Equus_caballus Locus Mono:16:SNORD113
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:16:SNORD113
Equus_caballus
Mono:16:SNORD113
X
SNORD113
1001..1071
2071
AAAGGAATGGAGTTGTGTAAAACCACTATGAACAACCAAAAAACGTACTTCATCTCTAC
TTATTCTTATACTACTACTGCAAAAACAACCCTTCAACAAAAAATTCAGTTCTTAGTACT
TGTTAATTTCTCTTTTGAGTTAACCAAGTGTACTGGTTTTGAAAGATCCCAGGGGATAAA
AGTTAGCCCTAGTTAAATTTAAAGCTAAAATATGGATTTTAGTGACTAAAAATTAATAAT
TAAATGTATAGCAAAGCAGTAGATGGGCACAACTAGGATTATGCTGCTTAAACATGTAAT
ATTTTCATACACTGGGCAAATGTCCTTCCCTCAAGAAAATGTATTACGGTATTACATGTT
TCCTAACGTGTAGCATTCATTCATACAGCCAAAACAAGGACAAAGAGAAAAAAATATCAG
TCTGTCTTTGTGACTTGCTTTCTCTCAGCCATATTCATATTGCCACCAATATTTTCACTT
AGTGGATAAAATAGTTCTAGAATAAAACACCTTATAGGGTAAAAAGTACTGAACAAAAGT
GAAGCAATGTGGCTTCTGGTCCCACCTATTCCATATAGTTTCTCTGATCCTTCATTTCCT
CATCTGAAAATGAGGAGATTCATCTATTCAACAAAAATCTCTATGATGGATTATATATTA
AATCACTTTCCAAATCTAAAATTCATGATTCTCTATGCATTATATATACACATGTATTTT
TTAATCTTTCACATCCCCTCTATAAAAATGAACTACGGTATTCACTATCCTACCCACAAA
TATATTTACCATTTTCTCTTCATATTCTGGGTCCATTTCCTTTTCAGATTTAGAAGCTTT
AGCAGCAAGTTTGACTTGAAACGGAGAAACGTTTTTCTAGAATTTCAAAGAAAATAAATC
ATCAAATTGCAAAGCAAGGTCTTAAAAGTGGTCAACATCCTCATTTGAAGAAAGTAAAAA
GTAATTAAATACTAAATAAATAAATCATCATGGGCCATGCATGGACCAATGATGAGAGCA
CGTCATGAAGCAGGGTTTATGATTAATCCAGTTCTGTGCACCTGAGGTCCAATAAAAAAA
TCCAAGAAGTGTGAAAGCCAGAGAAATAACATTAATTAAAATAAAAATCAAAAGGCGAAA
CATTGAGTCTTTTCACCTATTTTTTAATTTACAGCATAAGAAAGTGTATAACCATTGAAC
AGGAGATTTAAAATCTAGAATATAATATTATCAACCACAAACCAAAGGATTCGAGGAAAG
TAAATATTAATTCTCAGAAACACTTTTTTATGTAATGGAAACAAGCCAGACTTTCAAAAG
AAAAGACTGGTTTCTGTTCCTGAAAAGACACTATTTCTTTTATTGTCTTCATAGTCTAAT
TAAAATATTTAAACTTCTATATGTAAGGCAATGTAACCATTTATATTTAAAATAATGAAA
TCTTACAGTTTCAAACCTTTGGCTTATGTTAATTTCCTTCAACTGGAAAGAAAACTATTT
TAAACTATTTATATTACACAAATATTTTGTAGAAGCAGTTCCTCAGGGCTATTAATTATT
AACCTTTGATATTTAACAACTTGTAATTTATTGAAAACTAACATGAATCCGCTATTTAAA
AATACTGTAATTATATGGGGGTCTCATGCAGCCTAATTCTCTGTAAAGACAAGCTCATAC
TTGTAAATATAGATAGATCTACACAATACACCTTCTTCCCTGTAAGAAATCCAGAAATAA
TAAAATAAACACAAATCTACTCATTAGTACCAAAGCCGGGAGTATTTCAGTTTTAACACA
GACTTTGCACAAGTCAAAACACAAATCTGTTGTGAAAACTAAAGAAATTATGTCCATTTT
ATTATGGCTTTCGTCAATCTATTCCTGAAAACTTAGGTCATAAATCAGCAACACAGTGTC
ATCTTAAACATGAGAAAAACATGGCTCCAAAAGTTAATGAATACGTCTTCTGACATTTAC
TAAAATTTCTATTTTGAGGAAATCCAAACTAAGATTATGGAATTTGACCCTGGTCAGGGT
TCTGATTTGGAGCACTGACCAGATATTGTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved