Equus_caballus Locus Mono:60:SNORA2
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:60:SNORA2
Equus_caballus
Mono:60:SNORA2
20
SNORA2
1001..1127
2127
TCATTTTTACCTCCCTAATTTCAAATTTCACCCTCTGCAAGCATTTCCTCTGAAAGATA
AAAATTTCCATGTGTACAGCATTCAGTCTGAGGGTAAATGTTTTGGAAAGGCTTGAAGAA
CACTCCCTCAAGTCAAGTAAAAGTTGTTTCACTCTTATTAAGTTTCACAATGTTTAAATT
TGAAGACTTCAGCCTGAAAAATGCCAGGAACTCCTTTGGAGACACAACTGTGCTTTTTAT
TTATTTTCTTTCTTTCTTTCTTTTCTTTGAGGAAGATTAGCCCTGAGCTAATATCTGCTA
CCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCGTGCCCGTCTTC
CTCTACTTTATACGTGGGACACCTACCACAGCATGGCTTGACAAGCAGTGCCATGTCCAC
CCCCGGGATCTGAACCAGTGACCCCTGGGCTGCTGAAGCAGAACAGGTGAACTTAACCGC
TGGGCCACCAGGCCAGCCCCAACAATGATGCTTTTAAAAAAAATTGTAATAAAATGCACA
TAACATAAAATCAAACATTTTAACCATTTTTAAGTGTAACATCCAATGGCATTAAGTACA
TTCACATTGTTCTGCAACCACCATCACCATCCTTCTCCAAACTTTTTCCATCCTGCAAAA
TTAGAACTCTGTCCCCATTAAACACTAACTCCCCAGCCCTCCCTCCCCCGGCCCCTGACA
GCGCTATTCTACTTCCCGTCTCTATGAATTTGGCTACTCTAGGAAGCTCATATCAGTGGA
ATTATCTGGTATTTGTCCTTTGGTGACTGGCTTGTTTCACTTAGCATAACGTCCTCAAGT
TCATCTATGTTGTAGCACGGTGAGAATTTCCCTCCTTTTTAGGGCTGAATATTATTTCAT
TGCGTGTACGCACCACATTTTGTTTATCCATTCATCCATCAGTGGATACTTGGGATGCTT
CCACCTTTTGGCCATTGTGCTTTTCTAGAAAGAAAATTTCGTAGGCCCTGAATCAAGACC
AGCAGTTTGCTGTGGCTGTTGGTTTCAAGCAGGAGCCGAGAGCAATGTCCTTCTGTGGTC
TGTCGGCCATTCAGCACCCCGGGACCCAGTCAATTGGAAGAAACATAGTCTATAGAATAT
AATGTCCTTTTTTTCTTTTACGGAGCAGTTGGACTAGGTTAGGTTTAAGAATCAGGGGCT
TACTCTGTGGGGCCAGGGACTTAACCAAAATAGTATTTCTTAGCCATTCAGAGGGACTTG
GAGTTTTTGGCCTTTCTCTGCCTCTCTTGCTCACGGGCTTGCTTTATGGTTGTTAGGACA
TTAACCAAGCAATCCCGTATCGTCCAGTCTTTTAAGGCGCTATTCCATTTTAATTTGTTA
GTATGCTGAGTGTCCACATTAGACTCACCACTGCTGAGCTTAGCTGTTGACTGCAGCTCA
TCTTAGAGGGAAGATGCTCTTTTTTTGATAAATATTTTTTTATTGCGGTAAAATATTTGT
AACAAAATTTACCATTATAACCATTTTTAAATACACAATTCAGGGGTATTAAGTACGTTC
ATAATATCGTGCCACCATCAGCACTGTCCATTTCTAGAACTTTTCCATCAGCCCGAACAG
AGACTCTGTCCCCATTAGACTGTAACTCCCCTCCCCTCTCCCTTCAGCCCCTGGGAGCCA
CCATTATACTTTCCGTCCCTGAGTTTTCCTATTTAAAACATATACTTTTGGGGGGCCAGC
TCCATGGCTAATTGGTTAAGTTCACGTGCTCCGCTTCAGTGGCCCAGGGTTCACCAGGCT
GGATCCTGGGCACAGACCTACACACCGCTCATCAAGCCACGCTGAGGCAGCATCCCACAT
AGCAGAACTAGAAGGACTTACAGCTAGGATACACAATTATGTGCTGGGGATTTGGAGAGA
AAAAAAAGAGGAAGATTGGCAACAGATGTTGGCTCAGGGCCAATCTTCCTCACCACCACC
TCTCCAAAAAATATACATACTTTTTTAAGCTACGCGAAATGAAAAAGAAAATTTCGTTTT
GGATCTATAGACTGATTAGACAAATGCCTCACACTGATTTACTTAATGCTCTGGGCCTCT
GTTTCCTAATCCATAAAGTAAGGATGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved