Equus_caballus Locus Poly:15:SNORD65
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:15:SNORD65
Equus_caballus
Poly:15:SNORD65
11
SNORD49, SNORD49, SNORD65
1001..1071, 1528..1598, 2465..2537
3537
AGGACGGAAGTGGATCCAGATAAGACGTCTGCTCCCTCCTTAGCGGCCATTCTAGAGGA
GTGAAGGAGAGCTGTAAGCGCGGCAGAGGTGTGAGAGGCTCCGTGGATATCTTGAAATAG
TGGTGGGGAGAGAATAGACTGGCAACGCTTCTTAGAATTAGGGCTAGCTGCTATTTATGA
ATGCTTACTGCGCGGCAAGCTCTGCACGGTTTCAAGTGTTATATCATGGGATCCTCACAA
CAACCTCCCGTGGTGCCGATATCCCCACGTACCAGATGAGCAATCGGAAGCTCACAAACG
CCAACCAATTTGCTCAAGACCACAGGACTGAGCAGCGGGGGCGGGACAACATCCCGGCAG
CCACGCCGAAGGCCCGCGCAGGCGCCCTGGACCTCGCCAGGCGCCTCGTGACCCAGAATT
CCCGGGGCTGTGGAAGAGACCATGGGCTCTAAAGGAGGGGGTGTCCTTGGGTGGTGAGGC
GGAGTCTGTCCGTTAAATGTGCTGGAGGTTCCCGTGAGTCTTTGCCAGAACCACCCCCCT
TCTATGAGGAATGGAATGTTCCAGGCCCTTAAGGGCCTGGGACGCAGCTGAGGCGACCTT
TCTGTTACGGTTGTGTTAGAGGTAGCGTGTCTGTGTCGGGCGCTAGTGGCTGGTGGCGAG
GCCAATGAGTTAGTCTTTCTAGTTTCTAGAAAGATGTTTTCGGGAAGCTCGCTTGGAGAG
CGAGGGCGACTCTGTAACGGCGCGTCTCGCGGCGCCGTGGCCGGGGTCGAGCGTCTCGCA
GGGCCGCGCTGCGCCGGGCCTCATGGACCACGTGTGTTTTCGGAGGGGCTGCTGCCCTCT
CGGGAGCCGAGGTCTGGAAAGGCCGGGCCTCTGTTCCCCAGGCCTTCCGCGGGGAGTGGG
CAACCCCGAGAGAACTGGGTGAGTGGGGGTCTGCCTGCACGCACCCAGGACGCTGCGCGA
GGGGGCGGTTGTACTGGGCCCACGAGGAAGACTTGCTTGACTGTCCTGATGATACTGCTA
TTAGGAAGTGCCGTCAGATGCGATAGCTGACGACTTTCATGCCTGTCTGACCGCAGTCTG
TTGAGATCTCGACTGTTCACTTGAACGTGACTGCCAGAATCTGCCCTAAAACGCATCATT
CCTTCGTGTTTCAGATGGCAAACCCACTGCTGACTATGAATGGGAGCAGCATTGCACCCT
GGGGTAAGTTCTTAGTCTAGGTAGGGTTTAATACGTAATTTAATTGTATCGATTTTGTTG
CCGTAAGTGCGCTGAAATTGCCTAATTTAAACTTGCAGTTTTTATGCATTTAACATCATT
ATACACCACCTCATTGCACAGGGTGGAATCTCAAATAGAGATTGGGGATGGCTGCTGCAA
ACCTAGAACTGTACTTAAGCCGCAGCTATATTCAGAAACAAACTTCGTTAAAATGTCTCC
TGGCTGCTTTTAAGGCGATTTTAGTTTAATTCCGAGAAATGTCCAGGCCTCTGGAGCGGT
ACTGCTGGGGAGTGGTGAGGTGCTTGACTGCTCTGATGAAATCACTAATAGGAAGTGCCG
TCAGAAGCGATAACTGACGATAACAATTCCTGGCTGACTGCAGTCAACAAATCCTCACCA
GTTGCTGGTGCGCAAAAATAAGTTGGTCTGAACTGACCCTTAATTTTTGTATTCACCCAG
GTTGCAAATTAGTGAAGGGTTGACACTGATCACCAACAGCTGTGTATTGGAGTGAGGTGC
GATGGCCTGCTATGAGGTAAGCTTTGGTCTGTGCAGAAGTTAGTGATGGAGTACGCCTAC
CTGTTGAGTTGAATCATGTGAAACCACTGTTAGGTTAGACATTGGCAGTTTGGTCTGGTT
AACCGAATACCTTGTATCAGTGTAGTCCTTGACCTTTATTGACAATATCCCAGAGACACT
GCTTTTGGTTCATGGTGGCAGTGGAACAGAGTGCAAGGCGAATGCAGGAGTTGCTTTTTA
CCTCATGACTGTATAATCGTGAGCAAATTGCCTATCTGCTGAGCTGGGAGTTTTCCTCGT
CCTTGAAAATTGTAGCTGTAGGTTTGTGATACTTAAAATAATGTGATTGAATGGAGGTTA
CAATACCCAAAGAAGCCAGTTAGGACTTGAACGCTTATGGCTTAGTTTACCAAAAAGCAC
CTCCAAAAAGTTTTTAAGGACTCTTGTTAGGATGGACTTAAGTTTGTAAATTTGTGGTTG
AGGCTGTTATCAGAACTGACTCTTACGCCTTTGGCATCTGTTGTCTGTCTGGGGTGCCTT
AATTCATTCCCCCAGGTTTTGAGTGCTGAAGAGTGGTGATTAGCAGTGCAGAGTTTTAAA
GCCAGTGGCAGCAGCAGCTCAGCCCCAGAAAAAGGTAAGCTTTGATCTGGACAATGACCC
TATCCCCCCCACCCCATGAATAAGCAGCTAGTTTTGTTAAAAATAGATTCACAGAAAAGG
ATATCAAATGATGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTGGTGGTGA
ACCTACGGTTTTCTGAAGATATCTTTTATGCTGTGAATGACTGTTGGGAGTAGAAACTGA
GATTGACATTCAGTTTCTTTGCAGGCTGTTTTCCCTGATGATGGTCAGCCATGATGCGGC
AGGGGCAGAATTGAAAGTCCCAAGGACCAGTGGCCACCGTGCATTTGGACGCTAAAAGCA
TTTGTTGTAGAAACATGCTCACCTTGTGTTGAGTATCAGGCCATTCTTATCAACAGGAGA
GCCAAGAAATGTATTCAGCAACCTTTTTCTACGATAGGCGCTTTTGGTGTTAAGTTCATG
AGTTTTCTAGTATTGTCCCTTGCACAGAAGGAGCTTCTATGTTTTTGAATACTGTATAAA
TTATGTTGGGTGAGGGTCTGAATTCTTAAGCTGGGAACTTCTTCCTGAAATTAATATTTC
CATGCAATTACTATAAACTAATACTGTAATAAAGGATGGTCTTTGATATTGGTTCTTAAA
AACGTGTATTTGAAGAAAAAGTTAAATTTGACTACTGTCAGATACTAACAGTCCGAGTAT
TAGTACTTGCCAGCTTCCCTCTGGTCAGTCTAAGCTGTTCTCCCTCTGTAACACCTTTAG
ACTTTGAGGGCATTCCAAAGCATGTAAGGCATCCACATACTTGATTCCAGTCTCTGTCCC
TTCACATGGCCTTTCTCTACTTCCTGAAGTGCCACACCTGCCCAGCCAAACCCTCTGGCA
GTAGCAGCCAAGGTCCCATAGTGTGGCTCTTCACCTAATCCCCACTTTGCTGCCTCGTTG
GGTTGGGATCCCACTTACCTGGCATGAGACTAGAGGTCTGTCACGCTGTGTGCCCTTCTC
TAGCCATCTGCTGTTTGCCCGAGGGGTCTGGTACACTGGCTTTGGGCACCCAGGCCAATT
TTCTCTACCTCAAGAAAGATTGGTTTCCAGTCTCCCTGGACTTGCTGTCTGTACTTGAGT
CTAGGATATTTGGGCCTAGGGTTTACTGTGGCTGGAAGGGATTTTATATTTTGTAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved