Equus_caballus Locus Poly:0:SNORA71
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:0:SNORA71
Equus_caballus
Poly:0:SNORA71
22
SNORA71, SNORA71, SNORA71, SNORA71
1001..1132, 1341..1455, 2276..2408, 4065..4199
5199
CAGGGCGCCGTGCGGAGCCCGGGTGAAGCGGGCCGGAGGGCGCCGAGCCCGCGATCCTC
TCCGCCCCACCTCCTCTCCTCCTGGCGTTCGATCCCCCAGGGCCCCTCGGCGCTTCCTAC
CAGGTGAAGCGTCCTCACGGCCGTTAAGCCGTTTCTCCCCAATAACCTCTCAAGGGATGT
GTTAAAAGGTCCCTTCTGCAGACCTGTTGGCTGAGCTTTGGATTCAGGACGCCCCCAGGG
CCTCGAGGGGCAGAGTCTGGGTTCCCGCCCCCCTTGGCTCAAGCCCCTTCCCCTTTTCTC
CCTGCCTAGGCCCTGCGGCTGCCGAGCTCGCGGAGAGATGGGACCTCGGCCTCGGACGGC
TGAGCGGGCTCTGCGTCCGCCGGCGCCCCCTGCTCTCCTGCGGGGCCCTGACCCGCGCTG
CCCGACGCGCCCTCCGTGTCCAGCGGCTGAGGCTGTGCCCTGGTGAGAGCTGCGGCTCCT
GAGCACCTTGAAGGGGGCTCGGTGGCTTCCTGCTGCCCGCAGAGGGGGTGGTCCTGGGGC
TCAGGTGACTTCTGAGAACTGTGTTCGAAGCCCTTGTGCAGGAGGAGGCCTGGTGTAGTA
GGGGGGCTGAGTTTGGGGTCAGAAAGGCCTGAGCCCAGATCCGGACTCCGCTCCTCGTTA
CCCGGGTATCCTGGGGCGAGTTACTTCATGCTCCTGAGCTTTCCTTTCCTTCAGGTAGGG
AAACCGCAGGAGCTCTGGGAGGACAGAGGCCTTGTCTGTGTTTTTCTTTGTTTTTGAAGC
CACAGTGCTTGGCGCCCAGTAGGTGCTCAGTCAGTATTTGTGGGGTGAATAAAGAACTGA
GGCATGTTTACCAGAAGCTGTTCCTCCTGTGGACTGTGTTGATGCTGGGAGCTGGCATCT
TTCTATGAAGCTCTGATAGCGCTCGGGGTTCTGAGCTTGCCTAGGGGGACAGTGGGCTAA
CGTGGGCTTCTCTTCCTGGCTCGCCTTCTGCCCGCTTGTGCCCCTGCATTCGAAAGTGAT
GTGGGCTGCCTGTGCCCTGGTCATTGATTGTGCAGGGAGAGGAAGTGCTGAAAGCCTTTC
TCTGTGTTTGGAGGGCCCATCCTGTCCCTTCCAAACCCTGGAGCTTTCCCACACCTCCTC
CCCCTGCCACCTTTTGGATGACCCCTGTCCCCTGGGATCTCATTGAGTGCTCTCTGCCTT
GGCTCCTGGTTTCTGTGAGGCTTTCAGAAGGGGTAGTGAGAGTGGGTCCTGCTTCGGGGA
ATGCGTGGGTTGGTTGTGGAGCCACACCTGTGGTTTTCTGACACTAGTCTCCAATTTCAG
CAGTGCTGAGTCCTTTTCTGCCCCTGTGTGAAGTGATTACAGCCTGCCTGTGCCCTGGTT
GTTGGTAATGCAGGCAAAGGAAAAGTTGGGAGGTTTTCCTTGCATTCAGGACATCCATAT
GTGTCCCTTCCAAACGAGACAGCCTTGGGTGACTAGGCAGTGACCGAGCATGAGGATGGA
GGGAGACAGGCTGTCAGTGCATTCACCTCCTGACACCTGGATTCCCCCGGGGTTTTCCTC
TTGGTGAGCAGAGTGGTTTCTGGGCATGCTGTAAGCAGTGCCAAGTGGGCAGATCATGTG
CTGGCTTCTTGTGCCCTGCAGGAGTGTCACGTGACTGCTGATCCGCGTTCATGAGAGGTG
TCCTCAGGGAGAGCGTGGATTGTGAAGTCCCAGGTAAGTGGTGTCCTGCCTGGTTCTCTA
GAGCTCAAGTCTGTGCAGGCTGCGAGGCCACAGGTGTTTAGCTTATGAGGTGTGGGGAGA
AAGTGCAGGTGAAGGCTGCTTCCCAGTGCCACCAGCTTTGTCCCCTTGAGCCGGCAGGCA
CAGGTCTGGGCCTGCTTCTGAGAGTCCCCAGTGAACGCCACTATGATGTTGAGAGGAAAA
CAGCAGTGTGCTGGAGTAATGGACAGAGGGCTGCATTTCAGAGTCAAACCTCCATTCATA
TTCAGTGACCAGCTGTGTGTGCTTCTGTAAGCCTGAGTCTCCTGTCAGGTGTGCGGTATT
GGTACCACTTACTCCCAGTCTTTCAGAAGCCAGGGATTCTCAGTATTTGTGCTGTTAGTC
TTCTCTCCAACTCTTGGCAGGGAGTGGTAAATAATCTCTGTAAATCAGTGGTAGCTGCTG
TAATCTTAGGCTGAAAATCTGGTCATTGACTCGTCTGCACATCTGTTCCTAGTTCACGCT
CCCTCCCAGGATGCTGGAAAACCTCTCTCCTCGGCTCACTCATGGGCCCTTTCTGCACCT
GCATTCGAAAGTGATCGTGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGGAGAGCAA
ATGCTGAAAGCCTTTCCCCGTGTTTGGAGGACCCATCCTGTCCTTTTCAAACCCTGGAGC
TTTCGTACACGCCATCCTTCCTGCCAGTTTGTGTGACATCCTGGTACCTGGCTCTGGGTG
GCTCCCTGGGCACTCCTCTTGCCAAGCAGGGCCCTGCCTCAGGGAGTTGATGTTAATGGG
TTCATGGTCACTCCCCTCCTGGAAGCTTTCTTGGCCTCCCCATTGCACCCCTTCCTGCAT
TCTTGGCCCCGCCCCTCAGAATAATCACACCTGGAAATTGGGGGCTTACTTCTCCTGCCC
TGTGCTGTAAGCTTGAGGGCATTGCCTGACTTGTAACACCTGGACAAAAACCCCAAACAA
GGAGATGGAGGTGACACATGGTTGTGACGTGATAGCGTTCATCCAGTTGTGGAGTGTCTG
GGGAACAATGCCCTTGAGCATACCCGCCTGCCGAGGCTGAGGCAGTCTCCTTTTCTTTTC
CCACTGGAGTGCTGTTTCTCTACTGAGGGGTGGACTTAATTACAGTCCCCCTTGAGTCCT
GGCCGTGGGCAGGGCCCATGGTCCACCGGGGGTGATCTTCCTTCTGCCCTTAGCTTAAGA
GACAGGGACTAGTAGTAATTGAGCTGGGCAAAGCACAATATAGTTGAGAATATACATAAA
GCAGCCCTTACACTAGTTGGTGGACGTGGGGCCCTCCCACTGCTGGTTACCCCTCCCAGT
CCATTCTAGTCGCAGCCACTCAGCTATGGCACTCTCCCCAAAACCAGGCCTCGGCATCCT
TTAACAGACTGATTAGCAACAGACTGATCACAGTTGGCACATAGGATAACATGGATGTTA
CTTCTGTCACAGGTGATCTGCAGACCCCTTCCTAGAGTTAAATTGTTCTTGTCCTAAGAC
AGTAGTATGGCCATTGAGGTGCCAGTAGTAACAGCCTGCATTTGTGGGTGCTGTAATCTG
CCAGCCACTGCCCACCAGGGCCTGCTGTGAGTGCCCGTTCGTGCCTTGTCTCTTGCAGAT
GTGTCTGCAGTGCAGAGGCTTCGTGGGAGACATCGTCTTCATATCAGCCAGGTGCTAGAC
CCTGGGCCCTGCGGTAAGGTTTTGGGCCGTTCTCTGGATTTGCGTGTGTCTCTAAAGTCA
TGTGCATTTTCCCTGGGGCTTTGGTGATGATGTGAGGAGAAATGAGGTGGCAGGTGAACG
TGGCATCCCGTGAGTTCCCAGTTGTGTCCTGGCTGTGGGGCAGTCCCTCACGTGCCTATA
GGGGAGAGGCCTCTAGAAACTCACTTGGATAGAGGGCTCCCTGGGCATCTCCCTTCTGAG
GACTGGGCTGTCAGCAGCGTGCTGTGTGGAAAGCACGTGGATTTAGGCACCGGAGACTCT
GGTTCCACCTCTGGGCCCGTGCAGCTCTGTGACCTATTCTCAACCTCCATTTCTTCACCT
GAAAAGCAAAGCTGGGATAGCAGAGAAGGTTTTTAAAAAAATTTTCATGGTGATGTCGTG
ACCACATGATTCTGATCATTTCCAACCCAAAAGCATTTCCAATTTTTTACGCTGGAAGTG
TCCCGGCTCCCTATGGCAGGGAAGTTTTATGGGGTCTTCACAGGACACATCAGAAGCTAC
TGGGGCTCTCTGCTGGGCTGGGCCACTCTCCTCGACTCAGGCCATGCCCCAGGTCCCTGG
CACCAGCCTCCTGTCCTTTGTAGTTCTCTTTCTGTCCTTTTCTGCCCCTGCATTCGAAAG
TGATTGTGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGAAGAGCAAGTGCTGAAAGA
TGTTTTCCCCGTGTTTGGAGGGTCCCATCCGTCCCTTCCAAACCCTGAAGCTTTCCCACA
CTAGCTTTTCTCCTGCCCTTCCCCTCAGAGCTTGGGCCTTTGCTGGCCCCCATGTGCTAT
GGTGAGTGGTCTAGCCCCGTGACTTGTGGTTCACTTTGTCTTTTCAAGTTAAGGGTTGTC
TTGTCAGAAACCAGTCTATGCCTTTATGTTTGGACCTCACACTGGAATAAATTCAGATAG
TGCTGAAGGGCACAAGTGCACACTGTAAATCATGGGTTCTGCTTTATGAATTTATAGGAA
TGGAGGATAATCCATAATAATACATTATTCAAGACAGCTTGTGACCTAAATGCTTGTTTG
TGTGTCATCTTTGCTCCTCTACTCTTTCTTGAGCACAACTTGTGTCCCTTCTCCAGGAGC
TGTCAGTAATGTCCAATAAGTGGAGAAACAAAAATAACGTTAGGGGCCAGGCGTAGGGGC
AAAGAGGGAGTGATTCAATTCTGAGTCAGTAAAAAAAGTTCTCATTTGTCACGGTCTGCC
AGCAGCCCAGGGAGTTTTCTTGTCAGCCACTGATGAGAGAGGAGTACGTTGACTTGCCAA
CCTGTTTGTAACCCTCCTTTCACTGACTTTTACTCTGTGCTCTTGTGGTTTGTCTTGAAA
AGAGAAAGGGTCTCTTGACCCCAGGAGTTTATTAGAGAAGAAGTTCTCAGGCCTGTGGAC
CCTTGAAATCTGTATTTGTAGACTCAGGACTCCCTAGCTTGCTTTCTGGCTCATGTTAGT
GAGAATATTGTGTTGCTGCTTGGGCTCCCTGCCATGTAGTCAGGGATCAGCAGGTAGGCT
GACCTTCTGCCTTTCATTCTGTGTGCTGCAGAGGTGTTCCGTGGGAGGCAGAACCCTGTG
AAGGTACCTTCATCTGTAGACTCAGAAGATGCTCCACGGTGCTTCTGACAGTTGTGTCTT
GGCTCCCGGGTAACAGGTGAGGCGAGGTTGGAGGTGAGGTCAAAGTATCTATCCCATTGA
TCCTCCACTTTTGGTCCCATGGCTCCTGTCTGGTTCCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved