Equus_caballus Locus Mono:0:SNORA62
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:0:SNORA62
Equus_caballus
Mono:0:SNORA62
6
SNORA62
1001..1133
2133
CCCTCCCTCTCTGCCTCTCTGCCTCCTGGCAACCACTAACCCTTCTCTGTCTCTCTGAT
TTGCCATTTCAAGAATGCTGTACAGATGGAACCATATAGTACATAACCTTTGAGATCGGC
TTTTTTCACTCAACATAGTTCTTTTCGATTCATCCAGGTTACTGCTTGTTCCTTTTTATT
GTGAGTAGTGTTCCATGGCATGGGGGTCCCACAGCTTGTTTAACCGTTCTTCTGTGGAAG
GACATCTGAGTTGTTTTCACTGTTTGACTATTATGAATAAAGTTGCTATGAACATTCATG
TGTAGGTTTTTGGTGAATGTAAGTTTTTATTTCTTTGGGATACATGCCCATGAGTGCATA
TACCCTTTACTTAGATTTACCTGTTGTTAACATTTTGCCCCATTTTCTTTATTGTTTGTG
TTCTGTCTCTCTCTCTCTGTCTCTCCAGACACACGTATAAACTTTTTTCCTGAACTGCTT
GAGAGTAAACTGCATACGTGATTGCCCCTAAATACTATAGTGAGTATTTTCCAAGAATAA
GGATATTTTCTTACATACCCAAAGATAAGTTATCAACTTAGTTAATTTATCATTGATACA
ACTTTGATTATATCTACCATCTGTTACAGTTTGTCAGTTAATCCAGTAATTAATGTCCTT
TAGCATCTTTTCCCCTCTAGCACAGGATCTAATGTAGGATCACACATGGTATTTAGTTGT
CCTGTTTCTTTTGTCTCTAATCTGGAACAGTTCTAAAGCCTTTCTTTGTCTTTCATGACA
TTGGTATTTTTGACAAATACAGTCCTCTTTTTTTAAAAAATGGGATGTTCCTCATTTGGT
TTGTCTGATGTTTCCTCATGATTAGATTCAAGTTATGTATTATTCTTGGCCTGAATACTG
CATAAAAGGTGTTGTTTCCTTGATAAATACATCTTATCAGATTAGAAAAATTTCTTTTTA
GTCCTAGTTTACTAAGAAGTCTTAATTAAGAATGGGTGTTGAGTGCACATTGTTAGAGGT
TGGAGTTGAGGCCACTGGCTGGTGATGAACTCGCAAGTATAGGGAGGGTGCTACATGAGG
GGCTGGGGTCTCTGGCCTGGTGAGTGGAGTTTGCTAGTAATACTTGCTACAGGTTAAAAA
AAGGTGTTTGACTTGATCAACGGGCCTTTTGGCTTCTATCCTGATGGTGATTTGGTTCTA
TTCTGTTATATATGAACAGATTTCAAAATGTGAACCATGCTTGCATTCTTAGAATAAACA
TTGTATACCATGCATTCATGGTATCTAATTTTTTTAATCTAATGTTGGATTAAATTTTTT
ATCTTTTTATTCTGGGTTTTGCATTTATGTTCATAAAAATTCTTCTGTATTTCTGTATGT
GAAGGAGTGTGTGTTCTGTCTTTGTCAGATTTGGTATCAGCATTATTTAGCCTCATAGAA
TAAAATGAAAAGTTTTTTTAACGCTCCCCTCCCCAAAGTTTAAATAACATTGAAATTACC
TGTCTCTAAAACCATCTGGGCCTGGTGCATTTTGCAGTGTGGATGGATCTTTGTTGGCAT
TTTCTGGTTCCTTCTCTGGTTAAAGATCTGTTTAGGTTTTTACCTTTTCTTAGGTTATTT
CCCTGTCCTGCTTTCCATTGCTCTTAGGATAAAGACCCAGGCTTTGGGGCTGGCCTAGTG
GTTGGGTTCGCGCTCTCTGCTTCAGTGGCCCAGGGTTTCACAGGTTTGCATCCTGGGCAC
GGACCTGGCCCCGCTTGTCAGGCCATGCTGGGGTGGCGTCCCACGTGCCAAGGCTGGAAG
GACCCACGACTAAAAATATATACAGCTTTGTGCTGGGTAGCTTTGGGGAGAAGAAGGAAA
AATAAAATCTTAAAAAAAAAAAGACCCAGGCTTTGTATTTGTGGTCCTGTACTCTTTATC
CTGCCTAAGTGTTGTCACCATTCATCCTTTTATTTCATTACTCAAGCTAGATTTTTCCCT
CTTCTTATGTCCATACAGAGTCTTACAATTCTGTTCTTAATTTGCATTTTGAATCTGTCT
CCTTTTTTTTCATCCCTGCTGCTGCCTGGACCCTTCCAGTTGTCTTAACAGGTTTCTCAG
TCTCCAGTCTCTCCTTCCAAGCCAGCCTCTGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved