Equus_caballus Locus Poly:12:SNORD50
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:12:SNORD50
Equus_caballus
Poly:12:SNORD50
10
SNORD50, SNORD50
1001..1070, 1319..1388
2388
GGCGTAGGTTTGGGTTGGGGGCTGCAGGCTTTGAAACGGTTTTAGAGATTTGAGGTTAA
CGTTGCTGTGTGTTGAAAGCCTGCACGTCGGAAACACGCAGCCCGACCGCCACGTGCCCT
GAGTCCGGATGGGGGCAGCCTTCGAGCCGAGGCTGCTGCTGATGGCGCGGAAGCTGTGCG
CGGCCTGGGTACCGAGCCCGCGCAGCCGACCGGCTGAGCCTGAGCGGCGGCGGCGGGAAA
ACAACTACATTTCCAGGATTTGGGGCGGGAAGTTACTTTTACATTAACAGCAAGAGGCTT
TTATTACTGAACCGAGTCTTTCTCCCGTCGCCGGATCGAATGTTTATTTCCGTGGGTAGC
TCCCGACTGTGAATGAGGCTGAGTTGTAGCGTGCCCAGATGGCGCCATGCGCTGATCGGA
TTAGTGAAAGGGAGGGTTTAGTACTGAAAATCTTGCACTGTGGCGTTCTCTTAGAATGCT
TAATTTTAAATAGGTTGATCCACCGCAGGAACGATGGCTTTCAGTGTAACGGAACTGTTA
CCTGGAGATGCTAAGGTGGGTATTGTTGAGAGCTTAGTTTTTAAACTCGAAAGTAAACCT
GTTGATTTATAGGAATAGAAGGTGGTACATCATTTGAAATTTGCTTTTTTTTATTAGATG
CAAAGAAAAATTTCAAAACATAGGAGAGAACATTTGCTGGAAAATTACTTAGCTAAAACC
TGACAATCTTACCAGGTATGTGTTGGACTAGTACTTTGTTTCAGCATATGTGTGGTCCAT
ATGTAGATTAAATGAAAACTTTTTTTGCCCTTGAACAGCATCCTGGGGCTTGATGAATAC
TAATGAAGCTGTGGACCTCATTGACTAGCAGCTTTATTATGAAGTAAGTTGTGTGGCTTT
CAAGATCTACTGTAGTATTTCTCTAATATAGTACTTGTCTTTTAGCATTGCTTTGGTTTA
AGGTGAATGTCACAGTAACATAGCTTAATGGATTATGGTCTAATTCATGATGAAACCTAT
CCCGAAGCTGATTACCTGAAGAAAAGCATGTGCGGATTCGGCTTCTGAGATAAGACCAAT
GTGCAGATATGAAGTAATTTTTGTTGCCTGGATTTTATAACTTTTAGAGGGTTCTGTTAG
GTTATAAGTCTTGGTGGGGTGGCCCTACTACTCCACAATAGTGTGTTTTCTTTTTTCTCT
GCCAACAGTGAGGGGTCGCTGTCAGCGCAATGAAAGAGGCCAGTTTGCTGGGAAGTTCCT
CAAGTGTAACCGTTTCTGTAAGTGGCGATATTAATCAGTCAGTATTGTGTCCTTGGTCTT
ATCGATGATGATCCTATCCCGAACCTGAATTTCTGTTGAAAAAACTTATACGGATCTGGC
TTCTGAGATAGACCATTATGAGGACAATAGTATTTACGTAAGCTCTTCTGATGTTGATAG
TCTTGTAAATCTCAAATGTTTTCCTTTTTCTAGGGCTAGTGCCATGAGATTTACTTGACC
TATGAAAAACTGGTGATCAGGAAAAGCGCTTCGTTTTACAGACATGGAAAGAAAACATAC
AAAGCAAGACGGATTATATTGGGTTTTAATTTTTTAAATAGATTCTGGACCAACATAAGA
TTCGAGGCATTTCTAATTATTCATGTAACACCCTCCAAGAGTCAAAACCTGTTAACCAGT
AGGTTACTTCCCAGATCTTTCTACTTTGTAAGTACAGGCATACATGTGATACTAGATATT
TCTGATACAAAATTCTTTTTCAGTTAACCAGCCTTGTAATCAAATTTTTCTGAATGGATG
TTTTGCCTTTGGCCCCGTTTGAATATAAAATGCATAATTGTAATTAAAGCTGAGTGAAAG
TTTATACTGACTCTTGTGGGGAAATCCTCGGTAAGGTTTTTATGGAGAGAACTGTTTGGC
AATCACAAGAATGAGGAGAGGTGGGAAACCTTGGCTTTGTATTAAGTATTGTCAAAATTA
ATGTTGGTGGAAGAAAAATGTCAGGCATCAAGGTAATCAACCTGATTATTAATTAAATCC
TGGAATGTTTAGTCCTAATGTAATTTCAAAGGTTATTGAAGGTAAAAAAAAAAATGGGGA
GTAATACTTGGAATAAAGGAAGAAAGCACAGCATAACAAGGGTCAGGAGGGGAGGTTATT
GATAAATAATCTGGGTTAAAACTAGTCAAACATTACACAGTATGGATTTAGGGTAAACAG
TAATAGCATCTGATCTAACTCAGGTAGTTGGGCCTCATGCATGATCATTTTCCGTAAATA
GCTACATGAATAAGTTGTTCCCAGGCCCGTATTTAAATGTCACTCAAAAGCTAATATTTT
TGTTGTCTTATAATGAACTGTCATCTTTTTCCTAAAGTGTCTTGTTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved