Equus_caballus Locus Mono:33:SNORA13
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:33:SNORA13
Equus_caballus
Mono:33:SNORA13
14
SNORA13
1001..1133
2133
ACCTCCTTCTCCGCCACAAGAACTGTCACACAACGCAGAGAGGACTCCAGGGGCGCGGC
GAACCCTCGCCCCTCACTCCTCTTCCCCTTGGAGACGCGCCGCGCGGCCAATCACCGGGC
ACTTCGCCCTCCCGCCACACGGCGGCGCTCGCGAGGGCGCGGCGGCCGATGGTACCGTCC
GCTCTCCCCGCGCCCTCCGCACAGTGGGTCCTTCCAGTTGTAGAAAAGCATTGTGGGAGG
GCAGTGCGGCCTCTCCTGCCTCTCGCGCACCGGTCGGGACGTGCTGTGCGCGTGGTTCAA
GGATGGCGAGTGTTTTGTGGGCTCGCTGGGCCTCCCGACGGCCAGGACGCCGGGCAGGGA
CTCGCGCCGTCCGAGCCTGGGGACGCGCCCGCGGCGGCCCTGCTGGCCCGAGGTTCTGGG
CCCTGAACACGTTGGGGACAGCGGCCGGGTGTGGCCGCGGCCACGTTGTCCGGGGAACCT
CAGCGGGCCCCGGAGCGGCCCCCCGTCTGCGCTCCTGCATCCCCACGCCGGGAAGTAGGG
AGATGGGTTTGAATGCGTTTAAGTTTGTTGGTCACCCCCTGTATGCCGGGGAGTTTTTAA
TAGAAGCGGGGATTTCGCTCGTGTGCAAGGGAAAGGCCTCACCGTCCGACTGCCTGCGTG
CCCGCCCTGCCGCGGTGTGACGTCCGTCGGCGGACAAGGAAAGTGCCTTTCAGGTTTAGA
TCTTGACAGCCGTTTCGAGGCGCAGAACTTGGCAGAAATCGAATGAGTATCACCAACTTT
GCAGGTGAGTTTTCATGCTAGTGCAAGAAAGACAAGTCGTCTCCAAGTTTTAAGATTTTA
ACTTTTTAAGACGCTTTGTATTTCAATTTTCATTCCTTAGTCGGATTTTGAACCTTAAAT
GAATATCTCGAGCTGGGATGAGTTCATTATTCCTCTCAGCCGGTTGAGGGAGGGTCAGCA
GCTTTGTGCCACATGCAGCCGTCCGCAGCCTGTTTTCATGTAGCCTTTGTGTTGCCCATT
CACTTTTGAAACTAGTGAATGTGGTGTCAAAAAAGGCGCAAACTAAACACTTGGCAGCTT
TTTCCTGCCCTTGAATTTGATATCTTTGGTGTAGAAGCTGCATAAGTAACAGTTTATGGT
CTTATATTAGTGTGTTTACACAAGTGATCCTGAGTCAACCAACGTTTGTAGTTTCTCTAA
ACCGGTTTTAATTAATTTTTGTTAAGGTGAAAGATGGCTGCTGGAAGCATAGACCGCTAC
TTGCCAAGTAGTGTCTGGGAGCACAACGGTGACTGACCTAAGGTAGGTGATATTGAAGGA
GAAGTTTAGTCACAAAGCAGTTATTTGTAATGGGTGTTTTATCACCTTTCTAGATTGGGT
GCCTTCTCTAGTGGGTATTTAATTTAAATTGGGTATTAATGGTTCATTAATATTAGTATT
GCTACATCTGTAGCTAACAGGGTGACTTTAACTGCAAATGGGATAGCCTTACTCAGCTTA
CTTTTGAAATCTTGATACGTTTCTATGTGTAGTAGCTAAATTTTTTTTTTTTTTTGAAAA
TCCAAATCTCTGGCATGTTTTATGTTGACATTTAAGGCCAAGTCCAGAAATGCATAACTT
AATGTGATGCAGAAGTGTGTACTGAGCTTACTACCAAGATCTTAAGATGTGATACAGGTA
AATATTTGCTTGTCAAATTGAATGCTTTATTTTTTCTTTTAGGATGTCTTCGGTGAGGAA
TTTGAAAATTTGATCTTCACAGGAGTTGCTTGGATCATTTAAAGTTTCCAGGAGCCTGAG
GTGTATTGAAATTATTGCCCTTGGACAGTCCATAAATATACATTTTAAATGGTGGGGCTA
TGAATAAATAATTCAATGTGCTTCTTGGAGGTTTGTGTATTAAGTGATTAACTCCCAGAA
AATAGCATTATTTCACTGAAAGATCAAAGGAAGGGTTTCTCTCTCCTCCTCCAGCAACGT
CAAAATTGTTAAATCTCAGCCATTAAGGTTAATATGATTAATAAGATGATGAACTACAGG
CTTATGCTAGGCCCAAGGAGAAGTACCTCATACATGAAGAACTGGGCTGGTTGGTTTCTA
GGTCACAGGTGTGCTTGACAGTGTCACTGCAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved