGGGAAGAGGTAGAGGCCAAGAAGATGCAAGGCT
TGCCCCGGGGCAGGGAGTCGGGGTGGAACCCTTGGCCTGGCTCTGGTTACCTGAGAGCCT
GGCTGGGTCGCTGAGGCGTGCGCGTGCGATTGCTCTGCACTTCCCAGGTGGGATCTCCGA
GCAAAGCTTGCCGTCGCCCAAGAAGAGAAGACCTTCCTGTCGTTTGTGGAGCGGAGACGC
GAGGGAATCCCGCAAGAAGCGTGGCTTCGGGTGCGCCCCGTGCCCGTGGGTCGCTGAGGC
TGGTAAGGATCCCCCTGCACCCAGTTCGTGCCGTTGGCCCTGGGAGTCCCAGACCGCGCT
GAGAGGCTTCTAGCCCGCGGGTCCCCGGGGGCGTGCGGAGCTGGCGCTCTGAGGGTGGGT
CGACAGTTGCCCTTGCTCAGGGGCTTGGCTCGGGATTCTCCGGGCCGCTGGCCGACCCTG
AGGTGATGGGCTCACCCGCCGAGCCCCGCCAGCTGCCCCGAAGGTGCTCGGATCGATGAT
GACTCCCTCAAATGCATTCCTTGGAAATCTGAACAAAATGAGTGAGAACTCACTACCGTC
GTTCTCGCCGAGACTGAGGTCCAGCACCTGGTCTTCTCCGGGGGTGAGAGGAGTGAGGGA
CAGCTTCTGGTTGATGACACTCGCGCAGAGCCCGCCCAGGGCCTCAGCGTGTGGGCGTCT
GCCGTGTTTGCACCGGGAGCGTGACCGCATGAGCTGGACGTTTGCGACTCGGAGGGACTT
GCTTGAATGGCCGGCCTCTGCTGGCGCGGCGCCCGGGTCGCATGGGCGTCTTTAGAGTCG
GAGAGTGTGGCGTTGGCATGGGCCCGGCCCGTGGTTGGCGCTGAGTACGCGCTGGCCCGG
TTCTGGCCTGAGCCGTTGCCCCGGGGGGCGTGGCGGGTGGGGTGGCGGTCCGTGTCTGGA
GGCCGAACAGCCGAGTCTTCCCTGGGTTCCGTTCGGAGCCTCGGTTTGGGCCGGGCAAGC
CGCAGCGCCTGTGGTTGCCTTCTGGCTTGGTGAGGAGGTGTGATGGGCCCGTGGTTTTGG
CGGCGGGGGCAGCGGCCCTAGGCCGCAGCGCTGCAGCTGGCAGCTCCTGTGTGTCACCTG
CTCACCCGGGCCACACACAGCTGGCCAAAGGTGGCCCTGGCGCTGACGTCCAGGCAGTGT
GGTGGCTGACAGGACGGGCAGGAAGGAAAGGGAGCGGAGGGGAGCGGCCGTAGTGCGGTT
CCACGGGCTTGCACAGGATGTACCCTCTTGTTGGGTTGCGACCGCCGTCGCGGTCTTGCC
AGGGGTGGCGTTGGGTCCCAAGGGGGCTGCCGGTTGTTGCCTGCCAGGGAAGGCTCGGCT
GCGGTAGATGACCTGTGCGGTAGACGGCGTCGCGCCCCCGGGAGGTTCGGCCCCCAGTGT
TTGTTGTCCTAGCGCCTTGAAGAGACCCACAGGCCCGCGACTGGCCACCGGCCCCGTCTG
CTCCGGATTGCTGAGGCGGACAATCTCTTTGACCCTGCGCCCCCTCGGGTCCGGCGCTTG
CCAGGTGAAGGCGTTGCTGCAGGAAGGTTCGCTCTTCCTGGCCCGGGGGGCTCCTGTGGT
CCCGGGCGTGCCGGGGAGCGGGGCCAGGTGGCGGTGTGGGGCGTCGGGGGGGGGGTGTGG
GGGCGTGCGCGAGGGGTGGTTAAGAGCGGTGTGCGGAAGCTTGCGGGCGTGGCAGCGACC
CGAGGGTGCTGCGATCCTGGGCGCCCTGCCCCGGACGCACGTCCAGCGTGGAGGAGGAGC
ACGTCTCCTTGTGTGGGAGCGGTGTCCTAGTTTCATTCTTTGCCTTGTCTTCCAGGAGGA
GGCAGCGTTTGTGCTCTGTGAGGTCGTCTGTGGTGTTCTGGGGCCGAAGGAGGGGGTCAT
AGGTCGAGTGCGACGCGGTCGACTTAGGCAAAGTCATAATGCCTTGACGGCTGTCGTCCG
GGAGGCTCCCTGCCCGCCTGGCGCGCGAGGTGTTGGAGGCTACACCTTGGGGGACTTGCT
GTGCAGGCGTGAGGGGGCTTCCCCTTTGGAGCAGGGAGCCGCGGGGTTGAACGTTTCCTC
GAAGGCCAGCGCCCCGCAACCCGCAGGCGGTGGAAATGCCGCGTCGCTGCGTGGGAATTG
GCTGTGGTCTGAGACGGGTCTTGCCCCAGGTCTCGGTGGCTGTGACCAGCCGTTGCAGCG
GGGTTCCCTGCTGGCCCGCCCAGGGCGTCTTGGCTTAGATAGCCCAGACCGGAGTGCGGC
CTGAAGGCGTCGGGCCCCTGGAGGTTCAGACGGGCTGCTTCTGTTGCGCCGCCCGTGGGC
GAGTGGTGCCGGCTCTCGTGTCAGCCCTGTTGTCCTGGCGGTAGCCAGGTAGCATTACCA
TCAAGTGCCGTTCCCCCCGGCCCAGCTCGCGGGGACACGCTGGCCACGTTGACCTCACAT
CCACGGTCAGCGTGAGGGTGTAGGTGGATGGTCCGTGTCCTTTGCTCAGAAGGAGTGGCG
CTCAGAGAGGGAGTCCGGGGCCGATTGCAGCAGCCTCTAGCGGTGCGAGTTGGCGTCCTT
CCTTGGGAAGTCACCGGGCTTCCGCGTGGGGTGGCAGGGCACGAGGTCAGGCATCTGTGA
GGACGGCGTGCTTTCCCGGGTGCTGAGGCCACCGCCCACGGAAGCCCGCAGGCACGCACG
CGCGCGCGCGCAAACACACACACACACACACACACACGTGCACAGGCCTGCGCATCTGCC
TACACTCGGGATATCACACGCGCCTTCGGTCATCCCGAAGGGATAGAGGTACAGGGCAAG
CAGATGCAAGGGTGCCGCGGGGGGAACTGTGGCACGGATCCTGTCTTCTGACCAGCTGGG
CACGTTTCTGAAGCATGCGTGTGCTTTCTCTACACTCCTCAGGTGGAAGTGCCGTGCAAA
GCTCGCTGCCGCCCACCGACAGAAGAAGACCCTTCGTGTCCCGTGACGAGCGCAGGTGCG
AGGCAGTCGCGGCGGAAGTGTGGCCCGGGATGCGCACCACGCCCTCGGACGGCCCAGGAC
GGTCAGCATTGCTTTGTCCCAAGTTCGGCCTCTCGCCCTGAGGGCTTCGCTAGACCTGCC
TCAGAGGCTTCTTGGGCGCGTGTGCCCGGGGGCCCGCGGCGTCGTGCTCTGAGGGCGGAC
TGACTGTTGCCCCTGCTCCGGCGGGGCTCGGCTCTGGATTCTCCAGGCCGCTGGCGCCCA
TGAGGCGATCGGCTCGCCCGCTGCGGAGCCCCCCAGCCTGCCTGGTTAGTTTGTCCAGGT
TGGCAGAACGTGCTCGGATCGATGATGACTCCCTCATATGCATTCCTTGGAAAATCTGAA
CAAAATGAGTGAGAACTCACTACCGTCGTTCTCATCGAAACTGAGGTCCGGCACGTTGTC
TTCCCCAGGCATGGCAGGAGTGAGGGACCGCTTCCCCTTGAGCGCACTGGGACGGGCACG
GGCACCACGCCGGGCGTCCGCATTTGGGAGCCGTGGCATCTGGGGGTCCTTCCTCTCACC
GTGTGAGGGGGGTGTCCGTCAGTCGGCGGTGCTTGGTTGAACGGCCTGTGGCTGAGGGCC
GTGGCTGGCAGCTCGCATCCTAGGTTGGGAAGTCGGAGAGTGTGGCGCTGGCACAGGCCC
CGTGAGCTCAGGGCCTTGTGGCTGTGTGGGCCTGGTTCCCGCCGGGGACGAAGGCCCCGG
TGGTCTGCGTCTCGGAGCTGAGCAGTAAGCAGTGGAAGGTCGCGTGGTTTCTGATGAGAG
CCCCGGGCCAGGCGGGCGGCCGTCAGCTGTTCTTGCCTTTTGGCTTGGTGAGGCAGTTGG
AGCACCCCTCGCGGTTTGGGGCGCCGCCGGAGGGGTGAGACTTTGGTGCTGCAGCTTGGG
GCTCCTCTAGTTCTCCGGCTCGCCCAGTCCACGCCAAGGTGCCCAAACGGGGACCGGGCT
GTGGGCCTGGCACTCAGGTCAAGACACTGTGGTGGCTGATGGCCTGGTCGTGGGGAGCTG
CGGGGGAAGAAGAGCACGGAGAGGACAGGTCACAGTGTGATGCCGTGGGCTTCCGTGGGA
CGTGCTGCCTCGTTGTGTTCCGAGCGCTGGCAGCGGCTTGTCGGCAACGTGCCCTGGCTC
TGACGGGGCTGGCGATTGGTGCGTGCCGGGGAAGGCTGGAGGCTTGAAGGCCCGGGGGTG
TGCACTGTGGTCGGTGACCTTTGTGGCAGATGGCGGGCCTTGTTCCAGAGCGGTGGCGCT
CTGCGGTTCTCTCCACGGTTCCTTGAAGAGGGGCCCGGCACGTGACTGCCGGCCGGCCGG
CCGCCGCTGCTCATCGATTGCTTGGGCGACCGTGGCCTTGGATCCTCCGCCGTCTCAGGC
GCGGGGTCTCCGAGGAGAAAGCGTTCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved