Equus_caballus Locus mono: SCARNA9
snOPY snoRNA Orthological Gene Database
Equus_caballus mono: SCARNA9
Equus_caballus
mono: SCARNA9
21
SCARNA9
748..1070
2070
TCCTACAATGATTGAGACAGAAGAATATTGCCTCTCACTGAGCTCTTCCCCTTGAACTT
TTGGGTTTATTACAGATGGTCATGTCTTCACGCTATTACTAGTCTCTGTGTGCCTTGACA
TCCCTTTCAGTTTTTCTAAAGGCTATTTACATCTCAATAAGTAATCCATTTATCAAAATC
TGTTTAAAAATCTTAGCTGAATATGCCTTGGGTTTTCTACTTGGATCCCCATTGCTTACA
TTGATTACTACCAGAAAATGAATATTTAAGATGGTATTGTGGAATTAGGTTATTCACAGA
TTTAGTCAGAGTGCAGAAAACTAACTTTTTTGAAGTAAATGGAAACTGGTCTTTAATTTC
AGGTGGGGGACACAACATTGGGGCAGCATGCCCCTGTGGCAGGTTTTAGTTATGGGCAAT
GTTGGTTAATAGGAATTTTTACATGCACTAGCTGCTCCAGCTGTAAAGGAGAGTTTAAAT
ATGAGATAAATATGACCTCCTGAGTCAAAGCGTAGGTAGAGAATCAGAGAGATTCAAATA
ATCCTTTAGCTTATAGATATGCAGAACAGACATGGCTGAAAAGCAGGCTTAAAGTTTGGG
TTACAGAGTTAAAATTCTGGTAGAATATCCAATATTCCTAAGACTTTTAGGTGAAGTGTA
GGCCACAGTTCAAAGGAGAGGGACGTGCGTTACGAGAGAGACACATTTGAGCCCACCCAG
GAAAACTATTTTGAAAGCTGAAATATCTTCTCTGAGATCTGCTCTTACTGAAGTGGACCA
GTGATGAAAATAGCCAAATCCGAGCACCAGATGAGCTTCAAGTCTACCTGATGAGTGATC
TCTGAGTTCTGAGAAGCAAAAGCATAGAGTACAATATTGGCTCATGTCTAGGGTAATGTG
TGTGTGTGTGAGTGTGTGTGTATAAAGACGGCAGTGGATAACTGAGGACTTGTCAATAGA
TAAATGAGTTTGGGGAGGGTGATGTGTGTGTATGAAATTCTGAGCAATGATGAAAAAAGG
TTTTACTACTGGCCTTTATAACTATGAAAGTTTCGACACAAGCTGAGCTCAGAATTGGAA
AAAAAAAGAAACCTGAAATATCAAGGTAATTTTCTTGTTTTTTAAATTTTTTAAATTTTT
TCTTTTGAGGAAGATTAGCCCTGAGCTAACATCTGCCACCAGTCCTCCTCTTTTGCCGAG
GAAGACTGGCTGTGAGCTAACATCCGTGCCCATCTTCCTGTACTTTATATGTGGGACGCC
TACCACAGCATGGATTGACAAGCAGTGTGTAGATCTGCACCCAGGATCCAAAACTGGTGA
ACGCTGGGCCGCCAAAGCAGACCGTGCAAACTTAACCACTGTGCCACCAGGTGGGCCCTC
AACTATTATGAACTCAAAAAAAAAGCAAATGTAAGCCATAAAAAAAAAAGTCATACACTA
GACTGTGAAACAGATCACAGTAATTTTTATCAACATTAATGTTTTAAAAGAGAAATATGC
CAGGGGTTTTAAAACAAATCCAAAATCAAAATAGTAAAAAAAAAAAAAAAAAACAGAAAG
AAAAATAATTATTCCCCTAGGAAACCTTTGATTGATCTGGGAAAATAAAGGATCATTATT
ATATTTCAGTCCATTTTGTTTTGAGTCTGGTGCAAAATAAAACATTATATATTGAAATCA
TTGCAGCCTCGGATGACCTCATTGTTAAGAGAGAAATTACAAAAAAATAGACAGAATAAT
AAGGCAATACTTTAGCAAAAAGATAAATCAGAATAAATTAACAACTAATATCAAATCTCA
ATACATGAGATTTGAAATGTACAAATAAAACACATTATTTGAAAATTTCCAATCTGTCTA
GTCTAATCAAATAAAAAATAGAAAATAAATAAAAATATAAATAAAATGATATAATAACAT
GGCAAAGAAAACTAGACGAGGCTAATATTTATTGCTAAACCTAAACTTGTCAGTGGAATT
GCTATTTTCCTTATGAAACTTTTTATATAGAAAATGATTCAGAAAACAGTAAACAATCCC
AAATGCGCATTCAATAGCTAATGTATAACCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved