Equus_caballus Locus Poly:7:SNORA73
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:7:SNORA73
Equus_caballus
Poly:7:SNORA73
2
SNORA73, SNORA73
1001..1204, 1795..1998
2998
TAATTTACATTCAACAGCAAAGTCCCGCGCGAAGGGTCTAGTGTCGCGAGAGGACTCTG
AGCCAGGTAGGGGTGGGGCTTAACCTGAAGTAGATTCCCAGCACCCTTAGCGAATTTCTA
ACTCCCTAACTGCGCATGGCACGGCGCAGGCGCAATGGTCATTTCTTGACTTCCGCGCGC
TTCAGTAGCTATAAATACGGATGCCGGGGGACCAGTCGGTCTTTTGGGAGAGGGCTAACG
CTGCACTGTGGGCTTGTTTGGTGAGTGTTTCTACCCGGGTGGTTCGTCTGCACTTGATCT
GCTATCCTGGGTCCGCCGACCAGACTTCCCGTGGGCGTCTTACAACTTGCAAGGATTCGC
TTCAGCGGCGTCCTGCAAACTAACTTTCCCCTGCAATGGGGGTGGGCCGGATGTGGGCCG
CCGAGGCCGCGCGAGCCGCGGGGCTGGGCCGTCCCCGAGGGCTGCTAGCGCGGGAACGCG
GAGGCCTGCAGGGCTGCTACTGCGTGCCGACAGCTAAACGCTCAGCCCCCTTCTCGCTAT
TCCCTGTTGCGCCGTTTGTTAACCTTAGTCCTAGGAGGCGCGTTGGCCGCCTCAGTGCAG
TGTCCGCAGGACATTCCTGACGCCCATGCGAGTTTCAGAGTTCTGATTTCGAAACGGACG
GTTCTTGATGCTGTTGCCACTTGTTTTAACGATTTGGGGTAACCCCGACCCCAGATGGTC
GGTTAAAAAATGCATGAGCTATAATTGCCGTCTCAACGGTTCTGCATTTACCGTTTCTTT
GGCAGCGTGCTAATGGCTTGTTGGGCTTTCTGGATATGTTTGGGGTACCTGGCTGAAAGT
TAATTCAGATTACTGATGTGTGGCTGCTGGTTGGCCTTGAACTTGACTTTCGTTGACACT
TCGGGAGTTTAGGATCCATCTCTACATGGATGTCCCTGGGAAGTCGCTATCAGCTGGATG
AAATTAATTCCTAGCACGGTAGTCTAAGTAAAATGTTGTAACCAACGTGGATACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCGTAGGGGAGCATAGGGCTCCGCCCCGTG
ATGTACAGTCCTTTTCCACAACGTTGGAGATGAAGCCGGGCCTTGAGTCTGCGCCTGCAT
ATTCCTACAGCTTCTCAGAGTCCTGTGGACCATGACTGAGGAGACAAACCATGCAGGAAA
CAGCTCTAGAGCACCGCACCTGGATCTAAGTAGATCCGGAGTGAAAGAAAAATTTGCTTT
GATCGGTTCTACGGTACTGCTGGATTAAGCTTTTACCTACCTTGTTTTGCAGTGTTTGCT
CAAGATTCCAAATGATTTGAGGTGAGTAAAACTACGGGTTGCTTTTGGCTCATCAGTGTT
TGCCTGTCAGTATTTTGCGTAAAACATTTAACCATTCTGAGTTTAGTTCCTTTCGCGAAC
ATGATGCTACTGTTCGATACATTGTTACATCTTTAATTCTCGTGTGATGAGGAAGATTTC
TACTTTGCAAATGAAAAAACTGACCGTTTCGGTGTCATAGCCAAGGTCAGGTAGCACAAC
TTGCGCATGAGCCATATAACGTGTGTCTCCTCCATGTGTGTAAAGAAGGTAAGAGTTCAG
TATCATGGACAATCCTTTCCACCATAGAGGAGATCAAGTTGCGCATATGCATATTCCTAC
AATGAATAACGGGTTCAGTAGATGAACCATGAAATAGTCTCAGATCTACATGTGTAGTAT
GGGATGAAATCTCTTAAATGTTTTGAGGGGTAATAATGCTGTTTAATCAGGCGTTCCAAC
GTGGATACCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCGTAGGGGAGCATAG
GGCTCCGCCCCGTGATGTACAGTCCTTTTCCACAACGTTGGAGATGAAGCCGGGCCTTGA
GTCTGCGCCTGCATATTCCTACAGCTTCTCAGAGTCCTGTGGACCATGACTGAGGAGACA
AACCATGCAGGAAACATCTACTATACAATTTGCAGTTTAAGTAAGATGGTAAATATGAGT
CTAATCCTCTTTTTTTTTTTTTTTTTTCCATTTTCATTCAGGAGAGAAGAACCTCACCAC
CAAACTTTGGCAGAGAGACTTGGTAAAGTGATTAATATACTATTTTTGGAAGATAAGGTG
GACAATATGAAAATCTTATAATCTTGGATGCATTTGACTCCTTTTAAAAACTGCCCTTTA
GATTAAATCAAAGGGGAACGGGAGGTTAAAAGTGCAAATTCTAATGTGTAGCCCTAAAAC
CAAACCTTCAGAACTGGTAGAGTAATAGTATGTTCCATTGGCCAGGTGCCCACAAAAATT
TATGAAGAGTTCCAGAAGACACTGAGTATGGGCAGATCTGTTATGACTATGGTCCTTTGG
CCTAGGAGGCCCAGAGACCATAAGACCCATTCAGAATGCCTGTGAGTTGAAAACTTACCA
TAATGACACTAAGATACTACATCGCCTTTTTTACCCTTCTCTAGTAAACTGGATTTTCTA
ACTATTAAACCTGAACAGAAAGCAGAACTTAGATGCCTTTCATTTAAGAAATCCATATCC
GTTTGTAATGTTTTTATAAACTATAATAAAGATGATTATGCATATTTGTGTGCTTCGTTT
TTATGTGGAAATGTGATCGCTGGCAGCTAAAAAGCATTCTATGGCTGGAATTGCTTGTTA
GAAAAAATACTACAGTTGATGCCTGATTGGTTCTCTTTAGCTTAGTATTGTCACTTGTTT
AGTGTTGGGAAAATGCATATTCTGACTCACTGTTACATAGGGCCCATGTAATAGCTCCTT
GGGTAAATCTCGTTTTCATTATAGTCAGATAGCTAGTTAAATTCAAATGTGGGAAATGGT
TAAGGCACTGGTCTCTAATGAATTTAGGTGTGTTCTCAGATGATACCATAGGCCGCTGGA
CGTGGCTTTTGAATGATAGATCCAAGTTCCTAATTGGACCAGTCTGTCTTCAGTTTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved